Ornithorhynchus_anatinus Locus MAK16
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus MAK16
Ornithorhynchus_anatinus
MAK16
5
SNORA7
25427..25523
72949
CACATAGTAAGCGCTTAACAAATACCAACATTATTATTATTAATAACAAATACCAACAT
TATTATCACTATCAACAAATACCAACATTATTATTATTATTATTAAAAAATACCAACATT
ATAATTATTATCATTCATAAATACCAACATTATTATTATTAACGAATACCAGCATTATAA
TTATTATTAACAAATACCAACATTATTATTATTATTATTAATAATCAACAAATACCAACA
GTATTATTATCATTATTAACAAATACCACCACCATCATCATCATCATCATTATTATCATC
ATTATTATTATTGTTATCGTTGTTAACAAATCCCAACATTATTATTAACCAACACCAACA
TCATCACCATCCCGCAAGGGCGCCCCTTGAGCGGCGGCTTCTCCCCCGGGTCGGGGCAGC
GGGGCAGGCCGCAGGGGCGCCCTTCTCCCCCTAGGGGGCGCAGGAGGGCGGCGCCGCTGG
GGGGGGGGGAGACACGTTGTATTCGTTCCGGGCAGAAGCCCTGGGTCTTGGGTTCTGGGT
AAAGGGAGAGAGAGACGACGGGGTCAAATCATCAGCACCCGATCGCCTACCAGCCCCCCC
GGGCTCCAGATTCTCACTTTATTTTGAAGGAGCAGAACTGCCTGTTCCCCAAGGTGTCCC
AGATGATCTGCCGAAGACCAAAAAAAAGAAAAGATTCTCTTACTAATCTAATCGGCGAAC
AAAATGATACTATAACCTTTGGNNNNNNNNNNGGGGCATTTACAGAGAAATTATTGGTTT
CAGAAATTCATAACTTTGGGGGCTATATGGGTGGATCGTTGATAGGAGTACATGTGCATA
TCAAAAATTTTCGTGAACCTGAAATGCAATATCGTATAGGAAATAGTTTTCACATTTTTC
CACTGGCCAACACTTCGGTGTAAGGCCAGGTATTTGAGTCTACACAGAGATCTGTATAAA
CACGTCTTCTCCCCCCTAGGGGGCGCAGGAGGGGCGGCCGCCGCTGGGGGGGGGGGAGGG
GGTGGGTGGGTGCGTGAGGTCTCGCGAGAACTGGGGGAGCGCGGCGCTGCCGGAGCGGGG
CCGGCGGGGATCTCGCGAGAGTTGGCGCGCCGGCGGCCGTGGCGGCGGCCTAGGGAGACG
TCGAGGCGTGAGAGGACCGGCCGCCATCATGCAGTCGGACGATGTGAGTCTCCCTCTTAC
TCCTCGGGATCTCCTCCTCCTCTTCTTCTTCTTCTTCTTCTTCTTGTTCTTCTTCTTCTT
CTTCCACCGTGGCCGTTGGTCCTCGCAGGGTCCCGCCTCTCCCCTCTTAATAATAACCCG
TGGTCGGGCCGGTCCCTCTCTGGGGCCCAGCTGGACCTTCCCAGCGCTTAGCCCAGTGCT
CCGCACCCGCTCAGCGCTCCACAAATAGCACTGAGTAAATGAGTAAAATCTATTTATCTA
TTTTGATGGCATTGAGGCCTGTCTCCTTGTCTTGCTGTCTACCTCCCCCCCTTTTAGACC
ATGAGCCTGTGGTGGTTGGGCCGGGCCGGTCTCTCTCTGTTGCCCAGTTGGACCTTCCAA
GCGCTTAGGACAGTGCCCTGCACCCGGTCAGCGCTCAATAAATAGCACTGAATGGACGGA
TGAATTTATCTATAATTCTTTTTAGCTATTTTGATGATATTGAGGCCTGTCTCCTTGTCT
TCCTGTCTTCCTCCCCCCCTATTTTAGACCGTGAGCCCGTGGTTGTGCAGGGCCGGTCTC
TCTCTGTTGCCCAACTGGACCTTCCAAGCGCTTAGCACAGTGCTCTGCACCCAGTCAGCG
CTCCACAAATAGCACTGAATAAATGAGTAAAATATATTTATTTTGATGGCTTTGAGGCCT
GTCTTCTTGTCTTCCTGTCTTCCTCCCCCCCATTTTAGACCATGAGCCCGTGGTTGTGCA
GGGCCGGTCTCTCTCCGTTGCCCAGTTGAACCTTCCAAGCGCTTAGGACAGTGCCCTGCA
CCCGGTCAGCGCTCAATAAATAGCACTGAATGAATGGATGAATTTATCTATAATTCTTTT
TAGCTATTTTGATGATATTGAGGCCTGTCTCCTTGTCTTCCTTCCCCCCCCATTTTAGAC
CATGAGCCCGTGGTTGTGCAGGGCTGGTCTCTCTCTGGGGCCCAACTGGACCTTCCAAGC
GCTTAGCCCAGTGTTGTGCACGCGGTCAGCCCTCCATAAATAGCACTGAATAAATGATTA
AAATCTATTTATCTATTTTGATGGCATTGAGGCCTGTCTCCTTGTCTTGCTGTCTGTCTC
CCCCCGCCTTTTAGACCGTGAGCCCGTGGTTGTGCAGGGCCGGTCTCCTTCTTTCGCCCA
GTTAGACCTTCCCAGCGCTTAGGGCAGTGCTCTGCACACAGTCATAGCTCCATAAATAGC
ACCGAATAAATGAGTGAAATCTATTTATCTATTTTGATGGCATTGAGGCCTGTCTCCTTG
TTTTGCTGTCTGTCTCCCCCCTTCTAGACTGTGAGCCCATGGTTGGGCAGGGCCGGTCTC
TCTCTGGTGCCCAGTTGGACCTTCCAAGCGCTTAGGGCAGTGCTCTGCGTGCGGTCGGCG
CTCCATAAATAGCACCGAATAAATGAATGAATTCTGTTTATCTATTTTGATGGCATTGAG
GCCTGTCTCCTTGTTTTGTCATGCTGTCTTCCCCCCCCTTTTAGACCGTGAGCCCGTGGT
TGGGCCGGGATGGTCTCTCTCTGCTGCCCAATTTGACCTTCCAAGCGCTTAAGACAGCGC
TCTGCACCTAATCAGCTCTTAACGAATACCATCACCACCATCATCACTCACCGCCCCCCC
CCCCCCATTTTACAAATGAGGGAACTAAGGCACAGAGAATAGTAATAATTAGGTTATTTG
CTAAGTGCTTCCTACGTGCCAAGCACTGTTCTAAGCACTGGGGTAGTCAGGTTGGCCCAA
ATGGGGCTACTAGCCTTTACCCTCCTCCTTCTTCCCCCCCACACATATACACACACACAC
GCATTTTACAGATGAGGGAACTGAGGCACGGAGAATAATAATTAGTATTTGCTAAGCGCT
CACTATGTGCCAAGCACTGTTCTAAACGCTGGGGTAGATACAAGGTAATCGGGTTGTCCC
ATGTGGGGCTCCCAGGCTTCACCTTCCCCCCCGCCCCCATTTTACAGATGAGGGAACTGA
GGCCCAGAGAATAATAGTAATAACGGTATGTAAGGGCTTACTGCGAATGTGTCGAGGACT
GGGGAAGATACAGGGTGATCGGGCAGTCCCACGTGGGCCTCCCAGTCTAAACCGCCCCCT
ATTTTACAGAGGAGAGAATTGAGGCACAGAGAATAATAATTATCACTATGGTATTTGCTA
ATAATAATAATAACATTGGTATTTGTTAAGCGCTTACTATGTGCAGAGCACTGCTCTAAG
CGCTGGGGTAGACACGGGGTCATCAGGTTGTCCCACGTGAGGCTCACAGTTAATCCCCAT
TGTACAGATGAGGGAACTGAGGCGCAGGGAAGTGAAGTGACTTGCCCCAAATCACACAGC
TGACAGGGGGCAGAGCCGGGGTAAGCGCTTGCTTGCTAAGCGCTTACTGTGTGCCAAGCA
CTGTGTTAAGAGATGGGGAAGATACATGGTAATCAGGTTGCCCCCAGGTGGGGCTCCCGG
TCTTCATCCCCATTTTCCAGATGAGGGAACCGAGGCCCAGAGAGGGTAAGAGGCTTACCC
AAAATGACACAGCAGACGAGTGGCAGAGTATCCCTCGCCGCCCCTGGTGGTGTCTCTTCG
TACACCGTTGTTGTAATAATAATCTAATAATCATAACGGTGTTGTGAAGCGCTTACCGTC
TGCACCCTTTAAAGCGCCGGGGTAGATACAAGATTATCAGGTCGGACACGGTCCCGTCCC
ACGCGGGCCCCCGGTCCGGATTCCCATTTTGGAGATGAGGGAACTGAGGCACAGAGAAGT
GAAGTGACTTGCCCGAGGTCACACAGGAGGGGTGTGGCGGAGCCGGGATCAGAATCCACG
TCCTCCCGACTCCCCGGGCCCGTGTTCCTGCAGCAGGCCACGGTGCTCCCCGGTCCCCTC
CCCGCCTCGGCTGCGCCGTCCGGCCAGGGAGCCCCAGCGTGTGAAGTCCGGGTGCCCGCC
GCCGGGCCCGGGGAGCCGGCGGGAAGAAGTAAATTGGCTGGCCCGGGGACCCGGGCGACC
GAAGCCGCACCGTGGGCGACCCGGGCCGAGTCCGGGCGACGGCGGGGGTCGCGCTCTCCC
GGGTGCTTAGGACGGCGTTCTGCGGACGGTGAGCCCTCGATAGATATCGAAGCAGAAGCA
GCGTGGCTCAGTGGAAGGAGCGCGGGCTTTGGAGTCACGGGTCATGGGTTCGAATCCCGG
CTCGGCCACGCGTCAGCTGCGTGACTTCGGGCGAGTCACCGAACTTCTCGGTGCCTCACT
CCCCTCATCTGTAAAATGGGGATTAAGACCGTGAGCCCCACGTGGGACGACCCGATCCCC
CTGCGTCTACCCCAGCGCTTAGAACGGTGCTCGGCACAGAGTAAGCGCTTAACGAATACC
AACGTTATTATTATTATTATGTCGCCGATGAGATTTAGTAAGAGAATCTTTTCTTTTTTT
TTGTCTTCGCAGATCATCTGGGACACCTTGGGGAACAGGCAGTTCTGCTCCTTCAAAATA
AAGTGAGAATCTGGAGCCCGGGGGGGCTGGTAGGCGGTCGGGTGCTGATGTTTGACCCCG
TCGTCTCTCTCTCCTTTACCCAGAACCAAGACCCAGGGCTTCTGCCGGAACGAATACAAC
GTGACGGGGCTCTGCAACCGCTCGTCCTGCCCCCTGGCCAACAGCCAGTACGCCACCGTC
AGAGAGGAGAAAGGTGACTCGGCGGCTCGGTCCCCTCCCCCGCCTGCCGCCTGCCCGGCC
GGCCCTTCCCGCCTCATTCTCCGGGCCCGCCGTGGAGGTGTTAATCGGTGCCTCCTCTCT
CGCAGGCCAGTGTTATCTGTACATGAAGGTCATAGAGCGAGCGGCGTTTCCTAGGAGGCT
CTGGGAACGGGTGAGTGAAGACAGGCGCTTCCCCCCGCCGCGGCCCGAAAAAGACCCGCG
GACCGTAAGCTCCCGGTGGGCAGGGATCGCGCCGACCTACTCTCTTCTATTCGATAGTAG
TCACTGAGCGCTTACTGGGTGCAGAGCACCGTACTGAGCGCTCGGACTGGACAATGCGGC
AACAGAGAGAGACAGTCCTGCCCCGTGACGGCCTGCCTAATGGGGGGAGGCAGACGGCAG
AGCAGAACAACAGAACAAAAACAAGACGTTATCAAGATGAATAGACTCAAGGGGACGTAC
ACCTCGTTAACAAAATAAATAGGGTGATAATATCGAGAAATGAGCACAGTACTAAGGGGA
GGAGCAGAGGGAAAGGGGGAGGCTCAGTCCGGGAAGGCTTCTTGGGGGAGGTGAGCTCTC
TCGTGTTGTACTTTCCCTGGCGCTTAGCACAGGGCTCGGCAGACGGTAAGCGCTCGATAA
ATGCCACCGACGGATGGGGGGGCCTGACCGAGACGATTCCAGCCCGGGGACCCCCGTGGA
TAGAGCGGAGCGCGGCGAGACCCTGCGCCAGCCCCCGACCCACCCCCCTCCCCGACAGGT
CCGACTGAGCAAGAATTACGAGAGAGCCCTGGAACAGATCGACGAAAACCTCATCTACTG
GCCCCGCTTCCTCCGGCACAAATGCAAGCAGCGGTTCACCAAGATCACCCAGTATCTCAT
CCGGATCCGGAAACTGACGCTCAAGCGGCAGTAAGTTTCAGGGTCCCCCACGCTCGCTCT
CTCCCAGCGTCTAGCTTCTCCTGGCCGGATCGTGTGTCGGGTGGATTGGGGAGAAGAAAA
GGCCTTATTTTAGAAACGAAGACTGTGCCATCGGGAAGCCGCCGTGCAAATGAAATAATA
CGGTCAAATTTTAAAAAAAATACATTAAAAAACACAACCATATTCCAGATGCAGTATTTT
ACTGCTCCTCCCTGCCCTGGTGGCATCTTGCATTATGGAATTCTCAACCCAGGCAGAGAA
TTCCCAAGATCAGAGCCCTTCGGAGTACCGGACGAGGGGCATTTTACATGGAGCGTGAAG
GTTGGGACCTTGAGCGGAAAGACAGCGACCAACTCCGTAGTAATAACTGAGGAGTCGAGG
CACTTATTACGGGCCAGGCCCCGTACTAAATGGTGGGGTTGATGCAAGCTAATCAGATTG
GAGACAATCCCTGCCCAAGGTCACGGATTCTAATCCCGGGTCCTGCTGTGTGACTGTGCC
TCAGCGACCTCATCTGTAAAATGGGGATTAAGACCGTGAGCTCCATGTGGGGCGAGGACT
TTGTCCGATCTGACCTTGTATCGGGTCACCCCGGTACTTAGGACGACGCTGGTCCCAGTG
AGCGCTTAACAAATACAACTACTACTGTTATTAAGTAGAAGGGAAGACAGGTATCGAATT
CCTACCTTGCAGGCGAAGAGACGCGGAGAAGCTCCGTGACTCGCCCGAGGCCCGAGAGTA
GCCCCGTGGCGGGGAGGGGTTTGGAACCCAGGTCCCGTGGATCCCGGGTCTGTGGTCTTC
CCGCCAGGCCGGGCCGAGGCCGCTCTCACGGGGTCTCTGGGGAGACCGACAGACTACTTC
GTAAGGGGCTCTGACCGGGACGGGCCCGGCCCTCGTCCCTTTCCCTCACCGGTGTGTCGA
AGCTCCCCCATTGCGTGTGTGTCTGTTTCTCGCAGGAGGAAGCTGGTCCCCTTGAGCAAA
AAGGTTGAAAGGCGAGAAAAGAGGAGAGAGGTAATTTTATTTTATTTTGGGGGGGGTTGA
GGGGTGTCACGCTCTCGTTGGTCCCTGGGGTGAACGATGGCTCTGATCCTGGGCTGCCCG
AGACCCTGAAGTTGGAAGGGCAGAGGGGCGGGATCTTCCGGGGGGCCGTCGGGGTCCTTT
TTCTCTCTGCACGGCAGCAGCTCTAAGAGCTAAGGGTGAAGGGGGGAAGAGGGATGGGCT
GTCCTGTGGTGGAAGCGCTACACGGAGCGGGAGGACACCGGGGATCCACGACGGTAGACC
CTAGACTGTAAGCTCGGCCGCGGGCCGGGAACGCGTCCGGTTCATATCGTGCGCTTCGCA
CGCAGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTC
GGCCGACACCCCCGGCCGACTGACGGACAGCAGCGTCCTCACCTGCGACGCAGGAAGACC
GGTCCTCTTTTCACCACCCTCCGCCGGGATACCGGGCGATCGTCGGTTGCCGGTGTGGGA
ACGACATCGCCGTTTCCACGGTCCGCGGCTGGGTCCCGGGACCCCGAGCGTTTAGAGTCG
TTCGGCGTCCGCGGTGAGCGGGGAAACGACTCCGGGGCTGACCCTGGGGATCGTTCGGTG
CCGCTGGCGGTCGGTTCCCTCGGGGACAGGTTGACGACAAAGGGCCCTCGTCGTCGCGTT
AAGTATTTGAAGGTCGTCGACAGGCCGAGAATTAAAACGTACACTGCGGGATGCGCTCCC
GGAGGCCGTAAAGTCCGGGTAGGCGGAACTGGCCTAAAACGTCGTACACCCGTCTCGACG
ACGGAGAGCCAGAGAGACAGCAGGGTCTAGCGAGCGGAGCTCGGGCCTGGGATTCAGAAG
GGCCCGGGCCCTAATCCCGGCTCCCCCGCTCGTCCGCCGTGTGTCCCTAAGCAAGTCGGT
TCTCTTCCCTGCCTCAGTCACCTCATCCGTAAAACGGGGATAAGACCGTGAGCCCCGAGT
GGGACGGGGGCCGTGTCCAACCCGAACTGCTTGTGTCCACCCCGGCACTTGGTACGGTGC
CCGGCCCCTAGTAAGCGCTTAACAGATACCGCCGTTATTTTGGTGGTTACCCTATCCCTC
CAGTAAGGGGGAGCAGGGGACTCCGGGTCTCTGTCGGGATCCAGTGCGAGACCCAGGACG
TTCATTGTCTTTGGCTCCGGTCCCGGGCCTCACCTCTGGCCCGAATCACGACTCCCCCGT
TGACCGTAACCCACCCGGGCACCCGCTCACCGGATCCGCTTTTCGGAAACAAGCGTAGGA
GCGGCCGGAGCCGGTGACCGGGGGCTCCTCGGCGTCTCGGGGCACCGGAGCAGGACGCCC
TCGGTCGGTCAGTCAGTCGGTCGTATTTACGGAGCACTTACTGTGTGCAGAGCACTCGGC
TTAGGGCTTGGAGAATACAGCGGCACTTTCTCATCTAGGAGCCTGTCGCTGCAGCTCCTT
GGTGCTGGCCTTCAAGAGTTTCCATCATTTGGTACTTGCACCCCCGAGCCTCCCGATTAA
AATCGAAGCGCCAGACCGACCTTGAGTTGGCTTAACCAGGCAGAACTTGGTTGCATTACT
GACACCCCCCCCCCCCCCCCCCCTTAGTAACGGGAATTCATAGGTCTTCGCACGCTCTTA
GACACATGCGGTTGATGGGATATTGGCCCCCGTCCTTTAAATCCTTACCCACTTGGTTTA
GGACCCAGGCTTCGGGAGGGTAAGGGAGCCCGTCTTCACGTTAGATACACTGTTTTTAAC
TTCTCCATCTGGGCCGTGCCCTCACTAGACCGTCGGTAAGTGACGGCGGTAGTAATAAGC
GCCGACTGGGTACAGAGGGCCGTATTAAGCATCGGGAAAGAATATAAAAGTTGGGAATCA
GATGGCGTCCCTTGCCCGGGCTCACCATCTATAAAGGTCGTGGCACCCTCTCTTTCTCGC
CTACCTACCAACGCCCTCGCTGGACTGGTCCTCGTCTCTGGAGACTCCGCGTCGGGCACC
GTCCTAAGTGGGGGGGCGTAGATTCAGAGTCGGTCAGGTCGGACGCAGTCCGTGTCCCAC
GTGGGGCTCGGAGCCTGACGGGCCCGGGGAAGTGAAGCGACTTGGCCCGGCTCACACAGT
AGAAAAGTGGCGGAGCTGGGATCAGACCCTAACCCTGACTCCCAGGCCCGTGCCCTAGCC
CCAAGGCCGTGAGACTTGTGGGGAAGAAAGGGTATAGCTTAGACCCCTCTAGTGAAAGTC
TTTTGATGAGTCACCGTAGAGGCGATTCTGGAAAGGCTTTGCAGAAGAATTTAAAGAAGG
TGAGCGACGGTTCTAGGTCGAGTAAAGCCGGGAGACAAAACTCCCCGGCTGCGACCCGTC
AGCTTTTCTCGGCCGAAGCCAGGACCTTCTTGGTGGTAGGGCAGTAAGACGGCCTCCCTT
TCGTTCTGCTTCTAGGAAAAAGCGTTAATTGCGGCCCAGCTGGATAACGCCATAGAGAAG
GAATTGCTGCAGAGACTGAAGCAAGAAACGGTGAGCGAGCCAAGCCCTTCCCCGCGCCGG
GGGTCGCCAACTTCGTCTTTCAGACCGCCTGCGCGTGCCGGTCGAAACGGCAGGAGAGAT
CGGTCTTTCTTAATATTAGAATCGCTCGGACGGGCTCTTTGAGCGGGTCTTTTGGGATTC
CCTCCCCTTCGTCGTCATGGACGGGTGGCCCGGCCCGTGACCGGTGGCACGGGCCCGGCC
TCCCCGGGGACGTGCGGGGGACGGTCCTCCCGGGTGACGGACGCCACCCTTTTTCGTCTT
CCAGTACGGCGACGTCTACAACTTCCCCATCCACGCCTTCGACAAGGCCTTGGAGCAGCA
GGAAGCCGAGAGTGAATCCGACTCTTCCGAGGCAGAGGGCGAGGAGGACGGAGAGGAAGA
TGAAGTAAACCTTACTGCCTTTGTTTGGCTGAGGAGGGTCGTAACTCGGGGTTCTTTTGG
AGCCGAATCCGTTCACAGTCGTGAGGGAGGGGATAGTCCCCGTTCCTCGGCAGAAACACC
CGGGTGGGCGTCACCGGAGTCCCAACGTGACCTGGGGCAAGGTTGGGGTCGTTCTTTGTA
AGTACACTTTAAGTTGCCTGTAGCCAGATCCAATTTGCCATTCTCTGGAGTATGGAAAGA
AAGGATATCAGCTCACCGCTTCTATTACAAAAGAAAAGGCATCGGGGTTTGTTTTTTTCC
TTTTTCTTGTCCCCCGGAACAAAAGTGGGAGGGAGAGTGATTCTGGTACGGTTTGGACCT
AAACTGCACGTTGCTTTCTTTTAGGATGCGGGGGAAAGGGAGTTTGTGGCAGATGACGAG
ATGGATGAAAGTGACCTGAGTGACTTTGAGGTAAGCTGGCCTTTCGGGTAAAGAGTGTCA
GTTGTCCAGTTGCATCTGTTATCTCTTCCATCCTCTCTGCTTCTCTCCCCCCCTCTGTAG
GATATGGATAAGCTGGAAGGCAGCAGCGAGGAGGAGGAGGAGGAGGAGGACGACGACGGC
GGCGACCAGAAAGTCAAAGGCAAGGGTAAAGCTCCTCCGAAAGGACCCGCACACCGCAAG
CGAGCCTACGTGGAGATCGAGTACGAGCGGGAAACGGAGCCCGTGTCCAAAACCGAGGCC
ACCAGCTGAACACTTGGGCCCCGGTGCCCGCGCTTCTATTTAAAGACAGCCCTCGTCCCG
TATCCGACTCTACGGCCGTAATACGCGACATCTGTGTCGACCGTTCACACCTTTTCCCGG
ATTACGAGGCGGTAAGCTTCCTGACCCCGAGGAAGCCTCCTAAAATGCCAGGAGTGCGAT
CTCCCCGGTGGGAGGTGGTGTGACGAAGAATCGCCTGGGGGGGAGGGTGGGTGGGTGGGT
GGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAAGGCGGACCGCCGCCGGGCCGGAAGGGAGAAACGACGACGACAGACCTTT
CGAATAAAAGAGCGAAACTTTAAACGGCATCGCGTTCGGTTCCATCCGGGGGGGGTCCGT
CGGCGTCTCGGACTTTCCTGACGCAGTCCCGGACCTTGCCGTCTTCACAGCTGTGGAGAA
GCGGGGCCAGGAGATCCTGAAAGAGGGAAAAGGGGCTCGGGCACGTTCCGTTTCCCCTCC
CCCTCTAGTTGGGTGCGGCGGGGGGCGGGGGGGCAAGACCCGGGAACGGGAGAAAGAGAG
AGAGCGCGTGGGTGTGTCGGCCGCCCGGAGCCGCCTCCCGCCGCGAGCCGTGAGATTTTT
GGCGTACTTCGACCTTACGCTGGTGACCACCCTTCGCTCTCCCTCCACGGTCGGGAGACG
AGGCGAGGCGTTTCCAAACCGACAGTTAGGTGGTAAGGAAGGAGAAAGTCGTACTATCCT
TTGGCTTTCTACCGTTGACCGTTAGAGTCTGACCTCGGGTTTAACTGAGAAGGGGCCCCG
GCCTGAGTATTCAGAGTAAGCTCAGGCCGCCGGGTCACCGGCAGTGGCCTTCCCGGCACC
CCAGCTGGGGGCTACCGGAAACGCAGGCCCAAGCCCGCTATCCGCACCCTCGTCCTTCCG
GCGGTCTCCTCGCGAAGCTCGGGACTTGTGCTTGCCACCGGATTTTTTTCTTTCGCCCTC
TGAAATCTCCAAGGGTAAGAAAAGGCCTTTCTCACCAATAACCTCGACTCCCTCCGTGCC
TGGAGTCCGTCCTGAGCCGAGCCCTCTGCCCTCCGCTGCCCCGGACGGTTTTCAGATTAC
CGGAGAGGGGGAGAGGGCACCCGTTCTCCGCCGCCCATCCCCACCGCGCTCTCCCCGGCT
GGAGGAAGACGCCGACGTGGCCCCGCTTTCGAAAATTCCCGCCGCCCTGCGCCCTCATCT
CCCATCCTGGTTAGCCCCCGTCCTACCGCCCCTCTTGGCCTTCCCCAGTTCCCACCGCCG
ACTTGTGGGACCCGCCCCAGCGTTACCCAGACCTAACTCCCTAAGCGCTTCCTCTCGGGT
TCGATCGATCGACCGACGGCACCGAGCGTTTACGGCGTGCAGAGCACCGTACGGAACGCT
CGGGAGCCTTAAATAGAGCAGAGTTAGCAGACACGCGACGTGGCAGGACCTCGGTCCTTG
CTTAGGGGGTGCAGGGGACCGTGCCTAGCGCCGCGGAGAGTCCGCCGCAACGGTGCGTAG
ACGCGGTCTCTGCCCACGGGGAGGTTCCTCCAACCAAGTCTCCGGAAGGCGACGGGGACG
CACGGCCCCGAAAGCCCCGTGGGGAGGTCGGGCGGGTGTCCGTGATGGGGGGGAGAACCG
CACTGGCGGCGTCCGACGACTCGACCGCGCGGCCGCCCGCTAGAGCCCGCCCTGCGCGCA
CCCCAGGCGCCGAGGGGACGCGCCGATACCGCCGTCCCATCGTTGGTAACCCGTCGCCTC
AACTCCCCAACTTCCCAGGTGGAAGGCGGGGAGCAGCGTCCACGCGCGGTCCTCCGCGGG
GGGCCGTCACCGCCGGGGAGGGACCGGGCGCGGGCGCGGGGTGGGAGCCGAGGTGCCCCC
TCACGTACCTTCACCCGGCCTCCACAGCAGCGGTCCAGGAGGATGAGACATCCGGTGGCC
TCCTCCAGGAGGGCGGCCTTCACGGGCTCGGGCGTCAGGCTGCGGTCCCGCGCCACGTCG
CACACCATCTTCAACAGGGCCTTCAGCAGGACGTCGAGCCTGCGGGGCACTCTGGCCCGC
GGGGGACGGGACGGGGAGGGGAAACCCGGTCAGCCCGGCCCCCGGGCCGAGGCGCTTGAG
CGGTCGGGGCGCGGTGAACCGTTCTCTCCCCGCCAGCTCTGATTCCTCCCCGCCTCGTTA
CGGGTCCCTCCCAGACCGCACCGGGGTCTGACGGGCCTGGCGCGGCCGAGGGAGACGGGT
AGCGCCAAGCAACAGTCCGGGCGGCGCGCGCGGAAACGGGCACGGTCTGCGGAGGGCCGG
GATCACCGTGGCGTTCCACCGAGCCTTTACGTCGAGCACTGGACTGAGCGTGGGAGTAGA
TATAACGATAACGCTGGTATCGCTTAAGCGCTCGCTACGTGCCGAGCACCGTTCTGAGCG
CCGGGGTGGACACGGGGGGATCAGGTCGCCCCCCGTGGGGCTCCCGGTCTTCGTCCCCAT
CTGACAGATGAGGTAACCAACCGGGGCCCAGAGAAGCGAAGCGACTCGCCCGCGGTCCCA
CGGCTGACGAGTGGCGGGGCCGGGACGCGACCCCACGCCCTCCGACTCCCGAGCCCGGGC
TCCTTCCGCCGCGCCACGCTGCTTCTCGTACAGGGGTTAATACGAGAAGAATACACGAGA
GGTCGATACGTGGGTCCGTCAGGTCGGACGCAACCCGTTCAACGTGGGGCTCGCGGCAGG
AGTAGGAGGGAGAAACGGGTCCTCGACCCCCATTTTTCAGAGGAGGAGACTGAGGCACGC
TGAGGTTAAATGACTGGCCCGACAGTCGGGCGGTGGAGCCGGTATCGAAACCCAGGCCGC
CCGACTCCCGGCCACGCTTTTTCCACGAGACTCTGCTGCCTCACGGCTCTGGGCCGGCCC
CCTCCTTTTTGGGGGGGGGGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAAAGGGGAGCAAAGGGTGTTGGCCCGGTAGGAGGAGATTA
CTTTTCCTAGGGGAAAGATCGGCAAGGGCATGAAGGCCAATGGCTTTCCCCAAATAGTTT
TCCTCAATGGTCCATTTAGGAATTTCTCCCTTCACGATTTTTTACTATGGAAAGCACAAT
TTGTGTTCTGTTTCCCACGCTCCCACTGCCCATCCATAGGGGATAGCAGATTTGAAAGAC
AGTGTGATGATTGATTGAAAGCTGTGTAATTTGACACAAGGTGACTTTGGATGGGGCCAT
CTTTGAACAACATGCATTCAATCTAAAGCTACTGAGAAAGGCAAGTCATGAAAGAGGCGG
ATTAGAAATCTCAACCAATTATCCTCACCAATTTCCACGAAGCACACGCGCAAAGAGGCC
GCAGCCCCCGCGTGGGACGGGGACGGCGATGGACTCCGTCCGGATCCACCCCGGCGCTTA
GCACGGTGGCCGGAACGGAAGCGCTTGACCGACACGATCGCCGTTATCATCGCAACGGTA
ACGTCGCTATCACTGAGACGCCTTCCCGGCCCCCGCGGAGCTTACGGTCCGGAGGAGCCA
GACGACAGTAACGCTGGTGTTTACTGAGCGCTCACTATGTGCAGAGCGCTGTTCGAAGCG
CTGGGATATACAGGGTGATCGGGTCGTCCCACACGAGGCTCACGGTCTTAATCCCCGTTT
TACAGACGAGGGGACCGAAGCACGGGGAGGCGAAGCGACTCGCCCGCGGCCACGCCGCCG
CCGAGCGGCGGGGCGGGGATTCGAACCCATGACCTCTAAATTGATCTAATTTAATATATG
TATAATATAAATCATAGATTGCAGTATATGATATACGAATACATTATATATTACTAACAT
CGTGTTTTATAATAATAAATTACATAATCTATTATTACGTATCGTATACGCTGGTATATA
TACTATTATATATCATTATACATCCCGTATAAAGATTATATCCCAGTATACGAATAATAC
ACGTGAACGATACACAACACATACACAGATCATAATCTATCTAACCTAAATAAACGAGAG
ACGCGTACGGACCCGTCGGGCCCACCCGTCCTCGATCCCATCGCCCGTCTCCGGGCACCC
CCCGAGGTGCCCGGAGAGGCGGTCGCCGGTCCGGGCCGCCCCGCTCCCCGGGGGCGGGTG
CGAGAGGGGCCGCCTCCCCCCCCGGGGCGGGTCCTACCTGGGCCAGGCGTGCCGGATGGT
GACTTTCAAGGTCTCCAGAATGGCCAAGCGGGCTTCCTCCTCGGGCCCGTCGTACACCTC
CAGGTAGCTCACGACGACCCGCTCCAGCCTCTTCAGGTGCCGCGCCGTCAGGATCCCCAG
GCTGCCCGGCGGGGAGGAGGGGAGCGCTCAGAAGGGCCGGGCGGGGAGGGGGGGGCGCGG
GGGGGGGGGGGGAAAGTATGTCCCGGCCGGCCCCTTACCTCTCTACAAAAACGGGGAGGC
TCCCGGCGTAAACCCTCCTAAGCAGCACGCGATCCCACTCCATAGTCAAATTTTAAGGGG
ACTGAAAGTCATACACTCTGCATGCGGGTGGTGGGAATGAAGCACCAGGTAAACTTGGCT
TTAAACTCGGGTGACAGCTTCTGTTCTCTAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCACTTTGAAGTGTTCTCTACAGATACAGTAGTTAGGGCTTGAAGATTC
GGCTTGCCAGTGCAGGGGGCCCTCCACGATCGGCAACAGGGCCAGCAGGCTCCGGAGTAT
CGCTTGAGGTGACGGCCGGACCCGCGGTAAGGACGGGGGGGACCGAGGGAGGGAGGGAGG
GAGGGCAGCGCCGCGGGACTCCCCCGCCCCCTCCGCCGCCGGCCGCTCGGTCCGGCGGGT
GCACCGGGCGCTCGCCGAGAGCCCGGTAAGGAGTATTCGTTCAATGGTGTCTGCCGAGCC
CTCACTATGTGCACAGCGCTGCACCGAGCGCTCGGAACGGACAGATCGGTAACAGATAGA
GACGGTCCCCGCCCTCTGACGGGCTCACGGTCTGATCGGGGCCGACGGACAAGGACGACG
GCACGTAAGGGCGGCGGCTCGGCACACGGTGAGCGCTCAGGAGACACGGCCGAACGAAGG
GCCGGACGGCAGCCTCCCGGCCGACACGACGGCCGGCCTGGACTTCATCCGGCCAGGACC
GGGTTCGGGGGAAGAGGCGAAGGGGGGACACGGGGATCGGTCTCAATCTCGAGCGGGTCA
ACGCGGAAGTGACTGCGGGTTGACGTCGACTGACAGTTAAGTCACCGCCCCGGCGCGGTG
CAGAGACCCGGAGAGACGTCTCTCGGCTCTCTGGACGTCCCTCGGGTAGCGGCGAGCCCG
GCCCCGGGAGTCAGAGGACCCGGGTCCCGATCCCGGCTCTGCCACCTGCCCGCCGCGCGT
CCTCGGGCGGGACCGCTTCACTTCTGGGCCTCGGTTCCCTCGCCCGTAAGACGGGGACGG
GGTCCTCCCCCCCCCCCCGGCCGAGATCGGGGGCCCCCTGAGGAACGGGGTGCGCGTCCA
ACCCGATCGCCTCGTATCTACCCCGGTCCTCGGCAGCTAGCGGGGACTCGACGGATACCG
CGGTCGTTCGCCCCTCACCGGTGCCCGCGCCGGACCGGCGACGCCCCTCGGTGACCGGTA
CGTCGGGCCGAGCGGGAACTGACGGTCCACGGGGGCAAGGCTCGGCGGACCATTCCCGCT
TTATCCGTTCGACGGTATCTACTGAGCGCCTACCAGGTGCCGAGCGCCGTGCGACGCGCT
CGGAATCCACTTCCCACCTTCCCCTGGGTCCAGTTACCTGGATGAGACTGGGCTCCGGCG
TGTACAGGTGGTTGAAGAGGGCGTGGTACACGACCTGGTCCCTGTTATACTGGCGCAGGT
CGGCAGCTGGCTGCAGCAAGACGGAGAACGCGGGTTAAAAAGGAAGGGCGGGGGGGGGGG
GGGCGGCAAGCGAGCCGCGTTCGGCAGTTCGACGTGGCAGGAGCGGAGCCGCCGCTCCGA
AATCTTTCCTTCACGGCAGCACTCTCTCTCCTTTCACGAGCTCCCCGTCAGCTGGGTGGC
CGTGGGCGACCGAGGCCCAGAGAAGTGAAGCGGCTCGCCCACGGTCACACGGCTGACAAG
TGGCAGAGCCGGGAGTCGGACCCGTGGCCTCGGACTCCGAAGGCACGCTGCTAGCGAGGG
GGAGGCCAGCTGCTACGAGTCAAAACTCCCCCGTGCCGGGCAGCGGCGGCACGGGAGAGA
GTCGAGGGCGGAGACTCGAGTTTACCGCGCGGAAGGCGGCGGCGAACCGCTGCCGGATTG
GTTTTTACCAGGGAGACTCTAAGGACGCGGTATTCATTCATTCGGTCGTATTTATTGAGC
GCTCACTATGTGCCGAGCGCTGTACCGAGCGCTTGGAACGGACAAACCGGCCACGGACGG
AACGACGGGACGGTACCGGAACGATTGCGGACGGAGGCGGGGCGGCCCGGGAGAGCCGCG
TCCCCGGAGTCGCTAGGGGTCGGAGACGACCGGACGGCCCGTCTTTCCAGGTTTAGATAG
GGGAGGGTTCCCTGGACCGCCATTCCAAAAAGCGCCCCGAACGGTCCGAGGGTTGACCCT
CCGGGGCGGCAGTTGGCTCGCCCGGGCCGGCCGGACTCCCGCCGGCAAGTCCCGCCTCGG
GTTCCTCGGCCGCCCCAGGTGAACGTGCCGCGCGGTCCCGGTGGTCCGTTCCCAGCTGAC
GAATCGAGCCACCTCCTCTAAGACGACCCGGCTGCGTTGCCGGCTCGGGACGGCGCTTTG
CGCACAGTGGGCGTCCGATAACTACGACGGAAGGACCGTCCCGCCGTCCCACCCCTCTGA
CCTACGGGCTGCGGTCGACGGTCTGGGGAGGGGAGGGGAGGCTCCGCGTGGGCCGGGACC
CCTCGATTCTATCGACCGCCGTCGTTCTCGTCCGTCCGTCTCCCCCGATTAGACCGTGAG
CCCGTCGAAGGGCGGGGACCGTCTCTATCCGTCACCGACCTGTACCGTCCAGGCGCTCGA
TACGGTGCTCCGCACGCGGTGAGCGCTCAATAAATACTATCGAACCAACGAATGACTGGG
CTCCATTCGAGCGGAGCCGCCGCCCGGACAGGGGCCGCGCCTTTCCTCTTCCCCCACTCC
CTTCTGCATCACCCCGACTCGCTCCCTTTGCTCTTCCCCACCTCCCGGGCCCACAGCACT
CACGTGCTCATCTGTCATCGTTTCAGACTTCTCCGGGCCTCGGTTCCCTCCTCTGCAAAA
TGGGGACTGACCGTGAGCCTCACGTGGGACGACCCGATGACCCCGTATCTCCCCCGGCGC
TTAGAACGGTGCTCCGCGCGTAGCGGGCGCTTAACGGATACCGACATTATCACCCGTACT
GAGGTCCGTCTGCCCCTCTCTAGACTGCAAGCTCGTTGCGGGCAGGGAACGTGTCTGGTT
TTTTGTTGCACTGGACTCTCCCGAGCGCTCGGCGCGGTGCTCTGCCCGGGGTAAGGGCTC
GCTAAAGACGACTGAACGAACGGCCCGGGAGGCCCGGCCCTGCTCCGCGCAGAAGCTGGA
GTCCACAAAGAGCTAGTCTCCCCAGCTGCTAGACCGCCGGATGCTACGGCTGGCGGCGTG
GCTCGGTGGAAAGAGCCCGGGCTTGGGAGTCAGAGGTCACGGGTTCGACTCCCGGCTCCG
CCACCTGTCAGCTGGGTGACTGTGGGCGAGTCACTTCACTTCTCTGGGCCTCAGTTCCCT
CCTCTGGAAGATGGGGATTGACCGTGAGCCTCACGGGGGACGACCCGATGACCCTGGATC
TCCCCCGGCGCTCAGAACGGCGCCGTGCACGTAGTCGGCGCTTAACGGACGCCGGCATTA
TTACGTCGAGGGGGAAGGGGACACGGACCGCGGCCGGGGGACCGTCGTTCGGCCCCTCAT
TCGGGATTCTTGCGTTTTCAATGCCCTCCCCGCCGAGGTCTGTAATTTACCTTTTCTTCA
CGCCCATCCTCCCTCCCCCGGAGTGCGAGCCCCGGGTCCGAACCGTGTTCGCCCCGGGGC
TCGATAAGCACCACGGTCAACTGAAGACCACTGGAGATTTGAGGTGGAAGGTTCGAGGGC
TCGCAGTAATGTGCCGGAGGGCTTAGAAGAGGCTACGGGGACCGTCAGACCAAGAGAGCC
TTTTTTAAGATAGGTCGGAGGTGTTAGAAACCTTACAAACCAGTCGTCTCTCCGCTCTCT
TAACGGCTCTGGTCGAAGTTGGATGCGGGGGGCGGGCGGGGCCGAACGCCAGATGCAGTC
CGGGGCCCCGCATCTCGGCGAGGACATCGGAGAAGGACGGCGGAGTCATCGAGATCCTTA
GGGGTTAGGGTGGGACGGCTTCCGAGCGGGGCCAAATCGCGCGGATCAGGACCGCAGTTC
GGAAGGACGCTAGCCCAACGGGGTAGAGATTCACAGCATCGGAGAGCTCGGAGCCGAAGG
GGACACGCGGGCGGATCCTACGTTGGGAGGAGGTGGCGTCCGTCTGAGCTTAACGGCGGT
AGGATCCAACCAAGCCCGGGGGAACGATTCCCGCGGGGCATACTGAGTGAACGCGATCCA
CCTTCCTACGGTAACTCGCAAGAGCATCGGCAGGTTCAAGATAAATCGGGGAAAAGGCAC
GGTTTATCGGTCGCTTACGCTTCCGTCCTCAGTAGTCCCGATAAAAACGAGGACGATGAC
GGCAAGGGACGGGCCACTCTCTGTCCTCCCGCTTCATCAACTGAGAACGGGCTCTACCCG
TCGGTCGATCGATCGGCGGTACCGGCTGAGCGCCGGCTACGCGCGGGGCGCTCCGAGCGC
CCGGGAGAGTCCCGGACCGCGGAATCAAGCAGCCCCGATCCCCGGGGAATCCTTACCACG
TTGAGGATGATGTGATGGAGGCAGTCGACCCCGAGGATTTTGTTTTCCGTCTGGTAGTCA
TCCGACATGAGCAACGCCGGGGGCAGGACCTTTTCCAGGTAGCGGCTCAGCCAGGGGCGA
GTGACCTGGCGCAGCGTCCAGGAGAACACGTGCCGGGTGGCGGGGTTCCTCTTCCAACAT
TCCCTAAAAGTCGCGGAGAGGGACAACGGGAGATCGGGGCAGGGACACCACCTGGAGGCT
CCCGGGCCTCCGGAGACTCCTCCCGCCGTGCAACCTCTTACGATCTCCGGCGCGTATCCC
GCCGCGGTATAAATTTTCCTTAATCGGCAGACACCCGCCGATCGAGTGGGTGTCGAACCG
GAAACGGCATCGGGCTCCTCGGTTCTTTTTCTTGGCCTGTTAGGAGTTTTCAAGCGGGTA
CTAATAATGATGAGGAGTTTTTTTTGCAGTTACATCAGCATTCTTCTGTTGCTGCTGTTT
TTAAATGGTATCCGTTAAGCGCTCGCTATGTGCCAGGCACTGTACTGGGTGCCGGATGGA
TACGGATTAATCAGGTTGGACCCGGTTCGTGCCCACGTGGGGTTCAGAGTCTCGAGCCCC
ATTTTACAGATGAGGCTACTGAGGCGCAGAGAAATTCCGCCGTTGGTATCTGTTAAGCGC
CCGCTATGCGCCGAGCACCGTTGGAGCCGGGATTAGAACCCCCGACCTCTGACTGCCAAG
CCCGGGCTCTTTCCCGCTGAGCCACGCCGAGGGACTTGCCCGAGGTCGCACGGCAGACAA
AGGGTGGAGCTGGGATCTAGGAGCCAGGCCCTTCTGACTCCCAGGCCCGCGCTCTTTCCG
CTAGGCCACGCCGTGAACTAAATCCCCAGGGTCATTGTCCAACTGACCGAACGATCAAGG
TTCAACGTCTCGGGGGCAGAATTCCCAATTTAGCTCAAGCAGCCGTCACCAGATTTTCAT
TCCCAATCCCCCCACGCGGTGGAAAAAACTGACCCCTCAGGGCGTCGACGTCATCGGCAG
CGGTATTTACTGAGCGCTCTGTCCCCCTAGCCCGGAAGGAGGCTTGTGGTGGGCAGGGAG
TGTGTCCGTTATAATAACGATAATGATGTTGGTATCTGTTAAGCGCTCACTACGCGCAGA
GCACCGTTCTACTCGCCGGGTGCTCTGCACGTTCTAAACGCCCTACCAATACTAGTAAGT
GACTGACTTACCAAAACACCAAAGGGACGGATGCTGGAGACTTTCCCATGTGCATATTCC
CATGCGGTTAACACAATAATTGCTCGCTGATCCCGATTTTTTTTGTGAGGAACTACACCA
CCCCATTTTTTGTCCGCCCCCCCCCCCCCCCAAAGGTTTTTTTTTTTATATATAAAAGAG
AGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGCCCCGCGAGGGACGACCCGAT
CGCCTTTGGTATCCTCCCCGGCGCTTAGCGCTTTGCCCGTGGTAAGCGCTCAAAAAAAAA
AAAAAACCGGACACCTGCCCACGGCGAGGTCACGGTTTGGAGATCTCTAACTTCTCGTCC
CCCGCCGTTCCCCCTCCGTCGGCCCACTTCCAGGCACACGAGATTTAGGGTGACGGGAGC
TGGCCTCAGCTCGGGAGAAAAGTCTGGCACGGAGGAATCCCTCCTCCCCCGCCCCCCAAA
ATCGGTGCAGCGAAGCGTTTTATGACTGGTAAATGACCCACCGGTGGCAAAGGTTGGGAG
ACGGTGACCCTCCCTCGGCCCCGGGTGTCCCACCCGGCGGAACCCACCGACGATGATGAC
AATTCCAGCATTCCTCGGGCTTTAACAGGCGTCCAACGCCGCTCTAAATGCCGGCGGAGA
TACGAGGTTAGATCGGTCGCGGGCCCTGGCCCGCGGGGAGCTCGCGGTCTTCGTCCCCAT
TCTCCAGACGCGGCAACTGAGGCCGAGGGAAGCGACTCGCCCGGAGGCCACGCGGCGGAC
AGGCAGCGGGGTAGAGGCGCCGGGGCGTCGTACTTTCCCGAGCGCTTGGTACAGCGCTCT
GCGCGCAGCAGGCGCTCAGTAAATACAATTGAAAGGATTAATAATGATTACGGTATTTGC
TAAGCGCTTACCATGTGCAGGGCACTGGGCTAAGCGCTGGGGTACGTACGTGTGCCAAGC
AGTAAGTGCTGGGGTAGATACCCAGCGTGGCTCAGCGGCAAGAGCCCGGGCTTGGGAGTC
AGGGGTCACGGGTTCGACTCCCGCCTCTGCCACTCGTCAGCTGGGTGACTGTGGGCGGGT
CACTTCACTTCTCTCTGCCTCAGTTCCCTCATCCGTAAAATGGAGATTAAAACCGTGAGC
CCCACGTGGGACCACCCGATGACCCCGGATCTCCCCCAGCGCTTAGAACGGTGCTCTGCA
CGTAGTAAGCGCTTAACATATAGCCACATTATTATTAGTATGCGCTCGACAAATATCATC
ACCACTAGCGTGGCTCAGTGGCAAGAGCCCGGGCTTGGGAGTCAGAGGTCATGGGTTCGA
ATCCCAGCTCTGCCACCTGTCAGCTGTGTGACCGTGGGCGGGTCACTTCACTTCTCAGGG
CCTCGGTTCCCGCATCTGGAAAATGGGGATCGAGACTGGGAGCCTGAGGTGGGACAACCT
GATGACCCCGAATCTCCCCCAGCGCTCAGCACGGTGCTCTGCACGTAGTAAGCGCTTAAC
AAATAACAACATTAGTAGTAGTAGTAGTAGTAGTAAGCGCTCAACAAATACCATCATCAT
CATCATCATCATCATCACTAGCGTGGCTCAGTGGAAAGAGCCCGGGCTTGGGAGTCAGAG
GTCCCGGGTTCGAATCCCGGCTTATACCCACATTATTACAGTCTAATCGGGGGAGACGGC
CAAGAACAATAGCAACGAATAGAATCGAGGATGGTATNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAGGTGTTACGAGGTTCAAAATAGGG
ATCGTAGTAGTCATCCTTTATTCTAATAAATGGGGGGGGAAAGACCTTGGCGATAAGCAT
CCCTTGCTTCCTCAGTCTGGTCCTCGCTCTGTTCCATCAGCAAAGAAACATCCCAAAACA
AAGGTGTCGTGACGCAGTTTTGGCAGTTGACTTACAGAACATCGTTACCCATAAGGGGTA
CGCAAAGAGGATCAGACCTTTGGCACCTGAGGTAGCCATGCCAGGTTTCTAGACCAAATT
TGCTATTGCAGCCAATAGTTTCATAAATATGGTGAAGCCTACGTGCACCGTCAGTGTCCG
GCAGTTCGACAGCAATCACGCACTAGTTCCGAGATGAGGTGATTTGTGCTTAAAAAGAAC
AAAAACTGAGGCTACATAGGTGGTGGGCTGGACTATGAGCACTCCACAGGTTCTTCTCTT
GCAACAGGTGAAGTAAAAAAATAGACATCTCGGTGTCTGTCTTAGAAGTTAGAGCAGTAG
CCACTGGGCCACGCTGCTTCTCTGCCTACGGGCCGGCTCTGTGGCAAGAGAGTCCGAGGT
CATGAGTTCGAATCCCAGCCCGGCCACTCGTCAGCGGCGGGACTGTGGGCCCGTCACTTC
CCTTCTCCGGGCCTCAGTGACCTCATCTGGAAAATGGGGATGAAGGCGGGGAGCCCCACG
TGGGACGACCTGATTCCCCCGTGTCTCCCCCAGCGCTTAGAACAGTGCTCTGTCTCAACT
GTCTATATTTTCGTTACCCTATTTATTTTGTTGATGAATTGTACATCGCCTCGATTCTAT
TTAGTTGCCATCGGTTTTTACGAGATGTTCTTCCCCTCGACGCTGTTTAGTGCCATCGTT
CTCGTCCGTCCGTCTCCCCCGATGAGACCGTGAGCCCGTCAAACGGCAGGGACCGTCTCT
ATCTGTCGCCGACTTGTTCGTCCCAAGCGCTCAGTACAGTGCTCTGCACAGAGTAAGCGC
TCAATAAATACTATTGAACAGAAGAGAACATAGTAAGCGCCTCCCAAATACCACCATTAT
TAACACGTGCCACCAAAGGGGGAGGGGCAGGGGAGAGGGCTCCCAGGCAAAACTATCTAA
AAGAGAACAAAAATAAAGGTTACAGACTCAAAGCGGGGACCCACAGGCGGGTGGCGATCA
GATTCGCAGCAGCCAAAGATGGAGGATTGTTATTATTTCTTCCTCTTCCTCCTCCTGCAA
GAAGTCTTGCTCCTGGGCTGGTCCTTTCCCAGACTCCCCCGCGAGCCTCCTTTCCGAACT
ACCATTCTGCTGCGCGACGCGGCCGTAAAGCGCCCGCCGCGTTTGCGACGCTCCTTTCCG
GCAGGGGCTCCAAGAGGAAGCCGAAGAGTCGGCGGGAGGGGCGCGCGGACCTCATTTGCA
TACGCCGTGGCGCACGGGGTTAGGGGGGGGGGTCGCCGCGCCTTTCTCTCCAGGCGGGCT
TTGGGAGGGACAGAAGGGTCCTCGGGAGGGGCAGGGGATAGGGGGTGGGGGCTTGGGGCG
ACAGTGTTCGAGCTCGAGAAAGAAGTCTTTTCCGGGAGAAAGAGTCACCCTCGGTGAAAA
GGGGTTGGCAGGCGCTAGGGTGGCCGCTGGGGCGGTCGATGGGGATGATCCTTTCGGTTC
ATTAAAAATGATGATTGGGTTGCCACGCGCCTGCGTGAGATGTGCCGCCCTTTTGTTACG
CATGCGCACATTACCCTTCTGATCTGAACCGCGGATCCTTTTTTTTTCTATGACGCGGAG
TGATACGATTAAGCTTTTCTTACGAGTGATAGGGCTCATTAAGTAGTATTCAGCGAGCGC
TTATTACTGTAATAACGTTGGTATTTGTTAGACGGTCAGCAGGGGCCGGGCACCGTCCTA
AGCGTCGGGGGGAGATGCAGGATCGCGGGCTCGTCCCGCGTAAAGCCTCAGTCCTTATCC
CCATTTTCCGGATGAGGTCACTGAGGCCCGGTGAAATGACTTGCGCAAGGCAAGCGGGAT
TCGAACCCATGACCTCCGACCCCTCCCCCCCCCGGGCTCTTTCCACTAAGCCGCGCACTG
TAATAATAATAATGAGGTGGGTATTTGTTAAGCGCTTACTAGGCGCCGAGCACTGTTCTA
AGCGCTGACAAGTGGCCGAGGCGGGATTCGAACCCACGACCTCTGACTCCAAAGCCCGTG
GCTCTTTCCCCTGCTTCTGCTCGGAGCGAACCCTGCGGAAGCAGCTAGGGCAGCGTGGCT
CAGTGGAAAGAGCACGGGCTTTGGAGTCAGGGCTCGTGAGTTCGAATCCCAGCTCTGCCA
CTTGTCGGCTGTGTGACTGTGGGGCAGGCACTTAAATTCTCCGTGCCACAGTTCCCTCAT
CGGCTAAATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGTTGTCCCACGAGGGGCT
CGCAGTCTTCATCCCCGTTTTCCGGATGAGGTCACTGAGGCACAGCGAAGTGACTTGCCC
ACGGTCACCCAGCTGACCCAGCGGCAGGGGCGGGATTCGAACCCGTGACCTCCGACCCCC
AAGCCCGGGCTCTTGCCACGGAGCCGCGCGGCTTCTCCAGATGTAAATGTAAAGCAGCTT
GGGGGGGGGGAAGGGGGCCTGCCGGGGAGTCGGAAGGACTTAAAATTCTAATTCCGACTC
TGCCACTCGACCGCGGTGTCAGTGAAGTGGTATTTATTGAGCGCTTAGCGCGCGCAGAGC
GCCGTAATAATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGCGCTGGGGGAGACGCAGGGGGATCGGGTCGTCCCAC
GTGGGGCTCCCGGTCTTCGTCCCCATTTTCCAGCTGAGGTCACTGAGGCCCAGAGAAGTG
AAGTGACCTGCCCAGAGGTAATAATAACGTCGGTATCCGTGAAGCGCTTACTATGTGCCG
AGCACCGTTCTGAGCGCTGGGGGAGACGCAGGGGGATCGGGTCGTCCCACGTGGGGGGCT
CGCTTTTCATCCCCATTTTACAGATGAGGGAACTGAGACGCCGAGAAGTGAAGTGACTTG
CCCACGGTCGCCCAGCTGACCCAGCGGCAGGGGCGGGATTCGAACCCATGCCCCCTGACT
CCAAAGCCCGGGCTCTTCCCACTGGGCCCCGCTGCTTCTCCCTGAGAGGTCGAACTCATG
ACCTCTGACTCCAAAGCCCGGGCTCTTAGTAAGCGCCTAACGAGTATCATTCTGATGACG
ACGATTCAGTCGTTCGTCCAAGAGTATCTCTCGAGCGCCGACGATGTGCGGAGCACTGTA
CTGAGCGCTGGGGACGGACGGGGACGGGCTCACGGTCTAATTCGGGGGAGACGGACGAGA
ACTGTAAGCCCGTCAAACGGCAGGGACTCAGAGATCACTGAGGCACAGAGAGGTGAAAGT
CGCTCGCCCTCAGTCACAGAGCCGGGATTCGAACCCACGACCTCCGACTCCCGAGCCTGC
GCTCTTTCCACTGAGCCACGTTACGCAGGGTCCGGTGCTTAGCGCATAGTAAGCGCTTAA
CGAATACCATGATTAGCTGAATACCATGACTGTACCTGTTGCCGACCTGTTCGTCCCAAG
CGCTTAGTACAGTGCTCTGCACATAGTAAGCGCTCAATAAATACTATTGAAGGAAGGAAG
GAAGGAAGGAAGGAAGAACGATGGCGGTCAATAGAATCGAGAGGGGATGGTCAGACTGTT
GCCGAAAAGCGCTCAGTCCAGTGCTCCGCACATCGGAAGCGCTCAATAAATACCCTTGAA
CGAATGACTGAGTCGTCGTCATCGGAATGATACTTGTTGGGCGCTTACTAAGAATGAACG
GTGAATGAATGTTCTTGAATGAACGAATGTCTTGGTTTTCCTCTTCCGCAGCTGATGATA
ACGTTGGGATTTGTTAAGCGCTCACTACGTGCCGAGCGCCGTTCTGAGCGCCGGGGTAGA
CCCAGGGGAATCAGGTCGTCCCCCGTGGGGCTCCCGGTCTTCGTCCCCATTTTACAGATG
AGGGGACCGAGGCCCCGAGGAAGGGAAGCGACTCGCCCACAGTCACACAGCCGACAAGTG
GCAGAGGTGGGATTCGAACTCGCGAGCCCTGACTCCAAGGCCCGGGCTCTATCCCCCGCG
CCACGCTTCGGGCCGTGAGCCCGTCGCTGGGCGGGGACCGTCCCTATCTGTCCGTTCCGA
GCGCTCCGGACGGTGCTCTGCACATCGTAGGCGCTCAGTAAATACATCGAATGAATGAAG
GGGCACCATTTTAATCATCAGAGAGGAAAACTCGCTTCCCCTCTTCAAAACCCTACCGAG
GGCTCACCTCCTCCGAGAGGCCTTCCCGGACCGAGCTCCCCTTCTCCCTCTGCCCCCCCC
CCCCTTCTCCTCTCCGCAGCTCAACCCTCTTTTCCCCTTTCCCCCCCCCCATTTCCCTCC
GCTCCTCCCCCTCTCCCCTCCCCTCAGCCCTGTGCTCCTCCGCTCATTTATCTATATTTT
TATTACCCCATTTATTTTGTCGATGAGATGTACATCGCCTCGATTCTATTTATCCGCCAT
CGTTTCAACGAGACGTCCTTGCCCTCGGTTCTATCGACCGCCGTCGTTCTCCCCCGATTA
GAGGGTAAGCCCGTCAAAGGGCGGGGACCGTCCCTATCGGTTACCTATCTGTCCGTTCCG
AGCGCTCGGTACAGTGCTCTCTACGTAGTGAGCGCTCAATAAATACGATCGAATGAATGA
ATGTTCTGTTTTTCCTCTTTTGCAGGAGACGATCAGACCGTAGGCCCGTCACTGGGCAGG
GCCCGTCTCTATCCGTTGCCCGTCTGTCCACTCCGAGCGCTCGGTACAGTGCTCTGCACA
CAGTGAGCGCTCAATAAATACGACTGAAGGGGCGCCACTTTAACCATCGAAGAGGAAAGG
CTTCTTCCGCTGGCAAAGGCGTCGTGCGGCGGTAAACCCGGTGCAGCCATCACGGTGCTT
TAGAAGTACGTGAGTGATAATGACGACGACGTGGGTGTTCGTAAGGCGCTTACTATGTGC
CGAGCACCGTTCTAAGCGCCGGGGGAGATGCGGGGGTCATCGGGCCGTCCCACGGGAGGC
TCACGGTTCATTCCCATTTCGCGGATGAGGCCACCGAGGCCCAGAGAAGCGAAGCGACTC
GCCCGCGGTCGCGCAGCTGACGAGCGGCGGAGCCGGGAGTCGAACCCGTGACCTCTTACC
TACCTCTCCTCCCTTCTCTTTTTCTACCAACCCTGCCACACGCTCCGCTCCTCTGCCGAC
CACCTCCTCAGCCTTCCCTCGGTCTCGTTTATCCCTGCGTCTACCCTTGGGGCCACGTTC
CTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAGTCGGAGGCCACGGGT
TCGAATCCCGGCTCTGCCACTGGGCAGCCGCGTGACCGCGGGCGAGTCGCTTCGCTTCTC
TGGGCCTCGGTGACCTCATCTGGAGAAGGGGGACGAAGACCGGGAGCCCCACGGGGGACG
ACCCGATCACCTCGTATCCTCTCCAGCGCTTAGAACGGTGTTTCTTTGCACGTAGTAAAC
GCTTAACAGATGCCATCACCGTCATCGTTATTCTCTGGGCCTCAGTGACCTCATCTGGAA
AATGGGGACGAAAGACCGTGGGCCTCACGTGGGACAACCTCATTACCCTGTACCTACCCC
AGTGCTTAGAACGGTGCTCTGCACACAGCGAGCGCTTAACAGATACCAACGTTATCATCG
TCATTTTACAGGGGCGGGGAGGAAGAGGATCGAGCAGGGAAGCCAGGTGGAGCCTCGAGA
ACCCACTCCTATGAGAGGGTGCGTATGTAAAATCTATCTATATCTATCTATAAATGTTTT
CGTAAAAATATATACAATATTTATATAAATATATCCATGTCTAAACATATGATGTAAACA
TATAAATCTATATAAATATATTGATACGTATGTGTAAACATATAAATTTATATAAAAAAA
TATATATATAATATTTGTTAAGCGCTGCCGTCCCAGGCTCTGGAAGTACAGAACGGTGCT
TGGCACACAGTAAGCGCGTAACGGATACCGTCATCATCACCACCGTCATCCCAAGTTAAT
TGGGTTGGCCGCCGTTCACGTCCCACACGGGGCTCGCGGTCTCCATCCCCATTTTACAGA
CGAGGGAACTGAGGCCCAGAGAAGCCAGGCGCCCCGCCCGAGGTCACTCCGCGGACGAGC
CGCCTTAGAACCCGGCTCCTTCTCACTCCCTGGCCCCGCGCTCTATGCGCTAGGCCACCC
CGCTTCGCGGGCGGGAGCCCCGTGCGGGACGGGGGTGGCGCCTCCATCTGTATCCCTCCC
CGGGCGCGATGCTCAGCGCAGAGTAGGCGCTTGACAGACGGACACAATAATAAGGTGAGC
CAGCGGCCGAGAGAGCGAATCCCGTACGGCGCAGGCCGCTCCCTCTCCCCGGCCACGGAG
CAGGCGAGGCCTCTGGGATCGGACCACGGCCCCTCTTCCTCCCCAATCTGCTCCCCGGCC
GCCAGCAGCCGGCCGGGCGCTCAGTACGCCCCCCCGGGAGCGGCGCCATCGACGATCCTT
CTCTAGAAGAGCGACTCCGCAGACCTCCGGACGGCCGCCGTGACGCCCTCGCCTCGACCG
GATCCCGGTTTCACGGCGCCGCGGGCCCGTTCGCCGCTCCCTCGGTTTCACCTCCTACGC
GGTTTGCCGTGGGGAGATCGCCGGGAATGAACCTTGCCCGCCTTCTCCTCGATTGCTCCC
GTCCTCCCCTCGACGCCCTCTCCCCTCTTCCGGCTCCTGCCCCGGGAACAGCCGGGGACG
GGGCGGGGGGTGGACGCTCGATAACTCTAGGCCCGGTCGGGTGATCCGTCGGTTCTGAGA
CGGGACCCGCTTTCTTCACCCTGCGAGATGAAGTCTTACCCCGACGCTACGGAGATACGG
TGACCCCACCGGTCTCGGAGAGAGACGTGAGCGAGAAGCAGGAGGGCCCCGTGGAGAGAG
CACGGGGCTGGGTTCCCATCCCGACTGCGCGTGCCGCGTGACCGGGGGCGGGTCACCCGC
CCTCTCTGTGCCTCGGTCTCCTCAACTGGAAAATGGGGCTACGCCTCCCCCCTCCCATTT
AGACCGTGAGCTCCTCGCGGTTCAGGGACCGTCGGACCTACTGAACTCCCCGGTGCTTAG
AACGGCGTCCGACACGTGGCGAAACGTTTTCTCAAACGACGCGCTGGCCTCTCCGTCGAC
CTCTAGGTGTCGGCGGAGCGGGACGGGAGACGGTCCCACATTAAGACCGTTTAAACTTGC
TGCAGACTCCTCGTACACCCAGGAAGAGATCTCTTGGAAACAATTACGTCGGAACGTTTT
AAGACAGTCAGTGGCGTGGGGGTGGAGGTGACGGTCTCCATCTCTCACTCAGACCGAACG
CGTGGCTCCCCTCGGTCAGACCCGACGCGAATTCGCCGGAATCTACATCTCAGGATATCC
CCCGCCCCGCCCCGCCCCGCCCCTATGGAGAACAATCGAGCTCCGTATCCCTTTTTCAGT
GAACCGCAGATGGCCGTTAAGAGGCAAATTCTTTGTTTCGGAAGCCGAGGGGGACGTTCA
CAAAGCCAGTCCGGCTCGCTCCGTCGACGACCTTGAAAATCCACCGTCAGCACCTTCTCG
GGAAGCTCGCGTTTTCGTCGCTCGCGAACCTCACGTCGCTCCTCCCTGTACCTCCCCCGC
TCCCAGATCCTGACTTCTCTCAGCGGAGAGACCTCTCCCCACCACCCCGAGCCCACTCCC
CGCGTTTTACAAAACCCGCGGGAGGAAGGGGTCCCGTTTTCCAGAGGAGCCAATCCCCGA
GTCCGGCCCCTTCTCCTCGCGTCTCCCCCTTCCGCGGCTGCCCTTCGGCCACGCGCCCGG
GACCCGCGACGGACGACCCCTCTCGAAGAGCCGCCCGTCCCGGCCACGGAGACCGAGAGC
TGAAGCCGACGGTTTTATTTTCTCCTTCGGGAACCGGTTCCCCCCCCGTCCCCTTGCGGG
GATAAACCGGGGGCCCCGGGTAGCCCACGTATAAAGCCTGAGACGTGGGGGGAGGATTCG
ATACAAAAAGGACTATTTACGGAAAGGTGTGGGCGGCCAGCCCTCCCGAGGATCTCGGCC
ACCCCCGTCCTCTACCGGAAAGGACCCTCTCGGGGACCGCCGGCGTCTTAACCACTGGCA
GGCGCCCGGAACGGAGACCGGCCCCCCCGGCGGGAGCCCCCCGCCTCTCGCCGACCTCAA
AGGGGGACAGAGGATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGAGTCGAGGGGGAAAAACTGCTGAATATTACAGGCTCCCATCCGG
TATGCGGGGTCATGAGGTGAGCTGTGCCCAGGACATATTAAGTCAGACTCCCCTTCCTGC
CCTCAGTATAAGTGCATCATTGAGCAGTAATCAAACCCCCCCCCCCCCCCCCGACCCCAC
GGCCGAGCCGCCTCCCCGGAAGGACGGGAGAAAGGGGGGGCGGTCGGAGCCCGGGATCCC
GCCACTGGACCCCGGGCCGTCCGTCGGTCCAACCGTCCGTCGCCCGTGCCCCGCGGGGGC
GACGCCGGAGCGGCTTCTGGGATCCCCCAAGGGGAAGAGCAAGGCCGGCCTCTGACCCTC
TTCCCCGCCAAGAACGTGCCCCTCCCGGGCCGGAGTCACCGGCCGCCGGGGGTCAAGAGG
AGTCGGGGTCTCCCCGCCCGGCCCTCTGCGTCCCGGGGGAGGGGGCGGCTCAGACCAGCT
CGTCCAACAGGGTCCCGATACTCTGGGTGGGTTCGGGGGGGCCGGCGATCGGCTTGTTGC
ACATGGGACACACGGAGCGGACTTCCAGCCACTTCACCAGACACCTGCGGGCGGGACGAT
CGCGACGGTACTCGGTGAGTAGGCGCTCACCCTGTGCCCGGCGCCGTTCGAAGCCCCGGG
TCACGTGCGAGCTAAGCAGGTGGGACGCGGCCCCCGTCTCCCGTGGGGCTCACGCTCCCC
GTCCCCGTTTTCCAGGCGAGGCAACTGAGGCCCGGAGAAGCGAAGCGCCTCGCCCGGGGT
CGCACGGCAGACGCGTGGCGGAGTCGGAATCAGAACCCAGGTTCGGACTCGCGGGCCCGC
GCTCCGTCCACTAAGCCACGCTGCCTAGTCGGGCTCGTTTATCCCCTTCCACCTCCTTCC
CTCACCTTTCCACCTCCATTTTTTTTTTTCTTTTTTAATGGTATCCGTTAAGCACTTACT
CTGCGCCGGGCACCGTAGCAAGTGGTGGAGTAGATACGGGATTGCCAGGTTTGGGGGTTT
TTGTTTTTTTTTTTTTTTTTGCTTTAAAGGGTATCCGTCGAGAGCTTACTGCGGGCCAGC
CACTAAGCGCTGGGGGAGACGCAAGCTAATCAGGCCGGTCCCAGTCCCCGTCCCCCGGGA
GGCTCAGCGTCTCAACCTACGGAGGAAACGGCGTGGTCTAGCGGACGGAGCCCCGGCTTG
GGAGTCGGAAGGTCACGGGTCCTCATCCCGGCTCCGCCGCTTGTCTGCTGTGTGACCTCG
GGCGAGTCCCTTCGCTTCTCTGCGACTCAGATACTACCTCCGGATAATGGGGGTTAAGAC
CGGGAGCCCCGTGTGGGACAGGGATCGGGTCCGAACTGACTGACCTGTCCCTACTCCGGT
CCTCAGAACGGTGCCTGGCACAGAGTAAACACTTAAAAAACACCATTAAAAAAAAAACGA
ATCCCCATTTGACCGATGAGGCGACCGAGCCTATTACGTATCTGCTGATTCCTCCCGCAG
CGTGCTCTCGCGGGCGCTCGGGACACTGCTCTGCACTTAGTGAGCGCTCAATGAATGCCA
TGAATTGACCGACTGAGGCACGGGGGAGGTAAGAGACTTGCTCCGGGACAAGTGGCAGAG
TGGGGGACGCCGCCAGGAACCCCAGGTCCCTCTGAGTCCCGGGCCCGCGCTGCTTCACCC
GGACGGCCTGTCCGAGCGGGAGCCTCGGCGTCGGGGACCCGGCCCACTCTCGGCCTCAGA
TAGTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTGGGTGGAGGAGAATTCAATTTTGTATGAAAAACAC
CCTTCTTACCCCCCGCCCCCTTCCCGGCGCCCGCTCTTCACAGAGAAAAAGTGCCAGCCC
GAAGGACAACCTCAGGGAGGGGGGGGGAATCCTCGCCCCTTCCCGGGGAGCCGCGAGACA
CCTCACCACGGTCCCTTAACGCCCGGCCACCCCTTCCCGCCCCGCCGCCGGCCCCCGACC
CGACCTCCGCGGCGACGACTCACTTCCGATGGAAGGCGTGTTGGCAAGGCAGCACGCCCA
GCTCGTCTTTTCCCTTGAAGTCTTCCAGGCAGACGGCGCAGGTCTGCTGCGGGGAGAGGA
GGGGGCGGAGGGGACGGCACGTGTCACCCCGATCCGCCCGGCCCCGCCCCGCCGTCCCCC
CGGCCTCCCCCGGCCCCTTCCCGCCCAGCTGGCCGCGGCCTCGCTCCAGGGAGAAGGAAC
CGGGGCGGGGGGGAGGTAGGACATACTGTCCACCAGCTTCCTGAGGAAAGACGGAGAACG
GAGGGAGCTCGGGCGGGAAGGCCGGACCGGTGAACGAAACGGCCGGCGGGAGGAGGCGGG
GGCCCGGTGGGCGACGAGAAGCCGCCGAAAGGACCGGGCCGGGTGGGATTTCCCATCCCG
GAGTCCCAGAGGTGGGAAGCCGCCGGGGAGAAGGGACAAACAGAAGCCCCCGTTCCCCCC
ACCCCTTCCCACACCGTTGGTTCACGAGCGCTCACCGGGCGCAAAGCGCTGGATTAAGCG
GCGGGGAGAGTACGATACGACAACCAACGGACGCGTTCCCCTGCTTCACTCACCCCGTAT
AAATGGAGCTTCCTGGCATCTCCTTTGAGCACGACCTGGAAGGGGAAGGAAGAAAGACAG
GAGCCTGGAGCGACGTCAGCCGCGGCCCGGAGGGGCTGGCGGGGGGACGGGATTCGCCGG
GGAAAGAAGCTCGCTGTGGGCAGGGGACTCCGTATATCGTGCTGTACTTCACCGAGCGCT
CGGTACAGTGCTCCGCACCCGGCAGGCGCCCGATGGCTATGATCGATTGATTTAAGGGGC
GCTTCACGCCCCCCGCGCCCCCAATCGCCTCCTCCCGGTCGGGCGGGCCCTTGGGAAACC
AGACCGCCTGCCTAAAGCAAAGTGTTCGCCGACTCTGACAGGTCGTCCTCTCCCCAGTGT
TTAGAACAGCGCTCTGCACACGGCGAGCCCTCGATAAATACGATAATAACGACGGTACGG
GCCAAGCACCGTCCCAAGCGCTGGGGGAGATACCAGTTGGGCAGGTCGCCCCGGACGGGG
CTCGCGGTCTCGATCCCCATTTTCCAGATGAGGTAACTGAGGCCCAGAGAAGTGAAGTGA
CTTGCCCAACGTCACCCGGTTGACACGTGGCAGAGCCAGGATTAGAACCCACGACCTCTG
ACTTCCAAGCCCGGGCTCTTTCCGCTCAGCCACGCTGCAATTGCAGATCGTAATAATAAC
CGTGGTATCCGTTAAGCGCTTACTACGCGCCAAGCACTGTCCTGAGCACTGGGGTAGATA
CAACTAGAGAAGCAGCGTGGCTCAGCGGCAGGAGCCCGGGCTTGGGAGTCCGCGGTCATG
GGTTCGAATCTCGGCTCCGCCCCTCGTCAGCCGTGTGACTGTGGGCGAGTCACTTCACTT
CTCCGGGCCCCAGTTCCCTCATCTGGAAAACGGGGATGAAGACTGTGAGCCTCACGTGGG
ACAACCTCATTCCCCCGCATCTCCCCCGGCGCTTAGAACAGTGCTCTGCACGTAGCAAGC
GCTTAACGGATACCAACATTATTATTACATTATTGTTACAAGCTACTCGGATCGGACAGT
CCCCGTCCCACATGGGGCTCACAGTCCTAATCCCCATTTTACAGATGAGGGAACTGGGGC
GCCCAGAAGTAGAGCGACGTGCCCGAGGTCACGCACCGGACACGCGGAGGAGCCGGGATC
GGTAACGCGCGTCCTCTGACTCCCGGGCCCGTGCTCTTCCCCACCGGGCCACGGAATCCG
TGGCCGAATTGTCCGTTCCGAGCACTCGGTGCTCTGCCCGTAGTAAGCGCCCCATAAATA
CTACCGAATGAATGATGTTCAGACATCCGGCGCTCAGAAGAGCGCTTGGCACATAGTAGG
CGCTTAACCGACGCCATTATTATTATCTGTCCCGCAGAAGGAGAATTCTACTCCAGGCCT
CTGAGNNNNNNNNNNAAGCCGTACTTAAGTATTTACAAGAACAGTTCAAGAAAGAGAGAA
AGTCTAAATACCCTGATTCCCCCTATATGTAATTGGTTAGGATAGAGTCGTTCTAAGCAG
GCAGGGGAAAATAGGTTGAAGAGAAGTTCACTGGGGCAATACAGTAGTCCCATAAATACA
CAGTCCAGCACCTCAATAGGCAAGCTTCAGAAAAAATATAATAAATCCTCAAATAGAAAT
AAATTTAGAGACATGTACACCCTTAAGAAAGTGTATAATATGCCATGAAACACGCATGCC
ATGCCATAGGATCTGAAAAGGCGAGAAATACAATTTAATTCTCACAGTTCATTTCACCCA
TCGACACGGATGCTTTTCCCAACCACGCTAATCTATCACAGCCAATCTACAGATTTACGA
GATCCAGTGAGAAGATCACAGGCCCAGGAGTCAGAGGACGCGCGTTCCCGATCCCGGCTC
CTCCGCGATTCCGGTGCGTGACCTCGGGCACGTCGCTCTACTTCTCCGGGCCCCAGTTCC
CTCATCTGGAAAACGGGGATGAAGACTGTGAGCCTCACGTGGGACAACCTCATTCCCCCG
CATCTCCCCCGGCGCTTAGAACAGTGCTCTGCACGTAGCAAGCGCTTAACGGATACCAAC
ATTATTATTACATTATTGTTACAAGCTACTCGGATCGGACAGTCCCCGTCCCACATGGGG
CTCACAGTCCTAATCCCCATTTTACAGATGAGGGAACTGGGGCGCCCAGAAGTAGAGCGA
CGTGCCCGAGGTCACGCACCGGACACGCGGAGGAGCCGGGATCGGGAACGCGCGTCCTCT
GACTCCCGGGCCCGTGCTCTTCCCCACCGGGCCACGGAATCCGTTGCCGAATTGTCCGTT
CCGAGCACTCGGTGCTCTGCCCGTAGTAAGCGCCCCATAAATACTACCGAATGAATGATG
TTCAGACATCCGGCGCTCAGAAGAGCGCTTGGCACATAGTAAGCGCTTAACCGACGCCAT
TATTATTATCTGTCCCGCAGAAGGAGAATTCTACTCCAGGCCTCTGAGGACCTCCCAGAA
GAGAGTTTCCCGGGGGGGGCAGCGAGGTGAGAGGAGCCACCCTAACCGTGCATTTTCGTG
GCTCAGTGGCAAGAGCCCGGGGCTCGGGAGTCAGAGGTCACGGGTTCGACTCCCGGCTCT
GCCGCTCGTCAGCCGGGTGACCGTGGGCGGGTCGCTCCGCTTCTCTGGGCCCCGGTGACC
TCATCTGGAAAATGGGGATTAACCGTGAGCCTCACGCGGGACGACCCGATGCCCCGGATC
TCCCCCGGCGCTTAGAACGGTGCTCTGCACATAGTAAGCGCTTAACAGATACCGACATTA
TTATTTTCTAGCCAGCCCCTCGGGCTCCCTCGGGAAGAAACCGAGCACCGTGGATGGCTA
TAGAGGCACCCGCCTGCCCGGAGGCAGGCGGGTGGGTCCGTTTTCCGGCTCGGATGAGTG
TGCCATCTGAGGACGCCGTGACTCCGCTCCATTACCTCTCTGTAACCGTACCGCTCGCTC
TGGGCCTGGTGGCGAAGTTTGCTGGAGGAGAGAATAGGGACAGAGACAGAGAGTCCGTTA
CCGGGGCTGAGCCCTAGATCCTCCCCCTACCTCCCCTCTTTTCCGTAACGTAATCTACGA
AGCGCCTACTACGTGCCGGCCACCGTACCGAGCACCGGGGTAGATCCAAGCTAACCGGGT
CGGACACGGTCCGTGGCCCACAGGGGGTTCACAGTCTTAATCCCCACCTGTCAGATTCAT
TCATTCGATCGTATTTATTGAGCGCTTACTATGTGCAGAGCACTGTACCGAGCGCTTGGA
ATGGACAAACGGGTAACAGATAGGGACAGTCCCCGCCCTTTGACCGGCTCACGGTCTAAG
CGGGGGAGACGGACGGGCGAGAACGATGGCGGTCGACAGGATCGAGGGGATGGACGTCTC
GTTGAAACGATGGCAGGTAAATAGAATCAAGGCGATGTACATCTCATCAACAAAATAAAT
GGGGTGATGAAGATATGTACGGTCGAGCGGACGAGTACAGTGCCGAGGGGCGGGGAAGGG
ACGGGGGAGGAGCGGAGGGAAAGGGGGGAAAAGAGGGCTTAGCTGAGGAGAGGTGAAGGG
GGAGCAGGGGGAGCAGAGGGAAAAGGGGAGATGCGGTCACTGAGGCACAGTCCTCTCTAT
AGTGTGGGAAGGCCACTGATGACGATGTAATAATAATATGATTATAACTCAAGTGCCTTC
TGTTATCACAGCGTTACGTCAAGTGCTCACTACGTGCCGAGCACTGTACTAAGCGCCTGG
GGTACGTACAAGCTAAACCGTGACGCGGTTCAGATTTCGGTCACAGGGGAACGTACCGCG
CAGATCTAGTTTTAGCAATTGCACGTGGGTCCATTCAGTGACAAACTATTATTACGACGA
TTGTTATAATGGCATTTGTGAAGTGCTTACTCTGTGTCAAGCACTGTACTAAGCGCTCGG
GGGAGGGAAACAAGGCAATCAGGTCAGACACGGTCCCTTGTCCCCCACCGGGCTCACCAT
CTAAGGAGGCCGGAGAACGGACATTTAATCCCCATTTCCCAGACGACAAGACGGCCCAAG
AATCCCCACCGGTTCTTAACGGGACAGCCTGGTTTCTGACTTTGTTCTTCCAGTCCGCCC
GCTTCCCCAGAGCTCCGCGAACGGGGCCGGGCGCCCTGATGCTCAGCCCAGATTTTTCGG
CCAGAAGCGGCGAAATCCGCGCGGAGCCCCGTGCCCGAGACGGGCCCCCTCCCACCCCAC
CTCAGCTAGCCTCCATCTCCTTCGCCAGCAAACAGCGTGGCTGGCGGCGACCCCCCGGGC
CCCACCCCCATCCCCTTCTGTCGCCGCGGCCGTCCGGGGCCTGGCGGCTCGGCCGCCCCC
ACAGTAATAATAATTATTGGTATTTGTTAAGCACTTGATAATAATGATAACGTTGGTATC
TGTTAAGCGCCTACTCCGTGCGGAGCACCGTCCTGAGCGCCGGGGGAGAAACGGGGTCAT
CGGGTCGTCCCGCGTGAGGCTCACGGTCTTCCTCCCCGTTTGACAGATGAGGTCACTGAG
GCCCAGAGAAGTGAAGTGACTCGCCCACGGTCACACAGCTGCCAAGCGGCGGGGCCGGGG
TTCGAACCCACGACCTCCGGCTCCCAAGCCCGGGCTCTTTCCGCTGAGCCGCGCTGCTCC
TCTAGAATAATGACGTTGGTATCTGTTAAGCGCTGACTACGTGCAGAGCGCCGTTCTAAG
CGCTGGGGGAGATTACAGGGTCATGAGGTGGTCCCACGTGAGGCTCACAGTCTTCATCCC
CATTTGACGGATGAGGGAACCGAGGTTCAGAGAGGTTAAGTGACTTGCCCACAGTCACGC
GGCTGACAAGTGGCAGAGCCACTTATTATATGCCAGGAGCTCTACTGAGCCCCGGGGAAG
ATAGAAGGCAATCGTGTCGGACACGGTCCCCGTCCCCCACGGGGCTCGCGGTCTCCAGCC
CCACTTTCCAGATGGGGGAACTGAGGCCCGGGGAGGTGAAGCGACTTGCCCAAGGTCACC
CGGTTCCTCCCGACTCCCGGGCCCGGGCTCTATATCCAGCGGGCCCCGCCGGCCGGAGCA
CGGAACGGCCGGCCGGCGGCCCGGCTGGGAGGGCGGAGCCCGGGCGGGGGCGGGAGGCAG
CGGGGCGTCGGGGCGACGGATGCCGAGGCCCCCCCCCCCCCCCCCGTCGGGCCAGCGACG
GGCAGGAGTCTAAAAATAGCGAGCGCTCGGGGGGGACGGGGCCGGTGTGGGAGGAGACGC
CATTCCAGGTGATCCGGCTCCCCGCCGAGCAACGGCGCCGGGCCCCGAGATAATGTCTAC
TGTCCGGCCGGTGACTGCGTGTCCGTCCCCTCATCCTGTCTGAGAGGCAGGTAAGCGACC
TCGTCGGAGGACAGATGCAGCCAGCNNNNNNNNNNTGTATCCTTCTATATTTAGAAGCAC
CCACCCCCACACACACACACACACGAAACAGAGCCGTACTTGACGCCCGGACAGAAAGGC
ACGTGAGGCGCCGGCCGGGCTCGGTGGCGGTCCGACCCCGCTGCCTGGGCAAGGGGAGCC
CGGAGGCCCGGGCGTCGCGCGGCTATTCCCCGGCTCCCCTGGCCGCCGCACGACCGGAGG
AGAGGAAGAGCCAGGAGGGTCCCCGGCCCCGGGTCTCCCCGCCCGGAGACGGACCCCTCG
GCCCAAGAGGCCACGCCGTCCCCGGTTGTGGGGCGGGGAGGGGAAAGAGGAGGGGGAAGA
CCCTCTGCAACCCCTCTCGGCCCCCCTCACCTTTTCTCCAGCCCGGCTTCCCTGCCCCCT
CCTTCCATCCTCCCAACTTTAAATCCTCCCCCCCGCCACCGGTAACCAGGGAGGTCTGCG
GAGAGAATCTCCAATCTCTAAATAAATAAACGACCGCGGCCTTTATCCAGCAGTTGGCTC
CGAAGAGCTCCTCTCCTGCCCGTGCTCCTGGGCACGGAGGGGAGGAGTGCTTTACGGAGG
GACACGCGGGTCCGGGAATGCAGACGGCAATAACGAAGATAGCGTTCACTCAGCCTTCAC
TATAGTAGAACCACCGTGCTAAGCGGCGCGGCTCAGCGGAAAGAGCCCGGGCTTGGGAGT
CGGAGGTCATGGGTTCTGATCCCGTGCCAGCTGGGTGACTTCGGGCAAGTCGCTTCGCTT
CTCTGGGCCTCGGCGACCCCATCTGGAAAATGGGGATTAAAACCGTGAGCCCCGCGTGGC
ACGACCTGATCACCTTGTATCCCCCCAGCGCTTAGAACAGTGCTTTGCACATAGTAAGCG
CTTAACAATTACCATCATTCCAGGAAGAACGGATCTGACGCGATCCTCGTCCTTTTGTTT
TTCTGTGAAGCGCTTTCTACGTGCCAGGCACCGCACTAAGCGCCGGTTGGACCCAGTCCA
CGTCCTACGTGAGGTTCGCGGTCTCGATCCCCTTTATTACAGATGAGGCAGCTGAGGCAC
AGAAAGCTGTGACTTGCCCAAGGTCACGGAGCAGACGAGTACCCCTGGTCCTCCCCCTCT
CCCATCCCACCCCCTCAGCACCGTACTCGTCCGCTCAACTGTATATATCTTCATCACCCT
ATTTCTTTTGTTTAATGAGATGTACGTCACCCTGATTCTCTTTATTTGCCACTGTCTTAA
CGAGACGTTCTTCCCCTCGACTCTATTTATCGCCGTCGTTCTCGTCCGCCCGTCTCCCCC
GATTAGACCGTGAGCCCGTCGAAGGGCAGGGACCGTCTCTCTCTGTTGCCGATCTGTACA
TTCCAAGCGCTCAGCAGAGCGCTCTGCGCGTAGTAAGCGCTCAATAAATGCTATGGAATG
GAAGTAGCGGAGCAGGGATTAGAACCGAGGTCCTCCGACGCCCGGGCCGCGATGCTTCTC
TCACGGGGTTCGCGGTCTAAGAGAGGCAGGGATTATTACCCCATTTTACACCCGAGGAAA
CCGAGGCACAGAAAGACTTGTCCAAAGTCACGCAGCAGGCCAGGGGAAGAGCTGGGACTA
GGCTTCCTGACTCCGGACGCAGGCCCTTTCTATCAACCGAGGGCATTTATTGAGCACTTG
CCGTGCGCAGAGCCCTGCGCTCGGTGCTTGGAAAAGTGCAAGATAAAAGAGTGAGTAGAC
ACGCTCCCTGCCCACAAGGAGCTATTATCAGGCCACGCTTCCTCCATCTTGTCGGAAGCT
GGACGAGACCAAGTAAACACTCAGCTTTCTTCATCCTCCCCTGACCGAGCCCAACACGGG
ACTCTCTCCTCTACGCGGAGACTCGCCGAGCCCCCCAGCCCCGGGCGAAGGAAGAGGAAG
TCTGAAGCAACAGGGGTGGGTGTGAGTTCTCGGCGGCCTCGGGGCCGTGACCTCTCCGTC
ATTCTGAGTCACGGCTGGCTCCCGGACTGCCCCGACCGAGGCAAGTGAGAAGTGGCGTGG
CCTGACGGAAAGAGCGCGGGCCAGGCGGTCCGAAGGACCCGCGGTCTCATCCCGTCTCTG
CCACTTGTCTGCGGGGTGACTTTGGGAAAGTCACTTCACTTCTCTGGGCCTCGGTAACTT
CGCCCGTAAAACGGAGATGAAGAAGGTGAGTCCCATGAGGGACATGGACTTTGTCCACCC
TGAATGGCCTGTCTCTACCCCAAGCGCTCAGTACAGTGCCTGGCGCATAGTAGGTGCTCA
ACAAATGCCATAAAAAAAAAAGTCCTCCCTCTCCTGGGCCAACCGTATTTATCGAGCACT
TACCGTGGGCAGAACACTGTCCTCTGTGCTTGGGAGAGCACAATATAGCAATAAACAGAT
CGCATCACGACGAGCTTAGAGTCTAGAGGGGGAGACGGACATTAATCTAAAAAAATAAAT
TACAGATGTATACGTAAGTGCTGTGGGACCGGGGAGTGGGAATGTAAGGTCTCCACCCGA
CGTTTAAGACGTTTTCTGTCTTCCTTTCTGTCTTCCTATTGTCTTTCTCCCCCTTTTCTT
TTCTTTAAAAAACGCTATCGAAGTGCTGATCGTGTACCAGACACTGTAGTGGCTGCTGGG
GCAGATTCAAGATAATCAGGTTGGACACAGTCCCTGGCCCACGTGGCGCTCGCTGTCTCC
ATCCCTATTTTACTGAAGAGGTAACCGAGGTGCAGAGAAGTGAAGTGTCTTGAAGTAAAT
CTGCCTCTCCTCCTTCCTGGCTGCTCTCCCCACCCAGGTGAAAAAGTCACGGGGAAAAAA
ATGTTTCAATTAACCAATCAATGGTCTTTATTGAGCGCTTAGTATGCGCAGAGCATTGTA
CCGAGCACTTGGGAGAGTACAAGCCGACAGATTTAGAGGACTCTTTACCTGCCCATAACG
GGCTTAGAGTCTAGAGGGGGAGGCAGATGTTAATATAGGTAAATAATTTATGATATATAA
TTTAAAGATACGTACCCAAGTGTTGTGGGGTGGAGGCAAATATCAAATGCCCAAAGATTC
AAGTGCTTAATCCTCACTTCAGCGTTATTTCCCCCTCCCACTGAGACACAGCAGCCATTC
CGTATGTTCTTAGCGGGTCACAGACCAAGAAAATCACTCTCACACTCAGATCTCAGCCTC
ATATTCACTCACACAAACCCGTACGCTCACACCCAATCTGCCCGCCAACACCTATTCAAG
CGCCCACGTGTCAAGGACGCTGCGTCAATCCAACGCATTTACCGAGCGCTCACTGCGTGC
TGAGCGCTGGACTAAGCGCTTGGGAGGGTACAATAGCACAGAGTTGGTAGACACACTCTC
TGCCCCCAAAGAGCTCACGGTCTAGTCGGAACATCGGAAAGAAATAAAGGAAGAAAAAGA
TGAGAATACAGAGGGAAAAATCAAGGTGGTATGATTTGAGGAGGGGGAGATTCATTCAAT
AGTATTTATTGAGCGCTTACTACGTGCAGAGCACTGTACTAAGCGCTTGGAATGGACAAA
TCGGTAACAGATGGAGACGGTCCCTGCCCTTCGACCGGGGGAGATGAGGAAGAGAGGACT
GGAGAAGGTGAGGATGGTTGGGAGTAAAGTTGGGAGAGACAGACTGTAAGCTCCCCGTGG
GCAGGGATCACGTCTTCCGACTTTATTGTGCTGTGATAATAATAATAATAATTATTATTA
TTATGGCATTTGTTAAGCGCTTACTATGTGCCAGGCAGTGTGGCTCAGTGGAAAGAGCAC
GGGCTTGGGAGTCAGAGGTCATGAGTTCGAATCCCGGCTCTGCCACTTGTCAGCTGTGTG
ACCGTGGGCAAGTCACTTCACTTCTCTGGGCCTCAGTTACCTCCTCCGTAAAATGGGGAC
TAACTGTGAGCCTCACGTGGGACGACCCGATGACCCTGTATCTACCCCAGCGCTTAGAAC
AGTGCTCGGCACATAGTCAGCGCTTAACAGATACCAACATTATTGTTATTATCATCACTG
TACTCTCCCAAACACTTAGCACGGTGCTCGGAGCACAGCACGTGCTCATTAAAAACCACT
GAGCGACAGACCTTATGGTCAGTGGAATTGCCATCAGACATTTCTATTTAATAAAATGCA
GATGATACGCGTGGCCGTAAAGAACGGACCAGGCATCTCGGCTGAGTTCCCTTGGAACTT
TTTACTGTTCCCTACGGCGATGGACCCAGGAATTCCCCCAGGCCGAAATGTTACTCCTCC
GAAGCATTTTAGATCTTTTAGTGGGTTGGGTGGGCGGGGACCTCTACTAGCCGGCGGAGC
AAAAAGCGCCTCCGGGCTGGAGGAGAAAGAAGTGAGTGCAACCAGGTAGAGGAGAAAGGG
AAGGGGGAACAGTTTCTCAACTCGCTGGGTTAACAGAGGCCTCCAGACAGAAGACGCCGT
TGGAGTTTGTTCCGTGCGACTTAATATTTCGTGGGCGAAACAGACTCCAGAAATCCCAGC
CTGCGCAAGCCCTGCCTTAAGCGTGCAGTCCTACTCGGGGGATCGCCGGGAATAATACAC
TCGATCGTCGATCCTTAAGGGGGGGAATCGCGCCCACTTGCTCCACTGGACTCTCGCGGG
TCCTCGGCAGAGTGCTCAGCGCAGAGTCAGCGTTCGGGACGTGCCACCGATCGAGTGATA
GCTTCAGTTTTTCTTTTCCCAGTACAAGGCCTCATAAGCAAGGAGGTCCTAGGCTAAAAT
TGATGCCTGGGGCAAAGCGATGGGGTTGGAGATTCTCGGGAGCCCGGGGGGAAGCGCCGT
GGGTATTCTAACGCCCGCTGCCTCCGGCCGCCCGCCGGGAGCAAGCACGCCCGGGCTTAC
GGATGGGCATTCGAAGGACGTTACCGGGTAACCTTGCTGCAACAAGCCAGCGATTCCGAG
CAAGCCCACGGTAACCGAGCGAGTGTGACGGGGGCACCGTTTGACGGCGACGACCTGGCA
TTCCAACAACCCGGGAGGCCTGAGCACTGACAGATGAGGCCCTGGGGGGGGGACCCGGAA
GAGCGGAGGGCAACCTCAGGGTGGCAGACCCGCCCGAAGGACGGTGCCCGGGTCCGCCGG
TCCACCCCGGACCCCCGGGCCCTCCTCCCGCCCCTCCGCGCGCCCACCTGATGAAGTAGC
AACAGAAGATGAGGCTGAGCACGAAGACGAAGATGCCGGTGCCGAAGATGACCATGTAGA
TGTTGAGCGGGAGATCCTGGAAGCTGATGGGAGGCATCGCACACGACCTGTTGGCGGCAA
CCAGTCCCAGACCACAGAAACACCCTGGGAAGGATAAAAGGGAAACACTATCATCACACA
CCGGGGATTCAGAGAGCCCGCTCGGAGACCGTTCACTAAACTCGGCCTTCTCCTCCTCCT
TTCCGATCTGTCCTGGTTTTCCCAGTGGCATCGGTTAAGCGTCTACCGTGTGCCCAACGC
CGTATTAAGCCGGGGTAGATACGAGATGGGCAAGATAGGCACGGTCCCCGTCCCATAGTC
TAAAGGGAGGAAGAGGTATTTAATCCCCACTCGACACATGAAGGAATGGAGGCCCGGAGA
AGTGAAGTGACTTGCCCAAGGCAGTAGGCAGGTGGCAGGGCGAGGGGTTAGAAGCCAGGT
CGTCCGACTCCCGGGTCAGCGCTCTTAGCTACTTCTCTGGAAGTCTGCTTTTGGGCAATC
CACTGGTCGCTAATACATCCGTCAAAGGCGGAGAGAGGAGGGGAAGAGATTCAAGCTTTA
GGCAACAGATATCTGGCTCCGCAGCTCGCCTGGGGACGGGGGGAGGGCTTGACGCGGCTC
GGTGGATAGAGCACAGAGTCGGAAGGATCCGGGTTCTCATCCCAGCTCTGCCACGAGTCT
GCCGTGTCACTTAACTTCTCAGGGCCTCAGTCGCCTCGTCTGTAAAATGGGGATTGAGAG
CGCGAGTCCCACGTGGGACAGGGCTGGGTCCAACCCGATTGACCTCTATCTACCGCAGCG
CTTAGACCAGCGCTTGGTACGTAGGAAGCGCTTAACGAGTACCGTAAGTATGATCGCTAT
TAGTATTATCCTCCAAAAACCAGGAACGGAGTTGGAAAGGGATCGGGGAAGCCAACCGAC
CGCACCCCCTCCCCACGGCAGGACCGCACCTTAATTACTGCACAAGGGAGAGAAAGGCAG
AGAGAACAAGAGAGAGAGAAATCCATCGTATTTACTGACCGCTTACTGTGTGCGGAGCAC
TGTACTGAGCGCTTGGGAGAGTGCAATACAACAGAGTTGCCTTCCCCGCTCACGGCGAGC
TTACAGTTCAGAGGGGGAAGACGGACATTAATATAAATAAACGAATTACAGATATGGACA
TAAATGTCGCGGGGCTGAGAGGTGACAGAGAGACAGAGAAAAAGAAAGGGAGAGAGCCCC
AAAGGATGAGAATGTATGTCTGCTCCCTGCCAGCCCTGTCCTCTTTTTCCGCCGGGGCGA
CCCTCGGAAAGTTGTCGTGTCATTGCTGCCCGCTAAAATCCACATTTCAGAAAGGCCGCA
CGGTAGCGGAAGAGAGAGGGTCACCCTTAGAGCCGCTAAGAGGGGGATAGGTCTTACTCC
CGCCGCCGCCCGGTGAGCTGCCGGCACCGGTAACGCCCCCCGAAGCCTTCCGGCGGGGCA
ATTCGGGGCTCGACGGGGAGGGCGTGTGCCCCTAACTCTTACCCTCTCTCCGGTGCTTCT
CCCCAAGGCTGGCTCTTCTAAAAGGCACCTTTACCTCTGTGAAAGGCGAAGAAAGGAGGA
GAGCGAGGGCCCAAGAGGAAGCGGGAGAGCCCAGAGGAGGAGGTGGCGGAGGAGAGAGGA
GAAGAGAAGGAGCGAGCCCGCCAGAGCCGTCCAAGAGACCGGAGGCCCGGAGTCCCATCC
CGTCCCTCTCTCCTCCGCTCCTTCCCCGCCTGCCCGCCGGACAAAGGGAGCGGGACGCGC
CCCGCCGCCGAGCGGATGCCGGGCTCCCACGGGGCTCGGGAAGGAAGCTTCCCCTGCTCC
GTCCACCGTGCGGATCTCCCTCGGCTCCGGGGCCACCGCACGATGGGCGACAGGTGGTGT
CGCGGGAGGCTTCCCTCCTCTCCGGCGCTCCGTCTGCCCAGCCGCCACTACCCGGGGAGT
TTCAGAGCCGGGCACGGCGGAGGGTGCGGACCGCGGGGAGGGAGATGGCATCCGTGAAGC
GCTTCCCACGTGCCAGGCACCGGACTGAGCGCCGGGGCAGACGCGAGCCGATCGGGTCGG
ACGCAGTCTCGGGCCCACGCGGGGCTCGGGGTCCGGAGCCCCAGTTTACAGATGAGGGAA
CCGAGGCACAGAGGTGGGAGGTGACCTGCCCAGCGTCACCCAGCGGACGAGTGGCGGAGC
CGCGACTAGGATCCGGGTCCTCCTGCCTCCCCGGCCTGTGCTCTATCCACGAGGCCGTGC
TACCGTTTTTATTTTTTTACCGTATCTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGGAATCGGGGTGCGACCTGCCTA
CCCCCGCTCCTTATATTATACAAAGAAGCCCTGGTACCTTTGTGGAGTGAGATACAATAA
AGTGTGGAGTTATTTATTTTGCATAAAAAATCAGTTTTAAGCATTGGAATAGTGCCGATT
AATCAGGATGGACGCGGTCTCCTTCCTCACGTGGGGCTCACGAGCTCAGGAGGAGGGACG
ACGGTAGAAATGAGGCAGGGACAAGCGATCTCTCCGAGCGACTGGCAGAGTCGGGATTCG
AACCCAGGCCCTCTGACTCCCAAGCCCACGCCCTTCCCACGAGACCGATCGATCCATCAG
TCGATCGTACTTATCGGGGGCTCGCTGAGTGCGGAGCACCGTACTAAGCACCGGAGAGGG
TTCGATACCACGGAGAAGCAACCCGGCCAACTGGATAGAGCACGGGCCCAGGAGTCAGAC
GGTCATGGGTTCTAATCCCGGCTCCGCCCCTCGTCTGCCGTGTTACCTCGGGCAAGTCGC
TTCGCTTCTCTGGGCCTCGGTCACCTCCTCGGTAAAAGGGGAACCGATACCGTCCAAGTG
GGACAGAGACCGCGTCCGGTCCCGCTTGCTCGGATCCAGACCGGCGCCGAGTGCGGTCCC
TGGCACGTGGTAAGCACTTAGATAGCGTAATTATTATTATTATCATCACTGGACACATTC
CCCGCCCACAACAAGCTTCCAGTCTAGACCACACCGCTTCCCTACCGGGGCCGAAAGTAG
CAATCCGGCCCTGTCTCCCCAGAGCAGTGATCCGAGGAGGCAGGGAGCAGGTGGGAGTTA
ATAATAATAATAATGAGGGCGTTTGTTAAGCATTTACTATGTGCCAAGCGCTGTTCTAAG
CGCTGGGGGAGATACAAGGTTACCTGGTTGTCCCACGTGGGGCTCACAAGTCTTAATCCC
CATTTTACAGATGAAGTAACTGAGGCTCAGAGGAGTTGAGTGACTTGCCCAAAGTCACAC
AGCTGACAAGCGGGGGAACCGGGATCCACCGGGACCCGGGGGGCACCGTCCTCTCCGGCT
CTGGCCTTTCTGGACCTCCCGGCTCAGAGACGGCCCGGGTCGGGGGAGGGAGCGGGTGCC
GGGAAAACCACCCAGGGAATGGCCGTGCGACTGACTCTAGACTGTCAGCTCGTCGTGGGC
GGAGAGCATGGCCGCTAATTCTGTTGCACCGTACTCTCCCGAGCGCTTAGGACAGTGCTC
CGCACACAGAAAGCGCTCGATAGATACCATCGATCCATCGACGACACCCGAGGCTTGTCC
AGAGTTGCTCCCGGGAGGCGATGCATCCCTGAGCCACCCCCACGGGCTACGCAAGGAAGG
CAGAGTAGGGGTTTTCCCTCTACCCTTTCACGGAATTGGCCTCGACCAGTCAGAGCGGAT
TCTCCAGGAGGAGATCCCCTATCCTCCCGGCGCTAAATCCCCGAGCGCCCGGGCAAGGCG
ACTACAATAGCCCGGAACAGCGGATAGAGCCCGGCCCGGGAGTCAGCAGGTCACGAGTCC
TAATCCCGGCCCCGCCACCCTGCCTGCCGTGCGACCCTCGGGCGAGTCGCTTCACTTCCC
CTGGGCCTCGGGTCCCTCGTCTGTGAAACGGGGATTGAGACCGCGAGCCCCAAGTGGGAC
GGGACTGTGCCCGACCTGCTTCGTCTGCACCCACCCCAACGCTTAGTCTGGTGCCCGGCA
CGTAGCAGGCGCCCAGCGTTAATAATATCTGCATTCCCCGCTCCAGGCATCCAGACCCAC
CGCGGGCAGAGCCGCCCTCCGCAGTGACGGCACCCTTCTCCTGACCGACACGCTCATCCG
AACATCTTCCTGGAGGCTCAGCGGGGGATTCCCGTCAGTGGTTCGGTCAGTCCGTCGTAC
CCGCGGAGCGCCGTACTAAACGCTCGGGACGCTGTAACGACAAACGGACACATTCCCTGT
CTTGCTGAGGTGCCGGGGTTAAGGACTAGGAGGGGTGGGAGAGCCTTGGAAGAGAAGCAG
CTTGGTAGAGCCACCCTGATCGGGGGACGACTTATTAGACCGTAAGCTTCTTGAGGGCAG
GGATCACGTCTGCCGACTCCTGTTGTACCGCACTCTCCCGGGTGCTTAGCACAGTTCTCT
GCGCACGGAAAACACACGGTAAATAAGATCGATGGATTTCTTTTGCTCTGGAAACCTAGA
GACGGTATTTCCCCTCCCCCAGCCCGCCCCAAACTCCTCCTCCACCCAAAACTTGAAAGA
ACAGGAAACTGTGGCTCAAGAAAACAGCAGCCCCCAGATGTTTTGCATAAAAGCCTACGT
CTCCGGCTACATCCCGAACCCAGTTCGCAGGCGCTTTAGAAAGCAAAACTGAATGCAGCG
AACCTTCCGGCTCCCCCGAAGCAAGGTCTCAGAGAGTCAGACCCGGGTTTGGGGGAGGGG
GGGCCCGGACAGTACCCTGGATTGATTTAGGCTGGTTAGAGGTCAAGAAGAACAACTAAT
AAGGCAAAACGATATCCTTCCCACGGGCCCGTTGTCCACCGTCTCTCCCTTGGACCCTCT
CCCACTGGAGCGCGGACGTCCGAAAGTCCGTCTCTTCATCACCTCCTCTACTCCGTCCCA
AAGAGGGTGGGGCAAGGAGGCAAGTGAATTTGCCAGCGGCTCCTCCGATTCGGCAGATAC
CGCTTTTCCGTCTCGTCGTCTCCCCGAGCACCCGGCTCAGCGGCCGCGGCTCGGTCGGTC
CTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATT
CATTCGTCCGTTCGTCCGTTCATTCATTCGTTCATTCATTCGTGCGTTCATTCATTCTTC
CGTCCCTTCATTCATTCGTTCGTTCGTTCGTTCATCGATTCATTCGTCCGTTCGTTCATT
CGTCCGTGCGTTCATTCATTCATTCGTCCGTTCATTCATTCGTCCGTGCGTTCATTCATT
CGTTCATTCATTCGTTCGTTCATTCATTCGTCCATTCGTCCGTTCATGCATTCTTCCATT
CATTCATTCATTCGTCCGTTCATTCATTCGTTCATTCATACGTGCGTTCATTTATTCTTC
CGTCCATTCATTCATTCGTTCGTTCGTTCATTGATTCATTCGTCCATTCATGCATTCTTC
CGTTCATTCATTCATTCATTCAATCATCCATCAGTCCGTCCATCCGTCCTTTCGTTCATT
CGTTCGCTCATTCATTCATTTATTTGTTCATTCATTCAATCATCCTTCCATCCGTCCGTC
CGTCCATTCAATCATTCGTTCGTTCGTTCATTCAATCATTCGTTCGTTCATTCAATCATT
CGTTCGTTCATTCAATCATTCGTTCGTTCAATCATTCATTCATTCAATCACCCATTCATT
TGTTCATTCATTTATTCATTCATTCAATCATTCAATCATCCATTCCTTTGTTCGTTCATT
CATTCATTCGTTCGTTCATTCATTCATTCGTTCAATCAATCAGTCACCCATTCATTCATT
CACTCAATTGTTCGTTCGTTCGTTCATTCATTCAATCAATCAGTCATCCATTCATTCACT
CATTCATTCATTCAGTCAATCAAGCAGTCATCCATTCATTCACTCATTCATTCATTCAAT
CATAGAGAAGCAGCGTGGCTCAGTGGAAAGAGCCCAGGCTTGGGAGTCAGAGGTCGTGGG
TTTGAATCCCGGCTCTGCCCCTCGTCAGCCGTGTGACTGTGGGCGAGTCACTTCACTTCT
CTGGGCCTCAGTGACCTCATCTGGAAAATGGGGATGAAGACTGTGAGCCTCACGTGGAAC
CACCTGATGACTCTGTATCTACCCCAGCGTTTACAACAGAGCTCTGCACATAGTCAGAGC
TTAAAAAATACCAACATTATTATTATCCATTCATTGGATCGTATTTATTGAGCGCTAATA
GTGTGCACAGTTGTGGTCTAACCACTTGGAAGGTAAAATTGGGCAACGGAGACAGACCGT
CCCTGATGATTCATTCGGCTTTAAATCAACACTGATGAGACTGACAGAAAGACACGACAA
CAGAAGGAGTCAGGCTTCCCTAGCGTCAACATAAACCTGACTCACACGTATCCGCACATT
CTTTGACAGGACAAAAAGTTGTGGTTGACAGTCAGTTACNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTGGATCTCGCCTATCCCGCCGCCGACCCCCGGCCCGCGTCCCGCCTCTGGCCTGGAACG
CCCTCCCTCCTCAAATCCGACAGTGACTCTCCCCCCCGTCTTCCAAGTCTTATCGAAGGC
ACATCTCTTCCAAGAGGCCTTCCCTGATTAAGCCCCTCCTCTCCTCTCTTCTCCTCCCAC
TCCCTTCTGTTTCTCCCTTTATTCCAGCCTCCTCCCATCCCCACGGCACTTTTGTCCGTA
TCTGAAATGTATCCGTTTCTATTAATGTCTATCTCCCCTTCCAGGCTGTGAGCTTGTTGC
GGGCAGATAACGTATCTGTTCAGTGCTAAAGTGCACTCTCCCGAGCGCTTAGCACAGTGC
TCTGCGCACAGTAAGCGCTCAATAAATACGATCGAACGAACGAACGAGTGAACTCGATCT
CCTTCCCCCTTGCGCTGGGCGCCCTGTGTGGGAGACCGAGCTTTTCCCATCCAGTTATCC
TGTACCTACCGCAGCGCTTAGCGTAGCGCTTGGTACAGAGAAATGGCGCTTGTCCGACAA
CCTCCCACGCGCCTCTTCACGGGGACAGTCAAGTCACTGCGTTAATGAAGGGCTTCCAGG
GCGCTCGGTACCGTCTCCCGCTGCTTCCCCCTGAGCCCTGGGAAGAATGATGGACATGGA
TTGAGAAGCGGTGTGGTCTAGTGGATAGAGCGTGGGCCCGGAGGTCAGAAGGACCTGGGT
TCTAATCCCCATCCCGCCACCTGTCTGCTGTGCGGTCTTGGGCACGTCGCTTCGCTTCTC
CGTGCCTCAGTCACCTCATCCGTAAAACGGGGGTGAAGAGCGCGAGCTCCACGTGGACAC
GGACTGTATGCCGCCTGATCGTCTTGCCTCTGACCCCACGCTTAGTAGAGTACCGGCCGC
ATAGTAAGTGCTTAACAAATGCCGTTAAAAAAAAAAATCCAGCTCCGGGCCGGGGAGGTA
GCTTGCAAACTCCAGACCGGTTTAGTCTGCATCACTCCTCTCCGCTCAGAGTTTTGGCCT
GTTTTAGAGGTGAGGAAGACAGAGATGGCGGCTTGCCAAGGATCCCCCAGGGCGTTTTCT
TAGTCCAAAAAGACCATAATGATAGTATTTATTAATTTCTTACTATGTGCCGAGCACTAT
GCTAATCACTGAGGCCCAGTACCTGCCCTAAAAGGGGCTCTGGGCCTAAAAGGGAGGGAG
AATTTTGTTGCGCTCTCCCGAGCTCTTACTAAAGTGAGTATATATACGACCGAGTGATTG
ATCGATCGATTGGTTGTGCCTCTCTGTGCCTCAGTTCCCTCATCTGCAAAATGGGGATAA
TGATGATAATAATGTCGGTATTTGTTAAGCGCTTACTCTGGGCCGAGCACTGTTCTAAGC
GCTGGGGTGGACGTAGGGGAATCAGGTCGTCCCACGTGGGGCTCACGGTCTTAATCCCCA
TTTTACAGATGAGGGAACTGAGGCACAGAGAAGTTAAGTGACTTGCCCACAGTCACACAG
CCGACAAGGGATGAAGACTGGGAGCTCCACGTGAGATACGGAAGGTGTCCCTCGTGATTA
GTCCGTAATAATGATAATGTCGGCATCTGTTAAGCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGTGACTTGTCCAAGGTCACACAGCAGACAAGCGGCAGAGCCGGGATTAGAACCCAC
GTCCTTCTGACTCCCAAGCCCGCGCTCTCCCCTTTAGGCCACGCTGCTTCTCGCGAGGTT
TGTTCTGGCCTCCCAGTGATCCCGCCCCCCAGCTTTCATCTACCCCAGCACTCGGTACGG
TGCCTAGGACATAATAAGTGTTCGGGTTCTAATTCCCAACTCTGCCGCTTGTCTGCTGTA
CGGTCTTGGGCAAGTCCTTCACTTCTCTGCGCTTCGGTTAACTCGTCTATAAAAAGGAGA
TGGAGACCGTGAGCCCACGAGGGATGGGGACCGCGACCGGGCCGATTACTTCGGCTCTAC
GCCTGTGCTCAGTACAGCGCCCGGCACATAGTAAGCGCTTAAGGAATATCGCGAGGAAGA
GAATGAGGGGAAAAAAACGGCACGGCTGACCTGGATGATGCTGGAACTGACTCGGCGTGG
GGCTGACCTTCCCCCGGCCCTTCGCCCCAGCCTACTCTGCCTCTCAGGGAAAGGGGGAGG
CCTGGGCTCTCCATGAGACTTAGGCCCGACCTGTCATGGCTACCTTCTCTCATCTCCATT
AGTAGTGATGTGAGAGAGAAGCAAATCTCCCTTCTACTGTGTTTCCTCTTCTCCAGCTTC
CCCTCCAGTCCTGGTCCAGCCCAACAGCCTTTCCTCATCTGCTCGGCTGTCAGCGACCCC
AGTCTTGCCGGCCAGACGGTCGGTTTGGATCGCCTCGACCTTGCTCTGCTCCTCTCCTTG
GGCCCAGAAAATGTCCCCTGCCCTTTCAGGTGAAGTTTTTTTAAGGGTTGGCACTTTTAG
GCCCCTCTTCCATTTTCTTAGGACTCTGCCTTCGGCGTCTTACGTCTCAACTTCCCTGTG
CTTCAGTTTCCTCATCTGTAAAATGGGGATTAACACTGTGAACCCCCTGTGGGACATGGA
CTGTGTCCAATCTGGCTTGTAAATGCCCCAGGGCTTAGTACAGTGCCTGGCACATAGTAA
GCGCTTAACAGACATCATAAAAAAAAAAAAAATCAACTTCTCTGACCCTCAGTTACCTCA
TCTGTAAAATGGGGATGCCAGTTAGGAATGGGAGACTGTGGAGTCGGGGGAGTGTGTGCG
GGGGATAAGGGAGGCGGGGTGGGGAAGGGGATCTGACTAGCTCTGACCCCACTCTGCCTT
TGCCTCACCTGAATAATAATGATGTTGGTATCTGTTAAGCGTTTACTATGTGCAGAGCCC
CGTTCTAAGCGCTGGGGTAGATACAGGGTCATCGGGTTGCCCCACGTGAGGCTCACGGTC
TTAATCCCCGTTTTACAGATGAGGTGACCGAGGCCCAGAGAAGCGAAGTGACTCGCCCCC
AGTCACCCAGCCGACAAGCGGCAGAGCCGGGATTCGAACCCATGACCTCGGACTCCCAAG
CCCGGGCTCTTTCCACTGAGCCACGCTGAACGTTCCCCCGCCTCACGCCAAGTTGTCTTT
AGGGTAACTGGTGGGGGTGGGGGGGGGCGCTTAGTTGAACCTTCTCTGAATTTAGCTTCC
CTCTAGCTCCTCGTGGGCAAGGAACGTGTCCGCCGGCTCGCTTAGCGGAAGATCTCTTAG
TTACGCCGCTGTGCACGCAGTAAGCGCTCAGTAAATACAATAGATAGATGGACTGCTGGA
TGGATTTCTCCCCACGGTCTGCTCCTCATGACGTGTCCTCAGATCTCTCTGCCTCTGTTC
TCCTTCGGAGAATTGGAGGTAAATGGGAGAACTGTCCCTGAATAATAATAATAATAATAA
TAATGATAATAATGGTATTTGTTGAGTACTTACTATGTGCCAAACAGTGTTCCAGGTGCT
GGGGTAGACAGAAGGTAATCATCCTGTCCCACGTGGGGCTCACAGTCTTAATCCCCATTT
TACAGATGAGGTAACTGAGGCCCAGAGAAGTGAAGTGGCTTGCCCGAGGTCGCACAGCAG
CCAAGCGGCAGAGTGGGGATTAGAACCCAGGTCCTCTGACGCCCACTCCTGCTTCCCCTC
CACACCCAGACCCCACCGTTTTTACTTGCTGTTACACCGGCGGCAGAGGTGCGGCGGCAG
GGAAGGGACGCTGATACAGGTGGCATCTCGTTCATTCGATCGTATTTATTGAGCGCTTAC
TGCCCGCAGAGCCCTGTACTAAGCGCTTGGGAGACGACTACAGAACAATAAGCTGACACA
TTCCCAGCCCACAGCGAGCTCACTCCGGCCCGTCCCAAATCCCGGTTCCCCTCTTCCGTC
GGAGTGACAGCTCCGTGCGTACATTTGCGTGTGTATGTGTGTGTATCCTAATGAACGAGG
GAAGGGACTGGTGAGGGCAGCCGTCAATCATTCGATGGCGCAGAGCACTGTACTGAGCAC
TCGGGAGAGGACAACGTGACAATAAACAGGCCCGTTCCCCGTCCGCAACGAGGTGGAGGC
AGTGGGAATCATGCAGCCCAGTGTCGCCTGCGTGTTCCTAGGTGTGGTTTGGCCTCTTGG
CCCAACGGTGCCCAACACTCGTAGCCACTGCCTGCTTCACTTCCTCGGCTCCTCATCCTT
CCCGCTTCCTACCTCCCACCCCAGCACACCTCTTCCAAGAAGCCTTCCCTGACTGAGCCC
TCAATTCCTCTTCTCCCCCTCCCTTCTGTATCCTCCGGCGCTTGGATCCGCTCCCTTTAT
CCACCCCTCCCTCAGCCCCACGACTCCTATATATACCTCCACAATTCCCTTATTTATAAT
CATCATAACGTCGGTGTCCGTTAAGCGCTCACTAGGTGCCGAGCACCGTTCTAAGCGCGG
GGGGAGATGCGGGGTCATCGGGTTGTCCCACGTGGGGCTCACGGTCTTAATCCCCCTTTT
ACAGATGAGGGAACTGAGGCGCGGAGAAGCGAACTGACTCGCCCACAGTCGCACAGCCGA
CAAGCGGCGGAGCCGGGATTCGAACCCATGGCCGCCGACTCCCAAGCCCGTGCTCTTTCC
GCTGAGCCACGCTGCTTCTCTAATTTATATTCGTTTACATTAATTAAATCAATTCCATTT
AATTGCATTAATTAAATCACATTAATTTATATCAATGTCTTTCTCCCCCTCCAGACTGTA
AGGTCCCCGTGGGCGGAGAACACGTCTACCAACTCTGAGAAGCAATGTGGCTTAGTGGAT
CGAGCACGGGCCCGGGGGTGGGAAGACCTGAGTTCTAATCCCGGCGCCACCACTCGTCTG
CTGTGCAGCGCCGGGCAAATTAGTAAACTTCTCTGCGCTTCGGTTCCCTCCTCCGTAAAA
TGGGAATGAAGACTGTGAGCCCCATGGGGGGCCTACGTCCAACCTGATTAGCTCGGATCC
GCCCCAGCGCTTAGTCTAGTGCCGGGCACGTAATAAGCCCCCAGCAAAGAAGAAACAAAC
AAAAAAAACTGTTGTAGTCTCCTAAGCGCTTAGTACAGTGGTCTGCACATAGTAAGCATT
CAGTAAACATGGGTGATTGATGGGGATTAAGACCTTGAGCTCCATGAGGGCCAACCTCAT
AATCTTCTATCAACCCCAGGGTTTGGAAGAGTGCTTGGCACAGAGTAAGCACTTTAACAA
CTAATAATAATAATAATAATGTTGGTGTTTGTTAAGCGCTTACTACATGCAGATCACTGT
TCTAAGCGCTTGGGAGACTACAGGGGACCGAGGTGGACCCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACAGCGGCCTGATCCTCTGCCCGCCG
CTCCGTGGCCGCGCTCAATAACATTACCGTGGAGAAATAGCGGTCCCGGAAAAACGGGCT
GAAGCAGGAGGCTGCCTACGGGCCGGCTGGCACTTTGGTCCCCTGCCGTCCTCCCGGAGA
AGGAGGAAGAGGAGCGGAAAAGCGTAGGAGGAGAAGAAGAAGCGGGGGACCCTTGAAGTC
GCCTGGGGACGGGCGCTCTGTGGGCCCACAGCGCTTACGTCCACAACGGTAGTTTATTGA
TACTACTAATAATGATGATGGCACCCGATGAGCGCCTACCATGTGCCGAGCACCGTTCCA
AGCTCTGGGGTAGATGCAAGTCGGTCGGGTTGGGCACAGTCCCTGTCCCTCATGGGACTC
GCGCTCTTAACCCCCATTTTACAGTTGAGGTGACTGAGGCCCAGAGAAGCGGTGTGGCTC
AGTGGAAAGAGCACGGGCTTTGAAGTCAGGAGTCCTGACTACTCTCCTCGTCTCTACCCC
ATGTCATGTGTGAGAGCGTGGGGCAGACTATTCATGTAGCAGACACGCAGGTATCTCATG
CTCCCAACAGAGTGGCATATTGTTAGGGCGAGGAGGTCGAGAGACTTATAACACTTGCAA
GACTAGACTGACCACTGTCACTTCAAACATGATACGTACTGCATCGATGCCGGGATCCAT
GGTCTCTGTCCTGTGTGGCGGAGAACTGCACGGAAGGCTTGGAAGGACTACGAGAGAGAC
AAGTTTGGGAACACATGCTGCTCTGGCCCCGCGAGGGACNNNNNNNNNNGGATTCATTAT
TATTGTTGTTAGATGGAGAAGCCCCGAGGTCTAAGGCCCCCATCCACCCGGCTGGAATAG
AGGTAAAGGCGAGGCGACCGACGCGAGGAGGTTAGAAGGGAAGCAGCGTGGCTCAGTGGA
AAAAGCACGGGCTTTGGAGTCAGAGGTCATGAGTTCGAATCCCAGCTCTGCCGCTTGTCA
GCTGCGTGACTGTGGGCGAGTCACTTCACTTCTCCGGGCCTCAGTGACCTCATCTGGAAA
ATGGGGATTAAGACTGTGAGCCCCACGTGGGACGACCCGATTCCCCTCCGTCTACCCCAG
CGCTTAGAACAGTGCCCTGCACATAGTAAGCGCTTCACAGATACCAACATTAAGGGAGGG
GAGAATGATCTGGGGCCTGCTAGGCTCCAGGGTCACTCAGTGGTATTTATTGAGCGTTTA
CTATGTGCAGAGCACCATACTAAGCCCTTGGGAGAGTACACCCTAACAACACACTGACAC
ATTCCCTCCCACAACCAACTTTCAGCCTAGAGGGCCGGCAGAGGAGGCGACAGTCAGTAA
AACCTGGCCGCTGTCGCTCCGACACCTTCATCATCCTTCCCTTTCCCCGGGGGGCTGGAA
CTTACCGACCGCCGGGGATGGACAGAACCTGGAGCCTAGGGAATTTCTGATTTTAGCTCC
CTCGCCGCCCTCCCTCCTTCTCCCTCCTCTTCCTCTTCTGGTCTGAGTAAGCAGTAGCGG
GAGGAACGGAGCGAGGGCGGATCGCAGAACCTCGGGGGAGGCGGGGACTCTTGAAAATAT
CTCACATTTCCAGTCCTCTGAGGCCTCGGGCCCTTCGAACCAGCCGCTCGGGTTGAGGAC
AGGCGTCGTGAGGCCGGGACGGGACAGCGGCCTGATCCTCTGCCCGCCGCTCCGTGGCCG
CGCTCAATAACATTACCGTGGAGAAATAGCGGTCCCGGAATAACGGGCTGAAGCAGGAGG
CTGCCTACGGGCCGGCTGGCACTTTGGTCCCCTGCCGTCCTCCCGGAGAAGGAGGAAGAG
GAGCAGAAAAGCGTAGGAGGAGAAGAAGAAGCGGGGGACCCTTGAAGTCGCCTGGGGACG
GGCGCTCTGTGGGCCCACAGCGCTTACGTCCACAACGGTAGTTTATTGATACTACTAATA
ATGATGATGGCACCCGATGAGCGCCTACCATGTGCCGAGCACCGTTCCAAGCTCTGGGGT
AGATGCAAGTCGGTCGGGTTGGGCACAGTCCCTGTCCCTCACGGGACTCGCGCTCTTAAC
CCCCATTTTACAGTTGAGGTGACTGAGGCCCAGAGAAGCGGTGTGGCTCGCCCGGAAAGA
GCACGGCCTTTGGAGTCGGAGTCCGGATTCGAACCCGCGACCTCTGACTCCCCAGGCCGT
GCTCTTTCCGCTAAGGTCACACGGCAGACAGGTGGCGGAGCCAGAGGCCCATCCCCCCGT
GCTCTCTCCGCTAGGCCGCGCGTCTACTCCAAGCCCGTCGTGGGCAGGCGATGTGTCTGT
TGTATTGTTACGTTGTTCTCTCCCAAGCGCTTAGTACAGTGCTCCGCATACGGTAAACGT
TCAGGAAACACGCTCGACTAACTCTCTGCCTCCCCTTCTAGAAGGTAAGCTCACTGTGGG
CAAGGGAACGCGTCTACCAACTCCGTCGTACTGAACTCTCCCAAGGCCTTAGCACCGTGC
CCCGCGCACGATCGACGGATCGATCGATTTGGTTTCCCCTCCTTTCCTTCCCACGTGTGA
GGGGAGAGTCCGAGGTCCTTGTCGGGCTGCTGCTCGCCGCCGTGGTCGTGGCCAGGACGG
AATCTCAGAGCGGAGGTAGGAAACCGTTCATTCTCCTGCCACCCACGCTGATCCCCTGGG
ACCGGGGGAGATCGGACGGGGGGCAGGGGGATGCAGAATCTCCCAACGGGGCAATGATTC
CAGTTAAGCCTCCCTTCTCTCCGCATCTTTATTCTTCTTCCAGCGAGCCCGCATCCCCAC
CACCCGACGTGCCGTATTTACATTTCGGGGGGACGCCCGAGGGCCCCACCCGCCCCCATC
CGCCGCGCGGGCCTACGAGCGGAGCGACGACGCGTGCGGCTCCCTCCGCCCCCCCTCCAC
CGCCCCCCCGGGTACTTTCCAGGCCTCGGCTCATTCGCCTTCACAGCTTCCCGGGGCCAG
AGGGAGGCAGGGAGGGCCCCTCCTGTTTTACGGAGGAGGAAACCGAGGCGCGGAGAGAGG
AGAGGCCTAGTCGAGGCTCCTACGGTAAATCGGCGGCAGAGCCGAGACTTGGACCGACTC
CCCAGGCCTCCCCACCTCCCCCTCGATCGGCCGGCCTCTCCTGCCCGGCCCCTGGAGCTC
CCCGGGGGTCCGCGGGGAGGACGGGCGGGACGGCCTCTGGCTCTCTCATCTCCCGGGCCG
GCGGACGGGTGGGTCTCCGGGCCTACCGGCTATCTTCCCCCCGGCCCCGCCGGACCCTCG
GGCCGGGAGCCGGGGAGCCAGCCGCCCGCGGGGGCCCCTCACGCCTCCCGGCTCTGCCGC
AGCCTGCGGTCCAGGGCCAGGAGCTGGCGCAGGAAGCCCCGGTTGGGGATGATGCCACGG
TGGTCTTTGACGGTCTTGATGGCCTCCACTAGGGTGAGGCCATGGTACAGCATGAGGTAG
GCCAGCACCAGGGTGGCAGAGCGACTCACGCCGACGGCGCAGTGCACCAGGATCTTCCCT
GGAGACAGACAGACGGACAGGCACGCCAGGGGAGGGACGGGGCCGGCGGAAGGACGTTCA
GGCAGGTAGGGAGAGAAGCAGAAAGGGGAAGAGGTACCCGGAGAAAAATCAGAAGAATTA
CGGAAAGGAGGAGTCACACGGGCCGACCCATCATCGGCGTGGCCCGGTGGAAAGAGCGCG
GGCCGGGGAGTCGAGGGACCTGGGTTCGAATCCCCGTAGAGTCATTTGACTTCTCGGGGC
CTCGTTCTCCCGTTCTCCCTCCCACTTAGACTGTCAGCCCACGTGGACTGTGTGTCGAAC
CTTGTCAACTTCCATCTCCCCCAGCGCTTAGAACTGTGTTTGCAACCCGGTAAGCGCTTA
GCGATTACCAGTAAAACAAACGAGCAAATGAAGAAACGCCACAAGGAGACCTCGTCGGCC
CCAGCCCCCGCTTGGCCACCCAGGGAAGAGGCCGCGTCTCCCCCCCTCCGCCACGCTCTG
TCCCCCGACGTCCCCTCCTGCCCCGGACCCCGGTTCCCCGGCTCCGCCCTTACCTCCCGG
CTGGCTCAGGGCTCGGTGGATGAAGTCGGCCGCGGCCTGGAAGTGGATGCTCATGTCGAA
GGCGGGCGAGTCGTGGGCCTCGACCCCCAGGTAGCGGATGCCCAGCCCCCCGTAGGCCTC
GGGGATCCCACGCCACTTACTGTGGGAGGCGCTGAGCACGTGCGTGATGCCCAGACGGCC
CAGCTCCCGCCGGTTGGCGGCCACGTCCCTGAGACGAGGCGGGGTGCGGGGGAGGGAGGG
GAGGTTAGGCGGGGGCGCTGCTTTCTCTCTACCCCCCTCTGCCAGCCTCCCGACTCCCTG
GGCACCCGCTCTGAACTCGTTCTCATCCTCTGCCCTGATATGAAGCGGCGCGGCCTAATG
GGCAGGGCACGGGCCCGGGAATCAGGAGATCTGGCTTCTAATCTTGGCCCTGCCACTTGC
CGACTGTACGACCTCGGGCAAGAGGAATGATAATAGTTACGCTACCCGTACAGCACAAGG
TGCCAAGCACTGCTCCAAGCGCTGGGGTAGATGCAAGCTAAGCAGGTTGGACACAGTCCC
TGTTCCACATGGGGCTCACGGTCTTCATCCCCATTTTACAGATGAGGGAACTGAGGCACG
GAGAAGTGAAGTGACTTGCCCGAGGTCACATGGAGCAGACGAGGTAACTGAGGCACGGAG
AAGTGAAGTGACTTGCCCGAGGTCACATGGAACAGACGAGGAAACTGAGGCAGGGAGAAG
TGAAGGGACTTGCCCGAGGTCTCATGGCACATTAGAACCCAGGTCCTCCTGACGCCCAGG
CCCGCGCTCTAACCACTAAGCCGTGCTGCTTCTCCACTTCACCGACCCACGTGCCGGTTT
CCAAAGTGGGGATTCAAGGCCTGTTCTCTCTCCTACTTAGACTGTGAACACCGGTGGGAG
GGCAGGGACTGTGCCTGATCTGATTACCTTGGGTCTACCCCAGGGCGTAGAACGGTGCTT
AGCACGTTGTGAGCGCTTAATAAATAACTACGCATGTTATTATGACTAGTAGTATCATTA
ATAACGATCCCTAGCCCCATCCCAGCTCGGATTCCCGTCGGTCTTTCCCACCGTCCCTCG
GCTCTGCCTTTCCCCCGGTCCCAGCTTCGGGCCTTCCTCCGTTCTCTCGGCCCCGCCGAT
AACCGGCGACTAGTTAACCGCCGGCCTTAGTCCAGACGCCCTGCTCTCCGCGTTCGCCCC
GGAGCCATCTGCCTTCCCCCGTCCCGTGACCCGATGCCTTCCGAGGGACACTCGTAGCCC
TTGACCTCGATTCCCCACGAGGCGCCCTCCGGGAGAAAGGAGCCGGGAAATGGGAGAGGC
AGGCAGCCAAGCCTGGGCATAGCTCTCCTCTCTGGTGCCAGGCCTTCCCCCCTCCCCTCC
CTGCCCACACTTGCCCGCAACTGAGGTCGCCCGCACCAGTCATAAGCGGCATGGCTCAGT
GGCAGGAGCCCCGGCTTGGGAGTCAGAGGATGTGGGTTCCAATCCCCGCTCCTCCTCTTG
TCTGCGGGGTGACCTCGGGCGGGCCGCTTACCTTCTCTGTGCCTCAGTTATCTCCTCTGA
AAAATGAGGCTGAAGACCGTGAGCCCCGTGTAGGACAGACCGATCGCCTCGTATCTACCC
CAGGGCTTAGAACGGTGCTCGGTACCTAGCGAACGCTTAGCGACTACCGTAATTATTATC
TTTATTACTGTTACCCTGCCGTCCTCTAGACCGTAAGCTCCTTGTGGGCGGGGAACGCGT
CTGTCTCCCCACTCCGTTATACTGCGCTCTTCCGAGTGCAGTGATCCGCACAGAGTAAGC
GCTCAATAAATACGGTTGCCCGATTGTCCTTCCTGCCCTTCCTCCGCCCTCCTCCCCCCA
ACCCAGACATCCCCTCCCCGTTTGCCAAGGGCAGCAGAAGCCCGAGCTCCGGGCCCGCGC
GGCGGGACGGGTACGTACTGGTCTCCGAGGTAGAGGCCCGGCCAGACCTCGTCAGCGTGG
TTGCAGGCCGTCTTGCCGGTGAAGAGGAGGCGCTCCAGCTCGAAGACACTCAGGAGGGGA
TGCTGCGTGGGGGACGGCTCTTCCGAGGCCCCCCCGGCCCGGCCGGGGGACCGCGAGCCA
CCCCGGGAGAACCGGGCCATGAACGTCATGGAAGCCCAAAGCCAGTTGCCGGGACACATG
TCTCGGGGGGACGGAGGTGGCCGCTGCTTCTCTAGCCCCGCCGCTGCTCTCCTGCAAGGA
GGCAGGGGTTGGGAGACACCTGGGGGTAGGCGGGAGGGGGGCTCAGAACCCCTCCCTCTG
CCCGCCGGGTCTGGGGCTGCCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
GGAATACTATAAATAAATAAGGAATAATTAGCAAGAAACATCAAGCAACAAAGTTGTTGC
ACACACCTACTCACACACACACACACAGGCTTCAGTCACGGGTGCCGGGCACCCCCTCCC
CGACCCACCGCCGGCCTGCAAATCGAGGAACGGCCTCTGCTGGTCGGGCCGCCGACGGGC
TGACTCCAGGGGGGCCGGGTGTGACCAGGGAGGAGGACGGCGGCGGGGTGAGGTCATGCG
ATGTGCCAGTCTGCGGGTCTGCGCCCGGCCTGGGGGATGGCCCGCTTTAACCCCTTCTTG
TCCTCCGGCTGCTCCCGCCCCAGAGAGGGGGGCTGGGCCCCTTCCAGCAAAGAGTTAAGT
ATCTGGGGAGTATCAGGGGAGAGACCGGGGGGGGCCGACTGGGGCCGGGTCGGCGTCCGC
TAGCGTGAACCACTGTGGTCTGGTGGATAGAGTCCCGCTTCTGGGAGTCAAAAGGACCCG
GGTTCCGAACCCAGCTCTGCCACTTATCAGCTGGGTGACCTTGGGCAAGTCGCTTCACTT
GTCTGGGCCTCAGTTACCTCATCTGTAAAATGGGGATTAAGAGCGTGAACCCCGTGTGGG
ACGTGGACTGTGACCAACCTGATTAGCTTGGACCTACTTAGTCCGGTGCCTGGCGCGTAG
TAAGGGCATAACGATACGGTGCCTGGCACCCTGTAAGCGTTTAACAGATGTCACCATTTA
ATACCATTTAAAAAATCATACCTTCCCCTCACTGGCCCTGCATAGGGTATAGAAAAGGCC
AGAAGAGCAGGCGAGGGTAGGGGGTGCAGGAGAGGAGATTCGGCCTCAGCTCGGGGACTC
CACCCTCTTGAGGGGTAGGGAATACGGAGGGCGACGACCTCAGACAGAAACCCTTTCCCG
TCAGGGAGTCGGGAGCGGCAACCTAGAAATCCGGAGCCAGCCAAATGTTGTGCCCGTACC
TGTGTGACCTTGGGTTAGTCACTTCACTTCTCTGTGCCTCGGTTATTACCTCATCTGTAA
AATGGGGATTCAGACCGTGAGGCCCATGTGGCACATGGATTGCGTCCACTCTGATTAGCC
TGTACTTACCCCAGCGCTTAGTTCGGTGCCTGGCACATAGTAAGCGTTTAACAAATAGCA
TAAAAGGAAAGAAAGAGCAAGGGACAGCTGGTCTCTGGGAGAGTAGCACTGGGCTAGGGG
CTCGATGGAAGAGCTCGCAGGCCTCTGCCAGCCTCTGGAGTTTTGTGCCCGGCCACTGTG
CCCGGTTAACACGATACAGAGCCGCCTGGACTTCAGAGGGGCACCGTCGGCCTCCTGCTC
CCCCTCTGCCACCCTCCGAACTCCCTCTGGGAGGCCTGTACCTGTCTCCCCATCCTGTGC
CAGGAAAGGGGTTCACTCTGGTTTCTGGGGATGGAAGATTAGCCTTATTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1182, 4632..4681, 4763..4872, 4985..5049, 5638..5789, 6755..6809, 9315..9389, 9664..9783, 10164..10229, 10320..10361, 71732..71949
4632..4681, 4763..4872, 4985..5049, 5638..5789, 6755..6809, 9315..9389, 9664..9783, 10164..10229, 10320..10361, 71732..71809
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved