Ornithorhynchus_anatinus Locus CWF19L1
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus CWF19L1
Ornithorhynchus_anatinus
CWF19L1
Ultra472
SNORA12
13415..13554
17103
CAGCGTGGCTCGGTGGCAAGAGCCCAGGCTTGGGAGTAGAGGTCATGGGTTCGAATCCC
TGCTCTGCCACTTGTCAGCTGTGTGACTGTGGTCAAGTCACTTCACTTCACTGTGCCTCA
GTGACCTCATCTGTCAATTGGGGATGAAGACTGCGAGCCTCACGTGGGACAACCTGATTC
CCCTGTATCTCCCCCAGTGCTTAGTGCTCTGCACATAGTAAGCGCTTAACAAATACCAAC
ATTAATTAAAATGGGGATTAAAACCGTGAGCCCCACGTGGGACAACCTGATCACCTTGTA
TCCCCCAGCGCTTAGAACAGTGCCTAGAGCACACTGAGCGCTTAAATACCATAAAAAAGG
GTGCTAGGGTACTAGCATTGGGGGGGTGTAACCGGGATAGTGGAGAAATGAATCGAGGGA
TTTTGAAAGGCCGTTGAAAATGCTGCGAGAGAGAAGTGGCCTAATGGCTATGAAGGAGGA
AGCAGTTTTAGCCTAAAGGGAGGGTGGTAGCACGTAGTCAGCGCTTAACAAATACCACCG
TTTATTTTTTATTTAAATTGCACCAGGTGGAGGAAAGCAGCAGCTGCCCCATGGCCACAG
GGGGGCGTGCCGAGTTTACAAGTGGACTGTGCCATGTGAGGGTCGGGGGGGGGGGAGCAG
ACGATGACTTTTTCTCCATCTCTCTGCCCTCCGGCCGCTGGCCACCCTAAAATATTTCTG
ATTTCATCACTCTGCAGCTAGTTCTCCCTACAGCATCTCCGAACTAAGGGGGCGGGTAGG
CGGGACCGGCGCCCCTCCCGTCCCGGCCGAACCCTCCCTTTGGTCCCGCCCCCGGGGCGC
GGCTGAGGGTTCGGGAATGTCCGGGCTTGTTCCTCGGCCCTTTCCGTAGGTCCGTCGGCG
CAGGCGCGGAGGCCGTTTCGGTCGCCGGCGCCCGAGCCCTTACCGCGCTTGCGCAAAAGC
CTTTGGGTCCCGGAGCTGGCTCGGGAAGGACCGACCCGCTCATGGCTCAGCGACCCCTGC
GAGTGTAAGTGACCCGGAAGCGGAAACCAGGGGTCGGGGGGTGGCGGGGACCCCCCTCCG
GGTTGGCTCGGCCTTCCCCAGCGCTTAGTACAGCGTCCTGCACGCCGAGAGCGCTCAGTA
AATAGCCCCGACTGACCCGGGGTCAGGGCTCAGGTTTTAACCCCAAGGGACACGAGTAGT
GTAGAGGCCTAAGTGGTTAGTACACTGCTCTGCACGTAGTAAGCGCTCAGTAAATACTAT
TGAATGAATGGTATCTGTTAGGCGCCCACTACGTAATAATAATAATGACGTTGGTCCCTG
TTAAGCGCTTACTACGTGCCAGGCACCCTGCTAAGCGCTGGGGTAGATGCAAGTTAATCA
GGTTCGTTCATTCAGTAGTATTTATTGAGCGCTGATTATGTGCAGAGCACTGGACTAAGC
GCTTGGAATGGACAATTCGGCAACAAAGGCCATTTCTGCCCCTTGGCGGGCTCACAGTCT
AAATGGGGGAGACAGACGGACAAAAACAGGACAATTTAATCACGTTAAATAGAGTCAAGG
GGATGGGCACCTCATTAACAAAATAAATAGGGTAATAAAAATATATACAAATGAGTACAG
TGCTGAGGGGAGGGGAAGGGAGAGAGGGAGGGAGGAGCAGAGGGAAAGGGGGCTTAGCTG
AGGGGAGGTGAAGGGGGAGCAGAGAGGGAGCAGAGGGAGTGGGGCTCAGTCTCCATCCCC
ATTTTACAGACGAGGTGACTGAGGCACAGAGAAGGGAAGCGGCTTGCTCAAGGTCGCAAC
AGACAAGTGGTAGAGCTGGGATTAGAACCCGCAACCTCCGACTCCCAAACTCTTGCCGCT
AGGCCGTGCTGCTTCTATTGTAGAGGCCTAAATAATCATTTTCATGGTATCTGTTAGGTG
GTTACTGTGAGCCAGGCCCCCTACTAAGCGTTGGAAGGGATACAAGCCAATCAGGTGAGA
CACAATCCCTGCCCCGCATGAGGCTCGTAATCTTAATCCCCATTTTGCTGATGAGAGAAT
TGAGGCCTGGAGTAGGGAAGTGACTTGCCCAGGGCCACACAGCAGACAATAATGTTGTTA
AACACTTACTAGGTGCAGAGCACTGTTCTAAGCGCTGGGAGAGATATAGGGTAATCAGGT
TGTCTGTCCCATGTGAGGCTCACAGTTAATCCCCATTTTACAGATGAGGTAACTGAGGCA
CAGGGGAGTGAAGTGACTTGCCCACAGTCACCCAGCCGACAACTGGCAGAGCCAGGATTC
GAACCCATGACCTCTGACTCCCAAGCCCAGGCTCTTCCCACTGAGCCACGCTGAGGAGCC
AGAGTAGGAAGGCCCGTAGTTATTTTTCCACAATAGGGTGCATGGGTTAAAAAGCAAAAT
AAGTGGATCTTTACGGTTCCCTAATGATTTTTTAAAATTATATTTTCTCCAACGGCTGTG
GGAAACAGCAGCCAGACTTGACTCCAGTGTACACAAGGACTCACCCGCCTGAACAGGCTT
CAATCAATGGAATTTATCAAATGCTTATTACAGAATAAGTGGATCCATTTCCTGCCCATA
TCGAGCTTACCTTCTAGAGACGAGCTTACTTGATTTCCCCTGTCCAATCAGTAAATCTGC
TGCGTGAGCTTGAGCAAGTCACTTAACTTCTCTGTGCCTAGTTACCTCATCTGTAAAGTG
GGGATTAAGGTTGTTAGCCCTGTGTGAAGGACTGTGTCCAGCCCGATCTGCTTGTATCTT
ACTGAGTGCGTACCATGGTGCAGAGCACTTTATTAAGCACTCGGGAGAGCACAGTACAAC
AGAATTAGTAGACATAATCCTTACTTATAATGAGTGTACAGTCTAGAGGAGTGTTAGATG
ATCCCTGCCTTCAAGGAACTTCGAATCCAGTGGGGAAGAACAGGGCACTAAAATGTATTT
TATATGTAGCCAAATTAAAACGTAATGTGTAAAGGCTAGAATAGTCCCATAATCAATGGC
CGGTGGGAATTTGTGATGCGGAAACTTGGAACTTGGCAATACGTTTCCTGAAAATCAACT
CTAAATTTGACTTTTTTTCAGAAGATAGTCTAGGAAAGACCTAGGGTGGAAATAGACCGT
ATTTATTTTGGCCTGTAGTATGTGTTCCCTAAACACCTATTCACTTAGCTCCTCGATAGA
ACCGTTCGGCATCATATCTTGTATTTATAGTTGGCTTTTATTTTCCTGCTGCACTTTCAC
ATCAGATGATCAATTGACCCATTTTCATCCTCACCACATCCCTGTGTGATAGGGAGAAGC
AGATTTTCTCCCTGTTTGACAGGTGAGGAAAAGGATAAGAGAAAGGCTAAGCGACTTGTG
AAAGGTCACAGCAGGGTGGGGTTAAAACTGGGACTAGAATCCATTCAGTCGTATTTATTG
AGAGCTTACTGTGTGCAGAGCACTGTAGTAAGTGCTTGGAATATACAATTCGGGAACAGA
TAGAGACAATTCTTGCCCAACGACATGCTCACAGTCTAAAAGGGGGAGACAGACAAACAA
AACAAAACAAGGTCTCCCAACTCCCAGCCCCAAGGTCTCAGCAGAGGTTCTCTGAAAAGA
AATGTCACTTTCTGGCTTGTAAGAAGCTGCTAGAGATGAGAGTAAAAATCAATGAAATGG
CATGTTTTCTTTTATACTGAAATTTAAACTAATAGATTTGTAAAAGAAAAATAAAAAAAA
AATCCAGTTCTGTGGAAACTTACTTGCTGAATTACTTTTCACTTCATTTTAAAAAATCAC
TTTCCCTTCCTAGATTGGCCTGTGGAGATGTGGAAGGAAAATTCGATGCGTTGTTCAACA
GAGTACGAGCCATTCAGAAGAAAAGTGGAGACTTTGATGTGAGTTTTCATTTGACAGCAA
ATTTTACTGGTATTGTGAGTCAGTAAACAGTTTTGCCCTGTTAATTAAGGTTGTTGCCGC
ACTCATTTAGCTTGCTAGTATGTCTGGCACCCTGTTCCTCTTCAGCCGATCAATTTTATG
GGATGGAGGAGCTGCGTAGCCTAGCGGAAAGACCGTAGGACTCCATCACTTTCCTGCTGT
GTGACCTTGAGCAAGACACCTAACTTCTCTGGGCCTCATTTTTCCCTATCTGCAAAACAG
GGATTCAGTACCTGTTCTCCCTCCCGCTAAGACTGTGAGCCCTATGTGTCCAATCTGAAT
CTACCCCAACAGTAAGCACAGTGCTTGGCATATAGAAAGTACTTAACAAATACCTGATGC
TGTTCTCAGTATTTGGGTGCCTGCTACTCTGAGTATGCAAGGCAGATAGGGGTGTATGCA
GCCAATGGGCGGGAAATGTGTCTCCTAACCCTGTTGTATTGTACTCTCCTAAGTGCTTAG
TACAGTGTTCTGCACATAGGAAGTGCTCGGTGAATACCATCGATTGATTTTTGGCACCTA
GGACCTTCTTAGAACCAAACTGCTAATCCTACACCCAAGTGCCGTCATGCAGCAGGCGGT
AGCTTTGATACCGCTTACCACAGACATTGTGTCTCAGTTAACATAGGTCCCCGGCCCACA
GGGAACTTACGCTCTAAATGGGGGAGGTGAGACACCTAGAAAAATGACTGGAATCAGAAC
AGCACTTCCCTGAGCCTCAGTCCTCTCATCTGTAAAAGGGAGATTAAGCTTGGGAGCCCT
TAGGGGGACATGGACTGTGTGGAACCTGATTAGCTTATATCTATCCCAGCGCTTAGTAGT
GAGCTCTTAACAAATACCATAATTTTTTTTTAAAAAACTATTTGGGGGACTCAGAATAAG
TGGGATCGCCGATAGGATGGCAGTTCAATCGCTTGCTACTGCTTCCATCTTTTGCCTTTG
AGCGGACCGTTCCTATCCTGTCTAACTTTGTCCTCGACCTTCATTCTGACCTGTTTTCTA
ACCTCATTTTAGCTGCTGTTGTGTGTAGGCAGCTTCTTTGGCTCCAGCTCAGATGCCGAA
TGGGAGGCCTACAGGAAAGGCGTCAAGAAAGGTATGCGGGCAGTCGCTGTTGTTTCGTGC
TTGGATACCAATGGCAGAGTCAGCCGGGCAGAAAAGAGAATCAGACCCTGTCTCTGCTGC
ACGTGGGTTTATTACCCAACCCATCAGTGGCATCTTTCGAGCGCTTACCGTGTGCCGAGC
ACTCGACTGAGTGTTTTGGAGAGGACAGTAGAGTTGGGAGGCATGATTCCTGCCCTCAGG
GAGCTTACAGACTGGCGGTGGAGATGGATGTTTAAGTAAATTGTAGTTTGGATTTGTTGG
GCTGAGGGTTGGGTGAAAATCAAAGTGCTTAAGGGTTATAGGCTTGGAGAGCCTGCCTGA
TGCAGAAGGGCGGGTGAAATCCAGTGGCTTGAATCCCTTGGTTGGGAGTTTCTTTTTGTT
GAGGAGGTAGAAGAGAAACTACTGGAAGTTCTCGGGGAGTGGGGGAACTTAGACTGAGCG
GTTTTGTGGAGGAATGGTCCAGGCAGCCGAGTGAAACGTCACCTCCTTTTCCCTCTAGAC
TGTGAGCTCGTTGTGGACAGCGCGTAGCTCTCCCAACTCAGTTGTATTGTACTCTCCCAA
ATGTTTAGTACAGGGCTCTGCACACAGTAGGTGCTCAGTAAATACCATTGATTGGTTGAC
TGGCCTCAGCCCCAGAAAAGATGGCGTATCTGCCAGTTGTAGACAGAACCCAACTGGCCT
AAGGTCTCTCTTCTTCAGCGTGCTTTCACATCGTGTCCCTATCCGTAACCCCAAAGGGCC
CGAGATCGACTCTTTCAAAGTGATTTTTCCTTCTCCGGGTTCATTTTGGAGGCAGGGAAG
TGTTTAAGGGTGTCCATGTGCTCCGATGGGAATGCCAGGTGTGTCTGAACCCAGGGCGGG
AGGGAGGGACCGGGAGGAGAGGGAAACCCAGGGGAGACCTGGGGATTTTCTCTCTTGCCG
TGGTTATCGTTCTCCTGAAGGAGAAGAGATCTCTTTCTCCCGCGTCCTCTTTGGAATCCA
ATCCCGGAAGATAGCAGTGTCTTTGGTGTCTGTGTCTCCTCTTCCCCAAAGCTCCCATCC
AGACTTATGTGCTTGGTGCCAATAACCAGGAAGCAGCCAAATATTTCCCCGATGTCGATG
GATGTGACCTAGCAGAGAACATAACTTACTTGGGTATGTATTCGAGACCGTGGAGATTGG
CAGGACCGGAGGGGGGTTGGGGTGGGAAATGAGAAAGAAAAAGCCCTCTGGATGTCAGGT
AATTGACATTTTAAGAACTAAATCCTGTCGGTTCCACCTTCACGACATTGTTAAAATCTG
CCCCTTCCTCTCCCTCCAAAGTGCTACCACCTTGGTACCATCATTTATCCTATCCGCCTT
GATTACTATATCAGCCTCCTGGCTGACCTCCCAACCTCCTGTCTCTTCCCCACTCCAGTC
TATACTACACTCTGCCTGCCCTGATCATTTTTCTACAAAAACGTTCAGGACGTGTCTCCC
CACTCTTCAAAAAACTCCAGTGGTTGCCCATCCACCTCTGCATCAAACAAAAACTCCTCA
CCCTTGGCTTCAAAGCACTCGATCACCTTGCCCCCTCCCACCTCACCTCGCTATTCTCCT
ACTGTAGACTAGCCCACACAATTCAGTCTTCCAACGCTAACCTTCTCACTGTGCCTCGAT
CTCATTTATCTCGCCGCCAGCGCCTCGCCCACGTCCTGCCTCTGCCCTGGAACGCCCTCC
TTCTTCAAATCCGACACAATTTCTCTCCCTCCTTTCAAAGCCTTGTCTAAGGCCCATCTC
CTCCAAGAGGCCTTCCCTGACTAAGCCCTCCTTTCCTCTCCCACACCCTTTTGCTTCGCT
CCAATTTGCTACTTTTATTCATCCCCCCCAGCCAGCCCCATAAGCACTTGCATACCTATC
CATAATATATTGATTTATATTAGTGTCTGTCTTCCCCTCTAAACTGTAAGCTCGTTGTGG
GCAGGGAATATGTTGTCTTATATTGTACTCACCCAAGCGCTCAGTACAGTGTTCTGCACA
AAGTAAACGCTCAATAAATACGATTGAATGAATGAATAAAGCCAAAGAAGACTGCATATG
GTACCAATGCTACCATAAACCACCCAGTCTCTTGAACCTCCCACTCACTCCTTCGGCCCG
AGAGGAGAGGGGAACCTGTCCCCCGCCCCCACCTCTTCCCATCAGTTGAGGATCCTGCCT
CTGAAGCAACAGAGCCACCGAGCCCCGTTCACCCATTGCTCTGGGGAATGACCGTTCTTG
TGGTGTCTCGGGAAACTGTTCTCCCCCGTAGCCTCCCCTTTGATCCTGCCTAACATCTGG
CCGGGGGGGCGGGTTTCCCTCAACGTAGGTCGTAAAGGTGTTTTCACGGGAGCTTCCGGA
TTGCAGGTTGCCTACCTCAGCGGAACAGAATCCTCGGCTGAGCCCGGCCCGTCTTACAGT
TTTAGCGCCAAGGATGTGACGGCCCTGAAAGCGTCTCTCTTGTCGACGTCCCAGTTTAAA
GGGGTGGACATCCTGCTGACATCGCCGTGGCCCAAGGATGTGGGGAACTATGGGAATTCT
CCTGTGAGTCCATCGTGCACATGCTCTCTCTTTCTCTTTTTTTTTTTCTTTATCCATTTG
GAATTTTCAAGGGCAAATTCTGTGGCCAGTTAGGAATGGACTCAGACCTGGGTTTTTCCA
AGGTCTATACTGGATGTCTCTCTTTATTCTGGAGAGGGGGAAAAAAATCAGGTTTAGAGG
ATTCTGTGATCTTTCAAAAACAAATGATCATTTCAGGTTGGAGAAGAGGGTAGACTGTAT
GAAGTTGGCAAAAGTGGAATGATAGTTTTAGGAACTCTCCCAAGCCAAACCCTTATCCAC
CTCTTGCCAAAGACTCTTGACTGCTCTGCCTCTTAAATCTCCAAAGTCTATAGAAAGTCA
AACGTGATTTCATAGTTTGACGGCTCTTGGGGGATTTCCCAAACAATTATTCAGGGGCAC
TTGTGGCCCGGCTCACACACTCTTTCCCCCTCCCCCAGTACCCACCGAGTTTATTTATAA
TCAATCAACGGTACTTTGTGAGCACTTAACGATGTGCAGGGGACTGTTGTAAACCCTTAG
GAGAGTCCCAGACAACAGAGCTTGTAGACACGTTTACCTTCCCACGAGGAACTTAGTCAC
ATCCGTTTGTGGTGGTGGGAGCCTTACGGTTCCAGAGGAGAGGGTGGTCCCGCGTCGGAG
AGAGCTCAGTAAAGAGCAGAGGACAGCGAGGTTCTTGATGTTAACGGCAAGATGGTTCAC
TGACTGAGGCCCTGCCCTCTGGGAATTTTCATTCTATCTGATTTAGCGAGCCACTCCGCT
TTATTGATACTTAGATACCAGACCCGCTAACGCCATGCTTTATCAGCTGGTGGTACTGGG
CCACTGGTGGTATTCCCTCAGGTCGGGTCTACCGCCCCATCACACCAGCTGAGGGAGAAA
CTGTGGAGATGAGGAAAACCACCGGTTTCTTGGGGCCCTTTGGGGTCAAAAGGGATCAAA
ACTGGGTTCACGTTACAGGCTTCACCTAGAACACAAGATCTAAATGAGAAGCAGCCTGGT
CTAGTGGTTAGGGCCCGGGCCTGGGAGTAAGAGGACCTGCATTCTAATCCCATGTGCATG
CTGTGTGATCTTGGGCAAGTCACTTAACTTCCTTGGGTTACCTCATCTGTAAAATGGGGA
TGAAGTCAGTGAGCGCCATGTGGGACAGGGACCGTGTTCAACCTGATCAGCTTGTATCTC
CTCCAGCGCTTAATACAGTGCAGTACATTCTTAACAAATGCCGTGCAAAAAAGCAAAAGA
AAAATCCCTTTCACACACTTACTGTCTCTCACTCGGGTATGCAGGATTGCTTTGATTTTA
GGGCTCCCAAACTGAAAGATAAGAAGCAGCACCCTTAGCACTTGATTCTAGTCGCTTCTC
TTCCCGATTTGCCATCTTCTCCCTTGGCCAATATAAAAGAGGATCCTGAGACATAATTGC
ACCATCGGTCTGGAAACTTTCAGTACAGATCAATTAATGGTATTTATTGAGTGCTTACTC
TGAGTGGAGCGCTGTACTAAGCACTAGAGAGACTATAATATGAAAGAATCGGTAGACATG
ATCCCTGCCCACAGTGAGCTTCCAGATCCCGTGGCCCAAACTTTGGTGCTCAAGAGGACA
AGCAGGATTTTCTCGTCTGTAGGACTCAACGTCCGCCAGGTCACCCTGGAAGTAAAATGT
CGGCTTCCGTTTTCCAGGGAGAAGTGGATACCAAAAAATGCGGGTCGGCCTTGGTGTCCA
GTCTTGCCACGAGCCTCAAGCCGAGATACCACTTCGCCGCCCTGGAAAAGATCTATTATG
AGAGACTTCCTTATCGGTGAGTCGGGACCATAGAGCATTTTGCCAGTTTATTGGTTCTGT
AGGGAGTTGAATATGTAGTGTTTCCATATTTTTCGCATGTTGGTCCGATAGCCCCACACC
TCATCGTCTCCTAGAAAAGTCAAGATTATTCAGTTTTCAGCATTCAGATAGGCACCCCCT
TTTTTTTCTTAAACGTTTTCAGCACTGACTCGGGACTGTGTTCTCTCTGGCTCGGTGCCT
ACTCTGGGAGGCACTTTTTTATGGTATTTCTGAAGTGTTTACTATGAGCTAGGCACTGTA
CTAAACACTGGGGTAGATACAAGCTACTCAGGTTGGACTCAGTCCTTGTCTCACGTAGGG
CTCACGGCCTTAATCCTCATTTTGCAGATGAGGTAACTGAGGCCCAGAGAAGTTAAGTGA
TTTGGCCAAGGTCACACAGCAGGCGGGTGGTGGAATTAGAACTCAGGTCCTTCTAACTCC
CAGCTTGGTGATCTGTCCACGAGGCCATGCTGGTTTTCTGTGCTCCTGTGCCCAACTCCC
TCTCAGCTGGAGTCCCGGGGACCCGAAACCTCAGTGGGACTGCCCCATGATAGCATCACT
GTGGGGTGTCGTGCCTGCCGGCAGAAATCCCGTAACACTGGGAAAGGGCATGAGGAAGCG
TTAGGAAAATGTGGCCGAGAAGCTGCGTGACCTAGTCAATAGAGTACGCGGGCTTGGGAG
TCGGTGCCTCAGTTCCCTTATTTGTAAAATGGGGATTAAGATTGTGAGTCCCATGTGGGG
CATAGACCGTGTCCAACCCGATTAGCTCGTATCTACCCCGGCGCTTAGTACAGTAACTCA
CAGTAAGCGCTTAGCAAATCCCATAAAAACAAAAAAAGCAATGGTTCGTTCAGATCCGGC
CCTCAGAAGTGCGCTTGGCATCACGGAACCATCCCGTTTTTGAAAGGAGCCAAGCTAACG
GGAGAGAGGGACCCCACCTTTTTGACCGATTCTTTTCCCCCCCGAGTGTGGGACGAGATG
CCAGTCGGCGGGGAGCTGACTGGCCACTGGGCCGTTGTCCTGTCTCTCTGATAGCAACCA
TGTAGTCCTACAAGAAAACGCCCAGCACGTCACCCGCTTCATCGCTCTGGCGAGCGTCGG
GAACCCAGACAAGAAAAAGGTAGGAATCCGCTCCCTTCTCTCTCCGTCACGTCGGCTCCA
CGTGGGGGGGGGATTGCGTCCGACCGGATTAGCTCCTATTTTTCCCCCGGTGCTTGGCAC
AGAGTGAGTGCTTGACAGGCACTGCGGTCGTCTTTTGACCCCTGAAACTCTGTATCCCAA
CTGACAGCTCTGGGATGCTCGAGGTTCTCCTCTGAGCCACTGTGAGTTCGAAGACCTCCC
AGTACCAATCAGCTCAACCCTCCCGTTGCCTGTCCTCGCGAATTCAGCAGATCAATTCTA
ATTTAGTTGACCGTGGCCGCTTCTGTTGGTGATTATAATTGTTCTCTCTGATCTGCACTG
AGGTCCCATGAACTAGATATGACGGAATTCTACTTTCTGTGTCTTCAAAGTATCTTTATG
CCTTCAATCTTCTTCCAATGAGCCTAATGGATGGGGCCGAACTGGTGAAACAGCCACAGG
ATGTCACGGAAAACCCGTACAGGAAATCCGGGAAGGAGACGGCCCGAGGAAAGCAGACCC
CGCTCTCTCAGGTAAGGTGACCTCACGCGACCTCGCTCCTGGGAAGCACGCCTAGCTTGG
GTGTCCTATTTTTATAATATATTTTTATGCAGTGGGGTATGATTATAAAAATAATACTTA
AACCGTGAGCCCCGTGCTGGAAAGGGACAACGTCTGCCCTGAGTAACATGTATCTACCCC
AGGGCTTAGAACAGTGCTTGCCACTTAGCAAGTGCTTCACAAATACAATAATGATAGTAC
TTATTAAGCACCTACTGTGTGCCAGGTATGTTCAGTACTAAACGCTGGGGTAGAGACAAG
ATGATCAGATGGAACACGGTCCCTGTCCCAGACGGGGCTCACGGTCTAAATAGGAGGGAG
TAGAATTTTACAGATGAGGAAACTGAGACCTAGAGAGGTAGAATGACTAGCCCAAGCTCA
CTCAACAGACAAACGGGAGGGCCAGAATTAGAAACCACGTCCTCTGACTCCCAGGCCCGA
GCCCGAGAAGTGTCTCTTCATGATGAGAGAGGGGAGTTGAGCTAGGAGAAAATCCATGTG
GCCAGAAGAAATGGGTGTTTGACCTTCTGGGCGCTGGCAAGATCACTTTTCTGTGCACGT
TTGTGTCTTTGCAGGAAGAACCGGCTTGCCAGTTCTTTTTCGACTTAAGCAAACAGCAGG
GAAAGAAGCGCCCGTCCTCGGGAGAGGGGAACCACTCTCGTCCCAAGCAACTCCGCCCAC
CCCGTAAGTTCTGGGGCACCCTGGGACCTTGTGGATCGTCGCCCCACCTGGGTTAATTTG
ACGTTCGGGGAGGGGGAAGATGAGCCCAGATCCGCCCTCGTGGGTCCAGACCCGATCAGG
AATCTCCCTGGAGCGAACGGCTCTGGGACCTCGCAGTCACCCCAGAGTTGCTCCTTCAGG
CCCCCTCGCCCTGCCCAGACGAGGCTCTGATGCGAGGAAGGAAAGGCTCTGGAACGAAGA
GGGTCCGGGGGTGGTCGGCCTCCCCGGTCTTCATCCGGGAACCTCTGACGGCGGTGTTTC
GGGTCTGTCTACTTGTTTTCCCAATGCAGCTCAGCCGCCAGGACCCTGCTGGTTCTGTCT
CGCCAGTCCCGACGTAGAGAAGCATTTGGTGGTCAGCATTGGCACCCACGTGAGTCCCTT
CTCCCGGGGAGCTCGTGTTCCGGGGGACGTCGGCCCTTGCTCGATCGGTGGTCATTTTTG
AGCCCTTACTGTCGCAGAGCACTGTACCAAACGCTTGGAAGAATACAATACAACAGAGTC
GGTATACACATACCGTGCCCACAGTGAATTTACCGCTAGAGGACCTTAACCGACTGAGTC
CTCCTTTCTCATACTCCCCGTCCCTTCTGTGTCACCTCTGGATCCTTGCCTCCAAACAGT
TGATATTCATCCCGCCGTCAGCTCCGCAGCAGCTAAGTATATATCGCCTAGAGGCAAGAG
TCCTGGCTTGGGAGTCAGAGGACGTGGGTTCCAATCCTGCCTCCGCCACTCGTCTGCTGC
GTGACCCCGCCTTAACTTCTCTTTACCTCAGTTACCTCATCTGTAAAATGGGGAATAAGA
CTGGGAGCCGACTGTGTCCAGACTGATTACCTCGTATGTACCCCAGTGCTCGGCACATAG
TAAGGCTTAACAAATACCATAATAATTATCATTATTATTATCCCTAATTTATTTTAATGC
CCATATCTAGCTGTGATGTCTAAGCCACTTGTGGGGAGGGAGCGTGTCTACCAACTCTGT
TGTTATCGAACTCTCTCAAGTCCCCAGTAAGCGCTCAATAAATAACATCGATCGACCAGC
TGCCGGAGATGCCCGAGCACATGGTCGGACGATGAGGGGTGGCTGTGGCCGACCTCTGGT
TCGCTCTTCTCGTCTCCCTTTCTCGGCCCACCCTCTTGCTTCTAGACGTAAGGTCGTCGT
GGGCGGGGGATGTGTTCCTTGTTTCGTCGTATTCTTCCGAGTGCTTAGCACGGTGCTCTG
TATGCAGTAAGCACTCAGTAAATACGAATGAATGAGTGAACTCTTCCAGGCCGAGCCGGC
CCCCTCCCGTCCTGGGGAATGGTAGACACCGACAAGACCCCGGGCGTCCGGGCTCTCGAA
ACTAGCGCCGTGTTCTCGGCCCTCTGTCCCGTCCCAGTGCTACCTGGCCCTGGCCAAAGG
CGGCTTGACCAGCGACCACGTCCTCATCTTGCCCATCGGACACTTCCAGTCGGTGGTGGA
CCTTTCGGCGGAGGTGGTGGAGGAGCTGGAGAAGTACAAGGCGGCGGTGCGGAAGTTCTT
TCAGAGCAGAGGGAAGCGGTGTGTGCTGTTTGAGCGGAATTACAGGAGCCATCACCTCCA
GCTGCAGGTGCCGCCCAACCCCGCTCTTTTCCCACCATGGTGGCGGCGCCCCCTTTGTGG
CTGATTTGTTAAAGTTTCAAATGGGCCCCGGGGCAACCACACAGAAGGCAGAGGAGCCGG
AGAGCCTGGTGGCGGTGAGCTCTCTTCCATCAGGAACTCCTTGGCTTCCACAGGAAGCAG
AAGCTGTCTTCTCATGAGTTTAAGTCCTTACGGGCAGGCCGTCCTGTCCGAGATGAGGAA
GACTTGTGCTGAGGGGTGTCCTGCTCACCCCCGTGATGGCGTCTGCTACCCCTCGGGGAC
CCTGCCGACGCTCGCCGGTCTCCCGCCACGGGCCCAAACCCGCTGTTTCTGCTCTCCTCA
GATAGTTCCTGTGCCGCTGGACCTCTGTACAACTGAGGACATCAAGGAAGCCTTCATCGT
ACAAGCTCAGGAGCAGCAGATTGAACTCCTGGAAATCCCAGAACACTCGGACATTAAGCA
GGTAAGGCGGGCCGTGTTTCCTCGCTGCAGTACAGGGATTCAGTCCCTGCTCTCCCTCCT
TCTTAGACTGTGAGCCCCATATTAGACACCCCCACTCTCCACTCCACCCAGCCTAGCCAG
CCCCTCGAGAATTCAGGTTCATATGCCATGCCCCGAATGACGGAAATACCATTGTTTACT
TGGGGTCTGAGAGCTTACAGCTTCATCTTACGGCTCAGGGAACGGGTTGGGGAACTGGGG
GGCCCAGAGAGGTTCTGGACCAGGACATGTTAGTTCAGGTCTTACGCGACCAGCTCTTAA
ACTCCCAACGTCCCGAGCCAGAGAGCCTTGAATAATAATAATAATGTTGGTATTTGTTAA
GCGTTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGGGTAGATGCAGAGTCATCAGGTT
GTCCCACTTGAGGCTCACAGTCTTCATCCCCATTTTACAGATGAGGTCACTGAGGCTCAG
AGAAGTGAAGTGACTTGCCCAGCTGACAAGTGACAGAGCCGGGATTCGAACCCATGTCCT
CTGACTCCCAAGCCCGGACTCTTTCCACTGAGCCACGCTGCTTCTCTAATAGAACTGAGG
GAGAGCAGTGGGGGTCCGGAGCCGGCGGGGGCAGGCAGTTGGGGCGGGAAGGGGCTGCTG
GGAGGTGTTTCGTCTCTAGGACTCTTTTGTATTTTAACCTGACAGAGCTTCTCTCCTAGA
TTGTGCAGCCTGGCGTGCCCTACTTTTATGTGGAACTGGACACAGGAGAGAAGCTTTTCC
ATAGAATCAAGAAAAATTTCCCTTTACAATTCGGAAGGTTCGTGTCTCTTCTGCATCCTA
AGTAACTTGTGGGTATTTATGGAGAGTTGAAGCCTTTTTTTCTTTCCCCTGAACACCCAC
TCTGGGCAAAATGAAACTGAAAGGGAAGTCTCTCCCCATGTAAACATCTGTGTTCTCTTC
AGACAGGTGGACTGTTGAGAAAAAGAGCCGCAACTGTAAAGGCTGTACTGCTCATTTCTC
ACCTTTAAATTTTAATTGATCAGAGAAATAAAATCCTAAAGGCAGGCATGGCCGCAGGTA
GATGAAATCATTTGACTGCACATCGATCGGTCAAGCTGGTATTTAATCGAGCACCGTATT
GAGCAGTTGGGAAAGTACAGAACAATAGAGTTGGTAGCCACGGTGCCTGCCTGTAAGGAG
TTTACAGCCTAGAAAGGGAGGTGGACGTTGAAGGAAATTATTTTTTTTTATTCCATCAGC
TTCTCTTCAGTCACGTAGGGAGGCCTGAAAATCAGGACATGAGCAGTGCCTTAACGGATC
AGGCCAGTGGTCTGTTCATCTCCCTATTCCGTCTGCGGCAACGGGCCTCTGACGACTAAT
GGTATCTGTTAAGTGCTTACTATGTGCCAAGCACTGTACTAAGCTCTGGCTTAGTACACT
TTGGACAAAGGCCTTGGGTGAACTGGGTGATTGTAGCCCTCCTTGGCAGCCAGGCAGAGT
TGATACAAAACGCGAAACTGGTACGGCTCCTCCTGTAGAAAGGCAAGAGAGAGAATAACT
TCGGGTTCGACTTCTTAGTAGTCCGCATTTTCAAATTGAAACCCAAAACCTCACCATCTC
CTGCTCTCGTTTTGGGTGTGACTCCCGTAGGTGGGCCCTGCCCAACCGATCAGTCGTATT
TATCGAGCGCTTACTGCACGCAGAGCACTTCTGTCTCCGGTGCCCCCATTGCCGTGGCTA
GAACGCCATCAGAGGAGAGCCCGGGAGACGGGTGTTTGGCTGCGTTTCAGCCGACCCGCC
GATCTGGGGAACGGGAGGAGCGAGCTAGTGTCCGGGCCCGTTCTGCGACCGAGCCCCGTG
ATGCCGAACTCCGGCCTCTTGGTGTCCTTCGCAGGGAGGTGTTGGCCAGCGAAGCCATCC
TCAACATCCCCGACAAGTCCGACTGGAGGCAGTGCCGGCTCGGCCGTGAAGAGGAGGTGG
CACAGTCTCGGCTCTTCAGGGGGGACTTCCAGCCCTTCGACTTCGCCCTGGATGACTGAG
GGACTGACTGGGGCTGAAGAGGCTTCTCCCCTCCCCGCATCCCCCCTTTGTAAACCTAGT
CAGCCTGGAGACGCCCAGGAAAGGGGTAGTTGGACTTTTAAGGTCACGCCTGTCTCCCAG
AAGCGTTCCTGGCACGTTGCCTCAGAGCCGCGGCTGGGATACCCCGGAGTTCTTCGGTAC
CACGTGCCCCTCCTCTCTCCCTCTCCCTGTGGGAGGAGGCGGTGGCCATTTGCGGGTAGT
GGAAGAGCCGGAAGATCTCTCCCCCTGCTTCTGGCCGAGGAGAGTTTGGCAATGAGGCGC
GCGGGACTAAAGCGCAAACTTAGAGGCAGAAACCCGTTTTAGCTGACAACCCGCCCTTGT
CCCATCTCCGGGTACCAGCAGCTCCACCCTCAACATTTCATAAGTTTTTAACCACAAGAA
TAAACTCCCATTTATTTTATTATTATTATTATTATTTTTTACACACGGTCACTGCTTGCT
TTTTTGCCCGAATAAGTGAAGTTTTGCATTGCTTTGGAAAGTCGGGCATTTCTTTGTGAT
GATCCCGCGTGTCGTCGTTAGTAGCATGAAGACCTTTGAATATTTGCAGAATGCTTATGT
GATTTTTCACTGGACGCCTCGGCCGGCCGCTGCTTGGAGGCCAGTCAAGGATTGAAATGC
TTTTCTGTTTCAAGTTCCATCTGGGACTCCCTCCGCCCCTGCCTACCGCGACTGGCCTTG
GTTCAGTCTCTTTCAGGAACAGAGGAAATAATAATGATGATGATGATGATGATTGTGGTA
ATTTGTAAAGCACTTACCATGGGACAGCCACTATAATGAGCACTGCGGTGGATACAAGCA
AATTGGGTGGCCGCCTGGCCCATATGGGGCTCACAGTCTTCATCCCCATTTTACAGATGA
GGTAACTGAAGCACAGAAAAGTGAAGTGACTTCCCCCAGGTCCCACAGCAGGCAAGTGGC
GGAACTGAGATTAGAACCCAGGTCCTTCTGACTCCCGGGCCAGTGCTCTATCCACTAGGC
AAGTGAGCTGGCTTCTAGCTCTGCCCTTGTGATGAGGTTTGGGCTCCAATCCAAGTTGAA
AGAATGCTTTCATAAATACTGTTGATGGATTCAAATACTGTTGATTGATTCATGGTTGCC
CCACCCCCCGTCACAAGAGGGGAAAGGGAGGCAGGTTTATTCAAGCCTAGGGAAGAGGGC
CCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 3793..3877, 4932..5010, 6051..6152, 7348..7562, 9257..9375, 10434..10518, 10910..11050, 11654..11762, 12089..12168, 13177..13386, 13741..13860, 14579..14676, 15754..16103
1001..1023, 3793..3877, 4932..5010, 6051..6152, 7348..7562, 9257..9375, 10434..10518, 10910..11050, 11654..11762, 12089..12168, 13177..13386, 13741..13860, 14579..14676, 15754..15898
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved