Ornithorhynchus_anatinus Locus PRDX3
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus PRDX3
Ornithorhynchus_anatinus
PRDX3
Contig14978
SNORA7
7286..7429
10962
CCTTCGGACTCCCGGGCCCGTGCTCTATCCGCCGCGTCATGCGACAGCATTACTGCTTC
GTACCTTCCCAAGCGCTTAGCACGGTGCTGTGCGCCTGGTAAATGCTCAATAGCTGTCAT
TCCTTCATCGATTAACTCCATCTCATTCGAAGTACCTCTCTCCAAGGAGGACCTGTATCG
GTCGGCTCATGTCGGCCGTGTGACTCCGGGCGAGCCGCTTCACGTCTCTAGGCCTCAGTT
CCCTCCTCTGGAAAACGGGGAGGAAGACGGTGAGCCCCAAGGGGAGCAACCCGATGACCT
TGCATCTCCCCCGGGGCTTAGAACAGGGCTTGGCACACAGTAAGCGCTTAACAAATACCG
TCGTCATCATATCTCAGCGTGGCTCAGTGGCAAGAGCCCGGGCTCGGGAGTCAGAGGTCA
TGGGTTCGAATCCCGGCTCTGCCCCTCCTCAGCCGGGTGACTGTGGGCGAGTCACTTGAC
CTCTCCGGGCCTCAGTTCCCTCATCTGTCAAATGGGGATGCAGACTGTGAGCCTCAAGGG
GGACCACCTGATGACCCGGGATCTCCCCCGGCGCTTAGAAGAGCGCTCCGCACATAGGAA
GCGCTTAACCAACACCATCATCATGATTATTATCTCACAGGCGGCGCCTCTTCCCACCTC
CTCCGGGAGGCCTTCCCTGACTCAGCCCCTCTTTTCCTCTTCTTCCTCCGCCCCCCCTCC
CCCCCGTCCCAGCCCCACACCCCCTCGATCTGCCACTCATTTCTTTTTCCTTCATTCGCT
CTCTTACATTGGGCGCTTAATAGGTGCAGGGCACTGTGCTGAGCGACCTCAGCCGTACAT
TTGAATAAGGGGGCTGCAGGCTGAATTCTGAATTTTATTGGTCATCTTGAGTCTCTTAAA
TCATTAATTTTTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGAAGGAAGATGGCGGCGTGGGCGGCG
GGCAGGATCCTCAGGGCCGCGGTGAATGCGGGCCGGACCGGGAGCCCGAACCGGACCCCC
TCTCTTCCTTCCCTCCCGGCTGTAGGTGCGTGTGCGAGCGCCTTTCGGGCGGGAAGCAGA
GTCCCGAGCGGCGGATGGGGGGGGGCCCACGCGCCCACGCGCCCACGCGCTCCAGGCGGG
GCTCGCCGCCGAGCCGCGGGGGGTGGAGGATTCGAACCCAGGACCTCGGAGGAGCGGCGG
GGCTCGGGGGGAGGAGGGCGGCCCGCGGACTCGGAGGGCGTGGGGTGACCTTGGGCCGGT
CACTTCTCTTCGCTCTGCCTCACTGACCTCATCTGCAACAATGGGGATTATCATTCATAC
TAATGCTCATAGGAATAATGGTGTCTGTTGAGCGCTGACTATGTGCCGCGCCCCGTTCCG
AGCGCCGGGGTCGATCCGAGGTGATCGGGTGGGCCCCCGTGGGGCTCCCGGTCTTCGTCC
CCATTTTCCAGATGAGGTCGCCGAGGCCCAGAGAAGCGAAGCGGCTCGCCCCAGGTCACA
CGGCTGAGAAGCGGCGGAGCCGGGATTCGAACCCGCGACCTGGGACTCCCGAGCCCGGGC
TCTTTCGGCAGAGCCCCGCTGCAGATGGGAGCCCTATTTCTTATGGCAGAAAGGCTTTTG
AATATCCTTGTCATCTGCCTGTCTGTCTGTCTCTGTCTGCTGGTTTCTTTTTTTTTTTCC
TCATCTGCCTTCCTGCTTTTAGTGCCACGAACTGATTCTAGCCCCCTCTTTGATTTGGTG
GTTCAGGTCTGGAAGCGTTTGCTTTCAACCGATGTCTGTAAAATGAAGTTCCTTTTGATC
GAAAATAATTTTTCTTTGTTGTTCAAAATCTCAGTTGAGCCCCTTTTCGCGTGTGGCATT
TTATTATTTATTCAGCATTTACTTCATGCAACAGCACTGGGCAGAGCTCTGGGAAAAGGC
GGAGTCTACAGGGAACTGACTACAAAGGAGCCCAAAATCGGTCTCTTGAGTTTATTATAA
ATGTATAAGCTTACGGGTTTTCCTGTTTTGTTTTTTTTAAGTCACGCATAACTCAACATG
ACTGTCTCCCCTGTTAGAATGTAAGCTCCTGAGGGCAGGGATCATGTCAACTTACTCTTG
TACTCTCCCAAGAGTTTGTACAATAATAATAATAATGTTAGTATTTGTTAAGCTTCTACT
ATGTGCAGAGCACTGTTCTAAGCACTGGGGTAGATACAGGGTAATCAGGTTGTCCCACGT
GAGGCTCACAGTCTTAATCCCCATTTTACATATGAGGTAACTGAGGCCCAGAGAAGTGAG
GTGACTTGCCCACAGTCACACAGCTGCCAAGTGGCAGAGCCAGGATTCGAACCCATGACC
TCTGACTCCCAAGCCCGGGCTCTTTCCACTGAGCCACGCTGCTTCTCTACTGTACAGTGT
TCTGAACACAGTAAACAACTCACTAAATACTATTGAGTGAAATCATTTTAGTAAAGTATT
TAGCTTGGCTGCGGGCAAAGGGATAAGCGTACTTAACGGATTGATGAGCAAAAGGGGAAT
CCCAAGGAGTTGGATGCTGAGGGGCAAGGAATGCCCCAAGTGTGGAATGTGGCCTGAAAG
AGGACAGGACCCGGGCCAGGATGGATAAGTTGGAAGAACAGAAGGAGAGCCTGGATCCAA
GGGGACGTTTGCCTATGAGGAATAGAAATGGTGGGAGGGACAGAGAAGGGGAGCAAGGTA
TAGTCCAGAGTGATCAGCTGAAAGACTTTGACTGTGAGCAGCTAAAGCTTTGATCCTTGT
GACTGAATGATGTGGGAGAACCCCAACCATGTCAACGTCCTTGCTTCCAGTGAGCTCACA
GCCAAAGTCTTAGCCAGCAAAAGATCCCTGAGAAAGTCGCAGAGGAAAACCTCACACACA
GTGCCGACAGGTCAGCCATTGGATTCACACTGAGGGAAACCAGGTGNNNNNNNNNNGCAC
AGTGTAATGACAATAATGTCGGTATCTGTTAAGCGCTGCTCCGTGCAGAGCACCGTTGTA
AGCGCTGGGGTGGATACAGGGTCATCGGGGTGGTCCCTCGTGAGGCTCCCGGTCTTCGTC
CCCATTTTACAGATGAGGGAACCGAGGCACCGGGACGCGACTCGCCCACGGTCACCCGGC
TGACGGGTGGCAGAGCGGGGATCGGAACCCGTGACCCCTGACCCCCCAAGCCCGGGCTCT
TCCCGCCAGAGCCGCGCTGCTCCTCCGAGCAGGCGCTTAACGGATACCGTCGTGATGGTT
ATCCCGCCCCCCGGGCCCGTCCTCCGTCCACCTCCCCGGGGCCCCGCACCCCGGGCCCTG
CCTCTGCCCCGTCACCCGGGGCGGGCGAAGGCCCCTCCGATCGATACCGTCGAGTAAGCG
GCGTCGATGGATCTTCGCCTCTCGCAGGTGGCCCGCCAGGTCCGCGCCTCTCCCCGGGCC
GTCGACGCCCCGCGGGCGGGCGCCGCTTCCGCGGAAAGGAAGTGCCCGGCCAACCCGGTG
CCCGCCGGGCCCGCGCTCAACCGACTGCCGTTCAGCACCAGTGAGTCTTTTTCTCTTCCC
CCCTCGGCTGCGAGCGCTCTCTCCTTTCTCCTGTTTCCCTTCCTTGCTCGCTCTCTTCTG
CGAGAGGAAATAATCCGGGTCCCCTCGGCTGAGGCGGCCCCGGGCACCTCTTTTACCGAG
GCGGATGGCCTCCTAAGGGGTAAGGCCTCTTTTTGGTGGGTAGGGTGGCACGGGTACGGT
CCTTTCGGCGGGCGAGAAGGCAGGTGGTCGAAATTAATATTCAGCGCCCGCGTGTCGCGC
CCACCAAACTCCGAATCGTTCGATCGTATCGACTGAGCGCTTACTGTGCGCCCGGCCCCG
TGCCGAGCGCTTGGAAGGGACGGGTCGCCCACGGAGAGAGACGGTCCCTGCCCGCGCCGA
CCTGGCTGACCCGCCTTGGAACCGAAGAAGCGGCGTGGCCCGTTCTTGTCTTGTTCCGTT
TGGCTTCGCCGTCCGCCTCCCCCGTTGGGACCCTGAGCCCGTCGTCGCGCCGGGACGGTC
TCTCCCCGTTGCCCAACTGTCCGTTCCAGGCGCTCGGTACGGTGCCGCGCGCCTGGCGGG
CGCTCGATAAAAGTGATCGAATGAATGGATGGGGCCTGGGCCCGCGAGTCGGGCCGTCCA
TCGCGCGCCGGTACCTACCCAGCGCTTAGCGCGTGCAGAGCGCTGTACTGAGCGCTTGGG
AGACCACAGCGGGGCGGAGTCGGTCGGTTTCAAGGATTGCCCGGGGGGTTAACGGCGCCC
GCCGCTTTTGAAAACGGTCTTATCCGGGGGCAGGATGGAAGTCGGTTCGTTCATCCGTTC
GGTAGTATTTATCCAGCGCCTGCCGTGTGCGGGGCACTGGACCGGGCGCTTGGAACGGGC
AGTTGGGCAACGGAGGCGGAGGCGAACCCGCAGAGCGTGTGCGGTTGATCGGATCTCTCG
GGGAGTCGGTACGTGTTAACCGATGAGTTTGATTCCACAGGGAGGTGCTGGAAGGAGCCG
TTAATAGTCGGGCTTTTTCCGTTTTCAGGCTCGTCCAACTACGTTCCCGCAGTCACCCAG
CACGCCCCCTATTTCAAAGGTACGGCCGTGGTCAATGGAGAGTTCAAAGAGCTGACCCTC
GATGATTTTAAGGGGAAGTATCTGGTACTTTTCTTCTACCCTTTGGATTTGTAAGTGTCT
CCTTTAATACTTTTATCTCGTGTTCCGAGTGGGTCATCTTCATTATTCTCGAATTTCTTG
AATTCTTGAATAATCTTCATTATTCTTGAATTATTCTTGAATTCCTTCGGGTCGCTAATT
GTCTCCCCCGTTCAGACCGTGAGCCCGTCGGGGCGCAGGGATGGTCTCCATCCGGTGCCG
AATGGTATGTTCCAAGCGCTTAGTACAGCGCTCCATAAGTACGATCGAATGAATAATTGT
AACTTGTATCCGGAAGGACTCCGTTGAGCCGCACGCGTCTGTTTCGAGCTTAGACCTGAT
AACGATGAAGGGAGGAGAATCGTTCCCGACTCTGATAGTGTTTTCAAACGGTGGAATTGG
AATCGAAGCAGGTTCGCGTCCCCGTGGGGGAGATAAGGCACGAGGTCGCCACACCGAGTT
GAGAAGCGTTTCCTCGAGAAAATGCCCAGAAAGAATTTCCCCTTCGGATGACTGACCGTT
GAACGGATTATTTCGTTTTTAAAGTCTTTTCGGGTTTCCGTGGCAAAGATGATATGGATA
CGTTGCAGTCCTTATTATCTCTCCTTTTTTCTCCTCAGTACTTTCGTGTGCCCGACAGAA
ATCATTGCTTTCAGTGACAAAGCTAATGAATTTCACGATGTGAACTGTGAAGTTGTTGCC
GTTTCGGTAGATTCTCACTTTTGTCATCTTGCCTGGATCAATACGCCGAGAAAGGTAGAC
ATCCGGGGTACATCTTTTTCTCGTGAATATTAAGTGTTTGTGAGGTTGTAGTCTGTGGCC
CCTCCAACTTTCATTTTAGAGTACGTTGGGATAGCCTTAAATGAAAAAAAAGCCAACAAG
AATAAAGAACAAGTCTAGAAAAGGAAAATTCCTGCAGTATTTTGACGTAGACTAGATGGT
AACTTTACTTGGGATATTCTTGAGTTAGACATAAGACTTGGACTTATTCAAGTGAAGGGA
CAAAACTTCTGATTCCGGTTGCCTTAAATGAAGCCTTCTGCTGCAGAGTGTCCACTGGAA
TAACGTGTGTGTTTGTGTTTTTTTTTCCAAAACTTGCTTCACACCGAGTGTGTTAAATAC
TTTAATCGGTTTATTATCTTGGTGACTTTTTCTGTCCAAACAGAAGTCGTCCGGGCAGAC
ACTCAACCTTGTTTCACGGTCAGGTTGTTTCAAGGATGTGCAGTTTTATCTCAGTAAACA
TTACGCAAAAATATAACGAAGGCTAAATCTGAAGGTTCTTCCGACGTTTCTTTCCCCCCC
CTTCCCCTTATTCAAAATATTTTTTAAAAGTATTGACCCACCCAAGAGAAAATGCTGGTG
GAAATTTAGGATCTTGGTAAATGACTTTCCTCGGCCATTCTCCGAAAATTGTAGTCAGCC
CCGCTGAAAGCATTTTGAAATGCATTTCATGGAAAGCCTGCTGTAACGAATCCTTTTTTC
TTTTATGCTCAGAGTGGTGGTTTAGGCCACATGAATATTGCAGTTATGTCAGATTTAACG
AAGCAAATTTCCCGAGACTATGGGGTGCTGTTAGAAGGACCTGGTCTGGCTCTAAGGTAA
AAGTGTCTTTAAAAAAAAAAAAAATTTGTTCTTAATAAAATTTCTCGCATTCAGTGACAT
AATGGTAAGACAGTTGGGCTTTAACAGGAGAAATAACGAAAAAGTATTGCTGGGGACTTT
TTTAAAAACTGGAAAGTGACTGAAAAAATATTACCCCATTTCAGAAGTGGCTATTTTTAA
ATTAACTGCTTAGACTAAAAGTCAGAAGAAATATATTCGCTTTGCCTTGGTATCCTTCTG
GCAAAAATGACTACTTTTTCTCCTTATAATAAAAATAATAATAATGGTATTTGTTCAGCG
CTTACTACGTGTCAAACCCTGTTCTAGCGCCGGGGTAGATACAGGGGAATCAGGTGGTCC
CACGGTGGGCTCACAGTCGTCATCCCCATTTTTCGGATGAGGTAGCTGAGGGTCAGAGAA
ATTAAGTGACTCGCCCAAAGTCACCCAGCCGATAAGTGGCGGAGCGGGATTAGAACCCAT
GACCTCTGACTCCCAAGCCCGGGCTCTTGCCACCGAGCCACGGCGCCTCTCCTTCTCCGG
CTATCTGTTAGGAAGGTCCAGTGTTGGGAAGCTTGTTACCCGGCGGTCCTTTATCCAGAG
TTGTAGAGTCTATCGAGAAACCCAATAAAGATCCCCGCTGACCACTCGAATCCACTTTCC
ACAACTCACCTCGAACCCCTTCGGTAGCCAACGGGTATATATCCCTTTTTTTGTCTTTTT
CTCGACAGGGGACTGTTCATAATCGATCCTAACGGCGTCATCAAGCATCTGAGTATCAAT
GACCTCCCTGTGGGCCGAAGCGTCGAAGAGACGCTTCGTCTAGTGAAGGCGTTCCAGTAC
GTGGAGACGCACGGAGAGGTCTGCCCGGCAAACTGGACCCCAGACTCTCCTACGGTGCGT
TCCCTTTGGGATGGCGGTTCTCAAAATCCCACGGAAAACGGGCGGCACCCGGAGAGCGTC
CGGGACTCCACCGGTCTCGGCTACGGGAGGGAGAGTCCGGCCAGGGGCGTCTTCCCTTCC
GTTCCCTGCTTGGGCAGTGGCTAGGGAGGGGAAGGCCGTCCGCTACAGGTCAGAAGTGGC
CCGCGCCGGGCAGCGGCGGCGCGGGAGAGAGTCGAGGGCGGAGGCTCGAGCTTACCGCGC
GGAAGAAGGCGGCGGTCAACCACCGCGGAGAGTTTTCTTGGTAAAAATCCGGGCGACGCT
ACCGGAACGATCGCAGGTGGGATGTGGGGCGTTCTGGGAGAGCGGTGTCCACGGAGTTGC
TACGGGCCGGAGACGACTGGACAGCGGAAGACCAGTAAATATTTGCTCTCGCAGCTCCTT
GGAGAGAAAGGCAGCCCTAAAATCTGTAGCAGACACAGCCTGCTGCCGCCCTCTCCTCTT
CCTCATCGCCGGGATTTATCGAGCCCCTCCTCCGGTGCAGAACACTGATACCGGGTGCTG
TCACAGAGGAGGAGAGGGGACAGGTCCTACTTTTAAAGCGCTCATTATAAGATGAGGGAG
GTGGACGTGAGTTGTGAACCTACAGTAGGCAGGAGAGTAAAGCTAAAGTGGGTGAAAAGG
GAATCAGCATATGGAATAAATGTGAGTGCCAGAGTTGATGTCTTGACCAGAGAGGTTGGG
GTCAGTGTGGGAAATGGCTTTTTCGGGGGGTGGGGGGGGGGGGCTTTGATCACGGAGAGG
GACATGCCGTGGATTGAAGCGGGAAAGAGGTTCCAGAGAAATAAGGGGACGAGCAATGGG
TCCTAGACGGGAGGGTTGCGAGCAGGTTCATCCGAGAGGAGTGGTGAGCGTGAGCCGGAG
CGCGGCGACCCGAGAGAGCGGCGAGACCGAGGCCACTCTCCGGGTACCTGACTTATTTTG
CCGAGAAGAGCTGAGCGACTCCCAGAAAGTGGCCGGGCCCGGACTTGGCCGGGCCGGGCC
GGGCCGCGCAGCTGCAGGGAGCCTACCTCCCCACCTCCTTACCTTCATTTATTCATTCAA
TAGTATTTATTGAGCGCTTACTACGTGCAGAGCACTGTACTAAGCGCTTGGAATATACAA
TTCATCTACAGACGGAGACCATCCCTGCCCAGTGACGGGCTTCCTACCTTCATTGGTAGG
AGGCTGACTCTGATCATTCGGGTGTCGATGAACAGTGAAGGAGTGAATCGCACATAAAGG
ACATCAGTAGGGACGCACGCATTCTTTCTCTTCTCCCTTACTCCCCCGCCAAGGGCAGAT
AAGACACACTGATGTTCTCTCTTCGTAATATGGGTTCTTTGCTGTTTTTTTTTTTCAGTT
TGAATTTAAAAACTTTTCAATATGTTTCCTGGCTTGAATGTTGTCTCTAGATTTCTAAGC
TATTTAATCCATACTATGCTAATTCTGATGGTACTTTAAAAATTTTTTTAAACTAATATA
TAACACATAAATTGTAATTATCTACCCTTTTGACATAGCGGGTCCAAGGATTAAAAACAT
GCTGTGCTTTTAAGGGATCGCTTTCAGACTCTCGAATTAAGAAAATATGCGGATTTGCAT
AAATTGGGCCCTAAAATTAAAACTTTTCTTTTTTAGATCAAGCCAAGTCCAGAAGCGTCT
AAAGAGTACTTTGAGAAAGTGAACCAGTAAATTATCCAGTATCAAAAATGAAGAGCCTGA
AGTTTCTCAACCTCATTTTGGAATCTGCCTTATTATCCAAGAAGATTTATTTGTACAAGT
GCGAAACGAAAGTTAACGCTGGGATCCCAGAACTTTAGAAATCACTGAATGCCGAAATAG
GCGAGAACCATTTTAATGACTGTCGCTCTGTGTCTGTGATGTTGGGAGGAGGTCGTCGAT
CTTGACTTCCGGGTATAAAGTGCAGAGTCCATTTTTAAAATATCTCCCCTTTTTACCCCC
TATAACGTCCTTATAAGGCGGGGAGCACACCCGAAGCGCGTTGCTCTTGTTCAAGAAAGG
TGGTCAGCGGGAAACAGATTGGCATGAGTGAAATAGGTGCATAACAGCATTTCCTTTTTT
TCTTCTAGGATTTCTGTTGCAACTGATTGAAACTTGTTTCTTTTGGAAAATGGGTTCGTG
AACCATGGTAGCGATTTAGGGTTAATTGAATCCCGTGACGTAAAAGCAAGTCAATCTGAA
ATATGCGGGCTCAGAAACAATTACGATAATCATGTGCTTTCCTGAGAAGTTTTATTTTAC
GAATGTAGTTTTATCTCTAAATATCGCGTAGTCGAACGTAATAGCGGCATATGCTTAATG
AGAACGAACGGGACTTATCGTGAATGTATCTCCCTTAGATTTACTGTGTATAGCATATGA
TCGGAAATAAACATGAATTAAAAAAAAAAAACCCAACATTTTTGGGCACTGCCGCAAGTG
CCCTGTGAGTGCGAGAGATTTTTTTTTGACTGTTTACTGTTTAATGTTGCCATTAAAACC
ATGAGGAAAGTCAAGCCTAGGAGTCGATCTGGTCCAGTGGGATACAGATGAACAGGGCTG
TTAATTTTTTCTGCATTGAAAAATACATATTTTTCAGATTCTTCGGCAATGGATCGTATT
TATTCCCTATTGTGGGAGAATAGCTGGAGGAAAAAGACAACGATAGAGTGATCGACAGCA
GAAGTATGTAAAGATAAGTAGATTTATTTAAATTCTGTCCCTCTAGCCTGTAAGCTTTTT
TTTTTTTTTAAAAAAAAGTTAATCATTGAGTCATATTTACCGAGTGCTTACTGTGTGCAG
GACGCTGTACTAAGCGCTTGGAAAGTACAATTTAGCAACAGAGACGATCCCTTCAGTTCC
CTCGCCTCTAAAATGGGGATAGATTATAATGATGGTATTTGTTAAGCCCTTACTATGTGC
AGAGCACTGTGCTAAGCGCTGAGGTGGGTCATCGGATCGCCCCCCCCCCCCGGGGTTCAC
GGTTTCTTTCTAATCCCCGTTTTTACAGATGAGGTAACCGAGGCCCAGAGAGGTGAAGCG
ACTTACCCAAGGTCACACGGCAGACGGGTGGCGGAGGCGGAATCCGAACCCACGACCTCC
GACTCCCCAGCCCGGGCTCTTGCCGCCGAGCCGCGCTGCTTCCCGTGAGCCCCAGCCGGG
CCCGCCTGGATTAGAACCCAGGCCCTGGGGCTCCGGCCCGACCGCCGCCGCCGCCTCCAG
GGCGCAACGCACGCCGAGGGGTGAATGAATGTATATTTTCATCACCCTATTTATTTTGTT
AATGAGATGTACATCCCCGCGATTCTATTTATTTACTCTTGTTTTAATGAGACGTTCTTC
CCCTCGATTCTATTTATTGCCATGGTTCTCGGCCGTCCGTCTCCCCCGATTAGACCGTAA
GCCCGTACTCACGGTCAGGGACCGTCTCTATCTGTTGCCGACTTGTCCATTCCAAAAGCT
CAGTCCAGTGCTCTGCACAGAGTAAGCGCTCAATAAATACTATTGGATGGATGGATGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1051..1100, 1822..1892, 3566..3639, 4648..4789, 5378..5513, 6252..6355, 7088..7253, 8916..9962
1062..1100, 1822..1892, 3566..3639, 4648..4789, 5378..5513, 6252..6355, 7088..7253, 8916..8969
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved