Ornithorhynchus_anatinus Locus NOP58
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus NOP58
Ornithorhynchus_anatinus
NOP58
Contig10764
SNORD70, SNORD70, SNORD11, SNORD11B, SNORD11
830..918, 2789..2877, 9389..9465, 11351..11438, 14825..14913
17429
GGGATTAAAATCCGTGTCCTCTGACTCCCAGTTCTGGGTTCTTTCCGTTAGGTCACCCT
GCTTCTCATTATACACAATTATTATTTAGTCTGAAGGAAAATTCATGGCATTGAAGCACT
GTACTGGCCACTTGGGGACATGTGGTAGACGACTTAGTGGGATTCTAAAGGGCTTCCAGG
GCAAATGAGGAATCGGAGGATCGGGTTACGGAAGGAAAAGATTCAGATGGACGAAAGGAA
GAACTTGTTGGTTCTGATGCCGTGCCACAGTGTGCTTCCAGCCCTGGCGATGGTTAAGGA
AAGAGCGCTGTCGGTCCCGGATTGCTTAGCGGGGGCGTTCGATGGGTTGCCCGCTAAAGT
TCCTCCTTGCTTAGAATTCCGACTTCCCATTGATTTAAGTTGCAAGCCAAGGGTTAAAGT
CCAGGGTCCCAAAGGACCGAAAGTGGCACCACCAAACTCAGTTACAGTAAGAATCCAGCG
GTGGCATATGAGCACTTCTATGTGTCGCAGACTCTCTGGAGCACTTGGGATCACATGATC
CCCACCCTCCAGGTGCTCACAGTCTAGTGAGAGGAACGTCTGCGGTGGAGTAGCCGTCTA
GAAGAATCCTATTTCAAAATCCTAATGGCATTATTTTTTTTTTTGCTCCCAGAGTGAAAC
TTAAACACTTCGAAAAGTTCCAGGATACCACAGAAGCGTTAGCAGGTAAAGAAAGAGCAA
ATCAAAACCGGTGTGCCCTTTCCGATCCTTTTGGTCCGCTTTCTTTATTCACACTTATTT
ATTTTTTATCATTATTTATTTCTGAGTTAGCCAGTTTCCCCAGCATCTTCCTCTTTGTTG
TCAATGATGCATTCATGTTGAAACTGAATCCAAGTGATTTAACTGAACAATTCGTCACTA
CCACTGAGACAACACAAAACCCAGCAAAATTGAACCGGGCTCCTTTGTCTAAACGCAGCC
AGCACTCATTCATTCGGTCTTATTAATCGAGCGCTTACTGGGTGCAGAGTACTGTACTAA
GCGCTTGGGAGAGGACAGTAGAATAATAAATAGGCAGAGTCCCAGCTGGGACGGAGTGGA
GGTTTGGGAAGGTGGTCTTCCTTCGAGAAGTGTCTCACGTTGAGCCCCCGGCCGGTGTCG
GTCCGAACTGTGGCTCGTAGACAAGGCCCCACAGGTTTGCTGACAACGGAATATTTGCCA
GTCACACAAAGACCCAAGCAGAAGTCTTGAAGGGGTTTTTTTTGTGTGTGTGTCGGGGGG
TTTGCACTTTAAAATGAGGCTTGCCACCAGCTGCTCGGACCGACTATCCAGGGCGTGTTT
TATGCCATGAGTTGGGGAGAGTGGGGTCAGCTGCCCCGTGTCCAGGCCTTCGGGGTTTAA
ACCAGTGGGGACTTAGACGGATAGTTTACGCCCTGCAAAAGTATAATCACTGGTCCCATA
GTGTCGGCAGCTGGAGGCCTGAAGAATGCCACGTTAAGAGAAACTTGGATTTGGGGTGTT
CTTCCAACGACACCCCGTTCTCCCAAGGGCCCTGACGTCGGAAGAACATTCTCCAAATTT
TCCCTCACATTCTGGCAGGGGCTTACCTCCCTTCAAGCCCTGTTGAAGCCTCCAAGAGGC
TTTCCCTTTCTTCTCCCGCTCCCTTCTGCAACCCTCTGACTCACTCCCTTTATTCATCCC
TCCCTCCCTGCCCCACAGCACTTACGTACATCTCTGCAATTTAATTTCTGTTAATGTACT
GTCTCCCCCTTTAGACTGTAAACTAATTGTGGGCGGGGAACGGGTCCATTATATTATGTT
GTACTCTTCCCCAGCACTTAACACAGTGCTCTGGCCACAGTAAGCCCTGGGGAGACTGAC
ACGTAGTGATAACCAGCGTTCAGCGGACTTAAAGATCAGAAACCAAAAATTTTGGCTTTT
CATTTGAATCGTTTTTATCTATTTTGGCATATTATGTGGCGAAGGTATTACATCACTTTT
TGAACTCTAGGGGAAGTGGTAGAGTTTGGAACCGCTGCCTTTTCTTGTTTGATTTTCTTG
GGATTTTTTCTGTATTTTTTCTCCCCTTGCAAAGCATCCACGGCTCTGGTGGAGGGTAAA
CTCAGTAAGAACCTGAAGAAGGTCTTGAAGAAGATCGTAGCCAAAGAAGCCCATGAACAA
CTCGCAGTGGCTGATGCCAAGTTAGGAGGTGTCATAAAGGTAAAACTCTTTTAGCCAGTC
GCAGATGATCCTGAACAGATCGGTTCTCTTGGGATTTCTAGCGGTGTTTTTATGCTGGCT
GGGTTATGACTGCCTCAGGTCTAGGAGTGGAGTATATACAGATCAGGCGGGAGGAACAGA
TTGAACCAGCGTTCTTGGGTAATATCTTTCTGTAGCAAAAAAAACCCCACTCTACATCTC
ACAATTTAATTGAAGAGCTGATTTTTGAGTTATACCCTTCACCTGGGTGTCGTCACAGGA
ACCAACAGATAGTTCAGAGTGTTGCTCTGAAAAATGAGTGGGAAATGTCTAGCTTTAAGA
TAACCAGCTTTCTATCTGTACCGAGCTCTGGAGAAAGCTTCCCAAATCCTAGAAGCAGCT
AAAGTAGCATATATTGGGAAAATAGCACCTACTTTCTTTCCCTTGTCCTCTCTCTCACCA
TGATTCTTTCCCAGTGTTATCTAAGAGTACCATTTAAGCACACTTTTAAATTATGGCATT
TATGAAGTGTTTTACTGTGTGTTTGACCATGCCGTCTCCCTAAAGATGTATCTTCGTTAA
TTACCAGTGAGTCGATTGAAGTAGGGTTCTTGTCTGTTGTCAATGATGCATTCTTGTTGG
AACTGAATCAAAATGATTTAATTCAACAATTCGTCACTACCACTGAGACAACACTGAAAC
TAGGTAGAGTTGAATTCATCTCTTTCTGAATGTAGCCAATGTTCTGTGACTATCTGACTG
GAGCCAAGGTATTTTTGAGAGAGACTTTTTTAAAAAAAAATAGCAAAGCCTGAGCGATTT
TTTTTTAAGTTTGTGAAGCGTATTCTCAGACGTAGGGCTTTTGGGCCTGATGAATTTGCT
GGCCTCAATTTAAACCCTCTTGTTCCCCTCTCTCATTCTTGTACTTCCCGTCCCTTTCAC
TTATGTTCGTTCCCTACCGTACCACTGGGAACATGGTCTGTGTGTCATTCAATCAATGGT
AAATTTATTGAGTGCGGAGCATTGTACTAAGCTCTTGGTAGAATACAAAACAGAGTTGGC
AGACACGTTCCCTTTTCACAGTGAGCTTCCCGTCTTGAGGAGGTAACCGACTTGGTGAGA
AGCAGTATGGCCTAGTGGATAGATCAAGGACCCGAGTTCCAATCCCAGTTCTGGCACTCC
GCTGTGTGACCTTCGGCAAGTCACTTAACTTCGTTGGACCTCAGTTTCTTCATCTATAAA
ACGGGGATTAAGGCGGAGCCCTACGTGAGACAGGGATTGGGTCCAACCTGATTAGTTTAC
ATCTGCCCCAGCTCTTAAAACAGTGCCTGGCACATAGTAAGCACTTAACAAATACCACCG
TTATTATTACTATCATTATTATGACATTAATATAAATAACTCGTAGATATATCCGTCAAT
GCTGTGGGTTTGGGGGTGGGGTGAATCCCGAGGACAGATCTGAGCGCACAGTTTAGCAGG
TCCGCTTTCCACAGCAAGCAGAAAAATTTCCAGTTCCCCTGAAGACTTCACCCACTTCAG
CTCCCAGTAACTGGCCTCTTCAATTAGGAAGCACGCTAATTCACACTTCCAAAATATTTT
AAAGCTTCGGAATTTTACGTTATGCCCCCGGCGTTTAAGTTTCCCCGTTAGATCTCATCT
CCCCAACTCCAAAGGTGAATTGCTAACAGGTAATGATGATGATAATTGCACGAATTGAGT
AGGTGTCAAGCACAGTGCTAAGTAGATCTAAAATGATGCTGATGAGAGTCTGGATTTCAC
GCAGCGCTAATAACCAAGGAATTAGGCAGAGCTGGGAAGTGAAATGTGGTAGCCTGAGAA
CAGGTTTCCTGTGGACACTTGTATTGACCAGTGGAGAAAGAACTTGAAATGCTCTACACC
AGCAGGGGGGATACTCAAAATTTGGTTACAGGCCAAAGTTCCTGTAAAAACTAGGGGGCT
CATCTCTTATCCGGCTCGGAGCCTGTCATCCTCCTCCCACCCCCACCCGTTTGTCTCATT
CTACCCAGTAACTTAAAGGGATACAGCACGGCACAGTGGCTAGAGCCCGGGCCTGGGAGT
CGGAAGGTCACGGGTTCTAATCCCGGCTCTGCCACCTGTCTGCCGTGTGACCTTGAGCCA
GACACTTAACTTCTCTGTGCCTCTGTTACCTGATCTGTAAAATGGGATTGAGACTGTGAG
CCCCACATGGGACAGGGACTGCGTCCCATCCAATTTGCTTGTATCCGCCCCAACGCTTAG
TACAGTGCCTGGTACATAGTACTTAGAAAATATCATAATTATTATTTTTAAAGGAGTGGT
ATTTGTTAAACATTTACTTTGTAGCAAAGCACTGTACTAAGTAGAGAAATCTTTTTGGGG
GGTCAGATACAGTCCCTGTCCCACACCTGGGTTCAGAGTCTGACTGAGGGAGATCAGGGA
TTGCATTCCCGTTTTCCAGGTGAGGTAGCCGAGGACCAGAGAAGTGAAGTGACTTGCCCA
AAGTCACATGGCAAGCAAGTGGCAAGGTAGGGATTAGAACCCAGGTCCTTCTGTCTCCCA
GGCCTGTTAGTGCTTTCCATTAAGCCCCGTGTTGTTGTTGACACTAGATTCGACTTGGCC
CCCAACTTCACCTGGTTTGAATTTTGCTTCCTGTAGGAAAAACTGAACCTGAGCTGCATC
CACAGCCCAATGGTCACAGAGTTGATGAGAGGGATCCGCTCTCAGATGGAAGGGTTGATC
ACCGGCCTGCCGTCCTCCGAAATGGCGGCCATGTGTCTCGGCCTGGCGCACAGGTGAGTT
GTCTTCCCGGGAGTGGGCCTCAGGTTTGGCCTAGGTCTTCCCCTTCCACGGGCTCCTTGG
CCCTCGGGAACCGCGTCCGGTGTTGGCCAGGGGCTGGAGTGCATATTTGGGCCCTGACTA
AATCCCCAATCCTCCTCCCTGCCCCTCTATGCACTTGGCGGTGGACCCCTTAAAACTCTT
TGATAATCACCCCAATCCTGCAGCACTTGGGTTTCTCTCCCTATTCTCTACTACCTGATT
TTCACATCCATCTCCCCCTCTAGTCCTTAAGCTCCCTGTGGGCAGGGATCGTGCCTGCCT
ATCAGTTTTTTCCCCCCCAAGGGCTCAGCATAGCTCCCCTCACCCAGTAAGCGCTTAGTA
AATACCATCGGTTGATTGACGGTGCTACAATTCACCCTGATAACTATTGCCCACCCTTCT
TTTTGCTTTGGAGACTGTATCTCTACAAATTAACCTCTGCCTTCCCTCAAAATGCCAGGT
TGGCATTGATGTGTAAAATGCTTCAGTTCAGGGCGATGTCCAATTACACTGGGGGATATG
AAATAAAAAAGGGTTCCGTCACAGATGCCCACTCTTTGGAGCTCCGAGGGGCTCACAACT
CACCCCCGACCCTCGGGGTTTTCTTGTCGGAAGGGGAAGCATAGCTAGCCTGCCTGTCCC
AGCCCTTAGGATTTGGAAAAAAATCAGGAATCAAGATGGCAACTCTACCTCTTCTTTTTT
TTTGTTGTTTTTATGGTGTTTAAGCGCTTATGTGCCTGGCATTGTACTAAGCGCTGGGGT
AGATAAAGGCTGATCAAGTTGGACACAGTTCATGTCCCCCATGGAGTTCACAGTTGGAAG
CAGCGTGGCTCGGTGGCAAGAGCCCGGGCTTGGGAATCAGAGGTCATGGGTTCCAATCCC
GGCTCTGCCACTTGTCAGCTGTGTGACTCTGGGCAAGTCACCTAACTTCTCTGTGCCTCA
GGGACCTCATCTGTGAAATGGGGATAAAGACTGTGAGCCTCACGTGGGACAACCTGATGA
CCCTGTAGCTCCCCCAGCGCTTAGAACAATGGTCTACACAGAATAAGCACTTAACAGATA
CTAACAATATTAACACAGTCTTAACCCCCATTTTACGGATGAGGGAACTGAGAGAAATGA
TGTGACGGCAGACAGGTGGAGGAGCCAGGATTAGAGCCATACCGCTGACTCCCAGGCTTG
TGCGCTTTTCCGCTAGGCTGTGCTTCTTCCACTGGACTCTTGCTCTTGCCAGCTGATCCT
GGGGTTCTTGTGGATGGGGTGAGCGTTGGGTGTGGCCTGGGGTCTCCAGCTGGAGCCGGA
TTAGGGCTAGAGTCTTTTTGGAGCCAGCGCGGGGGCCTTGCGGAATTAGCAGGGGGTGGG
GGTTAAGGGGCGATGCCCGGAGCCGTGGCAGCATTGAAAAACTGGTGGGGGCTCGGGGTG
GCTTGTGGAGCCTGAGGGGCCTCGTGAGGCTCAGGTGTGAGGATGATTGTCATCTTCCTC
CTCACCTTCCCTTCTCTTTCTCCCTGCCCCCTTGAACCTCCACTCCTGAGGTCGTCCCCA
AACTCAGAAAGAAAGTGTCTCCTCCCAAATTGCACGCTGTATAGTTTTAATAGCAGAAAA
AGGGATAGACGGAAGGAAACTAAACACAGAAACTGTAAGTGTGATTTCTAAGTCACAGGA
ATAGGTTCGTCGACTCTGAGGAAATGTTCAAGAACAGGTTTGGTCATTTGAATTTCAGAA
TTAGAGTTTATGTTCCTCCTGACGTAGAAAAATGAGCTTTCCCGAGTGCTCAGTGTTCTG
TTTATTTTCACAGCCTCTCTCGATACAAGCTGAAGTTTAGCCCCGACAAAGTGGACACGA
TGATCGTTCAGGCGATCTGTAAGTACCCTTGTGTTTTAAGGCAGAATTTTGCTGCTGGCT
TGGCTCTGCGTGAAGCTTCTGCCAAGCTCCCCGTGGCCCTGGATTCTGAGGGGATCTTGC
GGGGTAGAGAGCGTCTAAGTGTCATCACCGAGGCCCTCGTGGGAGCCTTGGGCTTGGAGA
CAGATGCAGGGACCCCGGGCTAGACTCTGGAAAAGGAACTTCTCAATGGCCCCTAAATCC
TCCGAGAAAAGTTTAAAAGTATATCCAGGACCGGACTTTCTGGGACAGCCCAGGGATGTT
TGAGCCAAGCAGCCATGGGATAGGTAATGCCCCGCCCCTTGAGAACATATCGAACCGAAA
CCTGCAGAGAGAGATATCAGAAAAATCCCCTTTGGTGTTGTTGACTCTGAATTCCTTTGA
CCTTTGTAAAGGGGCTAACCATTATTCCTAAATGCTCCTTTCTGGCAAGACAAGTGAAGG
GCTGAATTGCATACTTCTGAAGCAGCGTGGCCAGTGGCAAAGAGCTCAGGCCGGGAAATC
TAACCTCGGCTCCGCCACGTGTCTGCTGTGTGACCTTGGGTGAGTCACTTAACTTCTGTG
TGCCTCAGTATCCTCATCTATAAATTGGGGATCAATCCTACTCCCTCCTACTTAGACTGT
GAGCGCCATGTGGGACAGGGACTGTGACCAACCTGGTGACCTTGGTATCTAGCCAGGGTT
AAAATAGTGCTTGGTATGTGGGGCTTAACAAGCACCCAAATTATTATTGTTATTATTCTG
CATCCGCATAGCTTAGTTCTTAATTTAATGTGTGGCAGGAGAAGCATTTCCTAACCAGTA
AACAATCAGTCGATGATATCTGCATACTTGTTATGTCCAGAGCCTGTTTCCGTGGCAAAG
TCCTCCCTTCCAAGAGCCCCACAGGGGATTGACTGTTGAAGTCACTTGAGTATTGTGGGG
ATAAGAGAGAGCATGTTGAGTTGGGGAGTGGAAGAGGGTAGGAAGCAGATCTGGGGGAGA
TGCCTGGAAAACTGACTCTCGAATCTCTGCCTCAAAGGGGTGGGCTATTTTGGAGGCGGG
GCAGCGTGCTCATTCTCTCCCCGTAATTCCCGGCAGCCCTGTTGGACGACCTGGACAAGG
AACTGAACAACTACATTATGCGCTGTAGAGAGTGGTATGGCTGGCATTTCCCCGAACTGG
GCAAAATCCTCACAGACAACTTAACCTACTGCAAGTGCTTGCGGAAAGTGGGTGAGTCGA
CCGCTAACCGTCCCTCCGGCCGAGAGGTTTCCGTAGTAGATAAGGCACTCGAGAGCCTGT
AGGTAAAGTGGGCGGCCGAAAAATTCCACCAAAGCCGGTATTTCTTCACGTCGTCCGTCT
TGGTGGGCCCCGGTCGAATCTGACCTTGGGAAGCAAGATAGCCACGGGCTTTGAATTTGT
GGTCCTTTGCGATGACCACACGTATTTAATGTTTGGGGCTTGATAATGGTCAGTGTGCAA
GAAAGCGTTTTGGAAAATGACAGCTGAATCTTCTTGTGGGTGGAGAGAAGGGCTGTTAAC
GACACTTGTGAGTGGTCCAGTGTTCAGATGTCAGTGAGATTTTCAGATGTATATACGTAC
GTTTATATGTGCATATATTTTAATGGTACTTGTTAAGTACTTTGTGCCCTGCACCGTCCC
GATCAGTCACTGGTATTTACCGAACGCCGACTGTGTGCAGAGCACTGAACTGAACGCATG
GAAGAGAAAACTGCAAGAGCGTTGGTAGATGTGTTCCCTGCCCACCACAACCTTCCAGTC
TAGAGCCCCTGTCTCACAAGGGATTCCTTGTCTAACTAGGAAAGAATAGGATGTAATCCC
TGGTTTACAATTGAGGAATCTGAGGCACAGAGAAGTGAAACGACTTTCCCAAGTTCACAC
AGCACGCAAGTGGTAGAGCCGGGATTAAAACCCAGTTCCTTTGACTCCCGGCCTGAGTTT
TTTCCACTGACTGACCCGTGTTCGATTAGAAAATCACAACTCCAGTTTGTTCACCTCAGT
ACATTCCAGGTTTTTGGCCAATGCAAACAGTCCTTTGTGGTGGATCAGTTTTAAAGATGT
GCTCCACTGAGACATTTTTCTCCTCAATCCCAATGACTGAACTGGGCAGTTATCTAAATT
TAGGTGTCCATATTTTGGGACCCTCAGAATCAGACCCGTCTCTTGTTTTGTTTTGGGTTT
TTTTTTTGAGTCACTGTCTCTTTATTTTGATTTTTTGCTGTTAGTTTTGGCTCCCCCCAC
TCTTCTTTAATAATCATTAATCGTCCCCTCCCTCCCCGTGCCTCTCAACAGGAGACAGAC
AGAACTTTGCCTCTTGCGATCTTTCTGAGATCCTGCCAGAGGAGATCGAAGGCCAGGTGA
AAGCGGCCGCCGAGGTGTCAATGGGAACAGAAGTGTCGGAAGAAGACATAAGTAACATCC
TGCACCTCTGCAACCAGGTAAGGCGCTGGTCAGCCGATGGATCGCGGCCGAGTTTTGCCG
CTCTTTGCCTCTCTTCCTAGTTTTCTCGATGGCGATGATGATTTCTAGATTTTTGCTCTC
CTGATGTAGCCGTGAGGGTGCAAAGTCACTACCTCATCTGATGCCATCTCGGAATGTTCG
TGTTAAAAAATGGAGTGGTGGTGGAGTGGGGGGCGGTCGAGCAAGGGGGTCTGAAAGGCT
GAGTCGTTGGAACTACTCATCCGCCCTTGCCATTTCAAAGGGTGTCGGGGGGAGGAGATT
AGAGATGTGATTGTTTGACTTTAGTAGTCATAATCAACATTGATAAATTGGGTACTATCA
AACCGCCCATGTTGGTTTGCGATAGTGCGGATCACAAGTCTAAGATCCAAAAGCCTTCTT
TTCGTCATGTGGCAGCCAGCTGCTCCTGAGGATGGAGGTTTTTCCATCGTGCAATTCCCC
AGGTGACCTTCAGTCAGCACCCTTAATGAATTTAGGGATCCCTGAAGGGGGCCCGGCAGG
AGGTAGAAAGAGGAGGAGCAGGGGCTGGGCGTCACCCATCCCAATCCGGGGTTAGTCGTC
TCTACAGTACAGTGGAGTTGGTGGACGCCATCCCTGTCCACAGGGAGCTTCCAGTCTACA
GCGGGAGACAGATATTAAAGTAGATTAGAGATAGGGGAAATTGTAGAGTTATAAGAATAT
TTACATATGTGTTGGGGCTGGGGTGGGGATCAAGGGATGCACTTTTGACTTGGGAGGAAG
AGCAGTTAGGGAAATAAAGGGCTAAAGCCAGGGAAGGCATCTTGGAGGAAATGTGAAGTT
AGGGGGGGTTGGGTGTGGAGAGAGGCGGACTGTCAGCTGTGAAGGGGGAGGGGGTTAGGC
ACCCAGGGGGAAAGCAGAGGTCCAGGTCAGTTCCCCGGTTGTTGTTCATGGGGAGTGCCG
CCTATGTTAGCGGGAGGTTGGAGGACCCCGGTCACGCTCGCCACACATCTTTCCTGATTT
TGACACAGTTCCCTCACACCCATCACCTTGCCAGACTCAAGAGTCCGAGTGTATGAATTG
GGCTCTCGTTAAGCCCCGTTGTCCACCGGTGATTTTTTGTCCCGGTCCTCCCACTTGTGG
TGCCCTGACGTAATTGTTTGTAGATCATTGTCGTCGACCCACTTGACCGTCACCTCCCGG
GACCGGGGTAATGATCGGTGGTGATGTTTCTGTTGTACTCTCAGTCCAATGCTCTGCTCT
AGGTAAATAACCACTGATGACGTGGATGACCATGGTGGTGATGATGGTCGAGGTCTGGCG
GTGGGGGAGTGTTCCAGGTTGGGTCCCGGGCTGAGAGGAAAGGCAGTGGGCATTTTTAGG
AGTCCCATTTCTAGAACCGGTTGAGTTCTTCTAATTTCAGATAGGAATTTGGGGCTCAGA
GTGACCTTTTTTAAATTCACGTTTGGCTTCTCAACAGACGGGGCCCATTGTTGCCACGGT
GGCTCCGAAACCTCTCGGCCCTTGGGCGCTTATTTGCAGTGCGATTTTTTTCCCGAGTTA
GTCTGAAGGCGCCCTGAGTCTTAATTTCCCAGCCCTGGGGAGGAAAGAGATACCTCGACT
TCTTCCCACAGCCCTCGGTTTTCCGGACGGGGGGCGCGTCGGTTGCTCCGTGAATGTATT
GGTCGAAAGGGTTATCGGTCGGCCGTTTGTCACGCCGGGCCCTGACCGCTGCCGTTTGGG
TGTTCGCTCCAGGTGATTGAGATCTCAGAGTACCGAAACCAGCTCTACGACTACTTGACC
AACAGGATGATGGCCATCGCCCCCAACCTCACCGTCATGGTGGGCGAACTGGTCGGAGCC
CGGCTGGTGGCCCACGCGGGTAAGTTGTGCCCGGCCAGCGCAAGTCTCGCCCTCCAGGAC
CTGCCCACTTCTGTAATTTGCCGACGAGGACGGCGCACTTGCGGGCTTTCCTGCTCACTT
GACCTGGGTTCAAAAAGAGCTGTGTCCTGCATAAATCCTCGTGGGGAAGGGGAGGGACGG
GGATGAGGGCCCAGTGATCGGTGATGATTTGGATTTGTTTGCCTGACTTCCTTTGTGGAT
AATGAAGGCAACTCAGTCACTACCTCTTCTGAGACACTTTGGACCCCTTACTCAAACTGT
TAGGATGTGAATTAAGCAATCCAAGCTGGTTTGAAAAGGTGTATTTATCCATTTTTTTGT
ATTTATTCAGTGCTTAGTCTGTGCCAGGCTCTGCACTAAGCACTGAGGCAGATACAAGAT
AATCAGGTTGGACACAGTCCATGTCCTACGTGGGGTTTACAGTCTTAATCCCCATTTTAC
AGATGAGGTAACTGAGGCGCGGAGGAGTGATTTGACTTGCCCATGGTTCCACCGCAGACA
GGTGGCGGAACGAGAATTAGAACCCAGGTCCTTCTGACTCCCGGGTCCGGGTTCTATCCA
CTAGGCCCGTGCCACTTAGAAACCCTGACTTCAGGGCTCCTAAAGCGACCGTCACGAGGT
GAATTTGAATTTAAATCACAGATCAGAAGTCCTTGCTTGATCGCTGTTTTCTCCGATCTG
CTTTTGTCCGATGTGATCTTAATGTGTTATCCACAAGTCAGATGTGGTTCCGGTTTGGGC
CCCACCCTCCGGATGGGGTGGGTTTGAAGGAGACACGGGTGAGATGGTTGGTCAGGGAAC
TCCCCCAAGGCTCCTTGTGGCGGTGGCTGACCTTCCGTTCCCATGTAGATGTCCACCCTT
TTTCCTTGGGCGTAAGGCACAGAGCGGGGCTTCCCCGTATAGGTGAATCCCCCCGGTCAA
AACCCACCCCGGGGATGGAGTTCCTGTGTGTTGGGCTTGGGTCTGGCCCGGGGGTCCTGG
ATCCCGGCTCGGGGCTTCCCCGGTACGTCCAGTGTGGACTGGCCGCTGACGCGGCTGTGT
TTCTTGACCCCTAGGCTCACTTCTGAATCTGGCAAAACACCCAGCCTCTACCGTGCAGAT
CTTGGGAGCCGAAAAGGCCCTCTTCCGAGCCCTGAAGACCAGGCGGGACACGCCTAAATA
CGGACTGATTTATCATGCCTCTCTTGTGGGGCAGAGCACCCCCAAAAACAAAGGAAAGGT
GAGTTTCCGGGAGTAGACGTGTCCATGACCAAACGTGGGGAAGGCCCAGATTCCGTGCCC
TGGCAGAGAGTTTCCCTCCGCCCGTCCCGTAACCACCACGGCAGCGGCCTGTCGCCGCGC
CACGAGCCCCTGTCTCTCACGGACGGGTCCGTGCTTCCCGATCGGTGGTCCGCCATCCAT
TACTTACCAGCTGAACTTTGCACAAAAACCGGTGGTGGAAATGAGTTTAAGGTCACCACC
ACTTCTTATCTGCTTCCAACCATTTCTCCCTCCGGTTGTTAGCCAGCCCGCCCGGCTCCC
TGGCAGGGCGAGATGGTTTAAGGAAGGGGCAGACTGTGATACCTGAGGAAAAAGTTCTGC
TTTTGGCTGGTCCTCTCAACGATTGGGGCAGGGATTTCTAGACATATAATGTCCTCTTTT
CCCAGATTTCCCGGATGTTGGCAGCCAAAACCGTGCTGGCCATCCGGTACGATGCCCTGG
GGGAGGATTCCAGTGCTGAAATGGGAGTGGAGAACAGAGCCAAGCTAGAAGTCAGGCTCA
GGCACTTGGAAGAGAGAGGGGTAAGTAAGAGCCGTCACCTGACCTCTTTGCTGTTGGAAG
TGGGAAAGCAGTCCCCAAACCGCAGCAGCTCCAAGTGAACTTTGGACATTTTCACGTCCG
TTTTAAGCACAGATATCGATATCGTCGTCACTAGCGATTAATCAGTGATTGTCACCTGCC
TTTTCCTCAGCTGCGAAGAATAAGTGGAACCGGAAAGGCCCTAGCGAAAGCAGACAAATA
CCTGAACAGGAGGTGGGTGCCGTGTCGCTCTCTGTCTTTCATGCTCTTTGGGAGGCTGGA
GGAAGAGAGAGAGAGAGGTGCTTCGCCAGTGTCGGCCCGGGCTCTTGGCTTCCCCCTAAT
CCTCTGACGGCACCTGGGCCGTTGCCCTGCTCATTTGGACCTGGGGCCTCGGGTGACCCG
AGGGCAGTGGGAAGTTGCCATCCTGGCCGGGAATTGTGGAAGAAGTCAGCCTGACCCCGG
GGCCCTCCGGAACCCCATTCCAAGGGGAGGATGTAATCATTGTGGTATTTGTTAAAGCAC
TTACTATGTGCCAGGTACTGATCTATTCAGCCCCCTCCCAAAGCGGGTTTGGCGAGTGGG
CAGCTGGGGAAGAGGAGGACATTTTGGGCCCCTCCGAAGCATCCTGGGATGCCGGTGCCT
GACAGGTTCATTCGCGTACCCCACCAGGAGGCCCTCCCTGTGTCCCTCCCTCCCCTGCCC
CAGGTCACCCAACCTGGTCTTGTCCTGTGCCTTTAGGGCCAACTGTCATCTCAGCTCCCT
GACAGAGAGTTTCTAGCGTGTGCGGTTGAGCCGCTGCTCTTGCAAACCATTAATTTCTGA
ATCACCTGTTGGTTCCAGCGAAGTGAAGACCTACGACCCCTCTGGGGACTCCACGCTGCC
GGCCTTTCCCAAGAAACGCAAATTTGAGGAGATGAAAGAGGAGGAGGTCCCGGAGGTCAA
AATGAAAAAGCCCAAAATCACAGAGGTGCAAGGTGAGTGCGGACCTGGTCCTCTCTCGCC
GCCGGTGGGCGATTTACCGCCTTGCTGTGAGGATGCTCTGCTGTTGGGCCTCGGGAGGGG
CAAGGTCAACGGTTTGGGAATAAAGTATTCCGGTGCTGGCCTTGAGAGGATTCGGGGGGG
CTTTCCTCCGATGGGGGAGGGGGCACTTAAGGATTCGGAATCAAGAGGATGCCCAGAGGG
GTCCCGGTTCCAGCCCAAGGCAGTTGCTCCCCTGCCTATGTTTTGGCAAACGGGTTCATT
TGCCAAAGCAGCATGAGAAGCGGCGTGGCTCAATGAAAAGAGCCCGGGCTTGGGAGTCAG
AGGGCATGGATTCGAATCCAGGATCTGCCACTTGTCTGCTGTGTGACCTAGGGCAAGCCA
CTAAACTTCTCTTTACCTCAGTTACCTCATCTGTAAAATGGGGATTAAGACCGAGCCCCA
CATGGGGCCGATTACCTCCTATCTGCCCCAGCGCTTAGAACAGTGCTTGGCACATAGTAA
GCGCTTAACAAATACCATAATTATTATTCTTTCGATCATATTTATTGAGCACTTAGTGTG
CAAAGCACTGTACTAAGCGTCTGTTGGTTCCAGCTCAGCCCGGAAGCCCCTTGGAGTCAG
TGGCATAATAATAACACTAATAATGTAGTGCTTTTGGTACGTCTGATATGGACAGCCACT
GTGCCAAACACAGTGGTAGCCGCAGCCTCATGGGGTTCACGGTTTAAGGGGGCAGAGCAG
GTGAGGAAACTGAGGTACAGAGAAGCAGCTCACCTAAGATGGTAAAATCGGCCAAAGGCC
GAGCCGGGATGCGAACCCAGGTCTCCCGACTCCCAGCCCTGTGCTCCGGCGCCTACTCCT
GGGGAGTGGTCTGTGATGACTGTTACCTCTTATTGCCTGACTCCTTTCGAAAGGAAGATG
AAGGCAATGTTAGTCACTACCTCTTCTGAGACTCTCCTCAGTAGGCCTCCCGCTCGGTAT
TTTACCCCACCGAAGGGCGGGGTGGGATCCCCAGTTACCCCGTCCTCCCCGGGGGGCTGG
GCTGAAACCAGAGCGGGCCTCCCCCTCTCCTCTCTCCAAACGAGCGAGCTCCCCCCATAG
ACGGGCGGATTCTCGTTGCCTCTGCTTATTAATAATAATGAATGTGATGGCGTTTAAGCA
CTTACGGTGCCAAGCACTGGGCTGGATTTCCAACAAACAGGTCGGACACAGTCCCCACCC
CCAAGGCCGCTCCGAGCCTAAAGTTCTGCTTGTGGGCGCTTTGGTGCCGCTCCCCCACTC
ACCTGGGGCGGGTTTTCAGGTCGTCGCCGAGACCACGCCTGTGAGGCTCGAGGGTGGGGG
TGGTCGCCGAGAAGGGCAGCCCAGGGCCCGACCTCTGCGCTGTAGGAGAGCGGATTTGCG
CTCCACATCCGTTCCCTGCGCAGTCTCTTCCCCGGAGGACCTCCCCACCTCCCACCCCTC
TGAGAGGACATCGCCTGGGGAGATGCGGGAAACCTCCTGCACCACAAGCTTAGACCCTGT
GCCCGCATTCTGGCCACCTGGGCTGATGGAGCTCTTCTCTCTTTGTGCCCTTGTCCTTGA
CAGAGGAGGTAGAAGAGGATGACACCCCCAAGAAGAAGAAAAAGAAAAAGAAAGATAAAA
AGAAGGTCGAAGAAGCCGCTTCTGAGGAAGAGGCAGACACTACGGAAGTAGCTGAAGTAA
GATGCAGATTTGTCTCTGAATCCCAGTTGTAGCTGCACGGAAAACCCTAACCCCGTCCCC
GGATGGATGGGGTGACGTGTTAGCTGGTGGTGTTTATGGCCCTTGGAGGACACCGTGGGT
CAGTGGTCCTGGTCTCCGTTGGTCTCACTACCATTTACTTGCTCTGGGTCGTGATGGGCC
CAGACGCTCGCAGACCAAAGACACGGAGGCCTTTAAGGATACAAGGGGGTAACCCAGCTG
ACGCAACTTTGAGGTGTGGGCTTATCTTGCGGGTCACGGGGAAATATGATCTCTGATGCT
TTCGTAGCATAGTGTAATGTGCAAAGCCCTTGGGAGAGGACAGAGCAACAGTCGACAGAC
TCGTTGCCTGCCCACGACAAGCTCACAGAGTTGTTCCTTCTGACTCCGTCAAAATAATTC
TTTTTCAACTTTTGCAGACGCCAGAAAAAAAGAAGAAGAAAAAGAAGAAGATTAAAACAG
AGCCTGAAGACTAGTGAATAGTCCAAAGGAACAAACCTCTTAGGAGAGATGTTGCTTATT
TTCCCCTGGAGTACATTTCTGTCACACTTGCCACCAGATATGTGCTTCAGAATATTGAGG
GGGAGAGAAAAAGAGCATCAATGAGGTCATCTTTTCCCGCTCTCAGTCCGGAAAAAGACA
CTTACTTTGTTGCGTACAGAACCGTAGCGGATCTTGTGGCATCTAGCTTCGCTGATGAGG
TCATAATTCTTATTTGATAGACAAATAAAACTATTTTCTTTGTATCTTTAGTTAGTTGAA
TATTTGTTTTATCTGGGACCCTAGAAATGGATTTTAGAAATACCTTTCCTAACTAAGGCC
AGGCTGGCCAAATGCCCGACCTCCTCTCCTGTCAATCCTCTGCCTCCAGCCAGTGCCCAG
GATGGAAGCAGGACACGAGTGGAAGATTCCATTCTGAACAAGTTTAGGGCTGGGAGAGAC
CCCTGCCGTGGGGCCTTTTGTGTTCAGGGGGAGAGACGACTGTAAACAACCAAAATCCTC
AACTTGGCAGTGACATTTCTAAAGCAAATAGCCTCTGGCCTTGACCACCTGTGCTTTTAA
GTACGTTTATATGTTGGGTGGACTATGCTATTGTCCCCTCCTTAAGGGATTAGAAAGATT
TTTTTTTTTTAATCTTAACCTGAAATTTTTTTGGAATATTGGTATTCAGTAGTGTTTATT
GAGTGCTTACTATGTGCAGAGCACTGTACTAGCGCTTGGAATGTACAATTCGGCAACAGA
GACAATCCCTGCCCAATGATGGGCTCAAAGTCTAAACGGGGGAGACAGCTGAGCAAAGCA
GAACGAAACAAAAACAAGACATTATCAAGATAAATAGAATCAAGGGGATGAAGAAAATAA
GTCTTCCCCTCTCACCTCCATCCATCCCCATTCTCTAGGGAAGAATTACATGTTTCTGTT
GCAGCTAATATGACACATCTCGCATCTCTGAAGAAATTGGGTTTTTCCACCAGTGTTTTC
GCCTACAAGTGGGTCGCCAACTCTGAACAGTGGAATTTTGTAAGATTGTTCATAGGAGTT
TGGGTGGTGGTATGGTGCTTTAAAAATCAGGATTTTTTTGAGGAAGAAAACACCCAGGGC
CATTCTGCCATTCCACGTGGCCTGAGAAGCTACAGTGTCCAAAGCAAAGCAGCCCAACAC
CAAACCAAGAACCTCTATACCTTAGAGTGTTTTTAGACTCACACAAATGACCTCAACTTG
ATATGGAGATGACTCTATTGCAGGCCCAGA
  Untranslated Region
  Coding Sequence
  snoRNA
606..704, 2074..2198, 4836..4972, 6793..6857, 7956..8090, 9171..9316, 11052..11178, 12254..12417, 12845..12979, 13150..13211, 13818..13951, 15543..15655, 16097..16429
4869..4972, 6793..6857, 7956..8090, 9171..9316, 11052..11178, 12254..12417, 12845..12979, 13150..13211, 13818..13951, 15543..15655, 16097..16153
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved