Ornithorhynchus_anatinus Locus RPS12
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RPS12
Ornithorhynchus_anatinus
RPS12
Ultra520
SNORD101, SNORD100, SNORA33
4587..4658, 6904..6988, 7256..7389
8710
CATGACCCTGTATCTCCCCCAGCGCTTAGAACAGTGCTCTGCACATAGTAAGCGCTTAA
CAAATACCAACATTATTAATCCTGACCTGGCCATGTGTCAGCTGTGTGACTTTGGACAAG
TCACTTCTCGGTGCCTCAATTACCTCATCTGTAAAATGGGGATTAAGACTGGGAGCCCCA
CGCGGGACAAGGGACTGCGGCCCACCTCCATTACTTTTGTATCTACCCCAGCTTTTAGTA
GAGAAGCAGCGTGGCTCAGTGGAAAGATCACGGGCTTGGGAGTCAGAGGTCATGGGTTTG
AATGCCGGCTCTGCCACTTGTCAGCTGGGTGACTGTGGGCAAGTCACTTCACTTCTCTGT
GCCTCAGTGACCTCATCTGTAAAATGGGGATTAACTGTGAGCCTCATGTGGGACAACCTG
ATGACCCTGTATCTCCCCCAGCGCTTAGAACAGTGCTCGGCACAGAGTAAACATAGTCAT
AAACATAACAGTAGCAATAAATGCGATTGAATGAATGAATATTATGACCAATGAATTATT
ATATTATTTTATAATAAATTACATGAATATAATATGTTTATAAAACAATATATCTATTAT
GCCATTCAATTTAAATTATATAATTTATTATTATGAAAATGGGGTAAGACTGTGAGCCTC
ACCCTGTATCTCCCCTAGTGCTTAGAACAGTGCTCTGCACAGAGTAAACATAGTCATAAA
TATAATAGTAGTAATAAATGCGATGGAATGAATGAATATCAGGATGGATGGATGGATGGA
TGGATGAATGAATGGATGAATTGATGGATGGATGAATGAATGGATGGATGAATGAATGGA
TGAATGAATGAATGAATGAATGAAATGCCATCATCCCCATGTCTCTCCTCTCCCCGCCCA
ACTAAGGGCAAAGGCTTCAGTTTCCACCACCCGGAAGCAGAACTTCCCCCCTTCCCCCCC
CCCCCCCCCGGTCCCCGCCAGCAAGCACTTCCGGGGCCTTGCCCTCACCGCCTCTCGCCT
TCGCCCCTCGGAAGGACGCATGCGCGGGGGCGTCTGCGCGCGCAGCCGGGGAAACCGTTA
AAGAGGCGCGAGCGCCGCGCAGCCGCCCTCTTTCCCTGTGGCCGCCGAGCGGAGCGGGAG
GCGGAAGCTGCCCCGGGGGTGAGTGCGGGGGACCATGGCGGCCCCGGGGAGGGGGAGGGA
GGACAATCCGCCCCGCATCGGCGCCATCCCACCCCATCGGCGCTCGGGCCCGGCCCCGGA
CGGACGTCGGCCCCTAAGGGCATCTTTCTGACTCTTTATTTCAGGGATCGCACCATTCGG
CCCCGCCCCTGACCGCCGCCATGGCCGAGGAAGGGTGAGTGCCCCCCGGGGGACGGGCGC
CAGAACGAAAAGAACGATAATCGCGATGGCGTGTTAAGAGCGACGGTGATGATGCCATTT
GCTCGGCCCTTTCCGTGTGCTAAGCACTCTTCTAAGCGCTGGGGGGAGAGACGGGCTCAT
CGGGTGGGGCCCACGTGGGGCTCGCAGGCTGCAGCCCCCATCTAGGGTCCAAGCGCTTAG
GACAGTGCTCTGCACAGAGGAAGCGTTTAGGACAGTGCTCTGCACATCGGGTGGACCCCA
TCTAGGTTCTAAGCGCTTAGGACAGGGCTCTGCACAGAGGAAGCGCTTAGGGCAGGGCTC
TGCACATAGTAATAGGAAAAGTTTAGGGCAGTGCTCTGCACATAGGTGTTTAGGACAGTG
CTCTGCACATACGCATTTAGGACAGTGCTCTGCACATAAGCGTTTAGGACAGTGCTCTGC
ACATAAGCGTTTAGGACAGTGCTCTGCACATAAGCGTTTAGGACAGTGCTCTGCACATAA
GCGTTTAGGACAGTGCTCTGCACATAGGAAGCGTTTAGGACAGTGCTCTGCACATAGGAA
GCGTTTAGGACAGTGCTCTGCACATAGGAAGCGTTTAGGACAGTGCTCTGCACATAATAA
GCGTTTAGGACAGTGCTCTGTACATAGGAAGCGCCTAGCACAGTGCCCTGCACATAGGAA
GCGTTTAGGACAGTGCTCTGCATATAATAAGCGTTTAGGACAGTGCCCTGCACATAGGAA
GCGTTTAGGACAGTGCTCTGTACATCGGGTGGGCCCCCATCTAGGTTCTAAGCTCTTAGG
ACAGTGCTCTGCACAGAGGAAGCGTTTAGGGGTGTGGGCCCCATCTAGGTTCTAAGCTCT
TAGGACAGTGCTCTGCACATAATAAACGTTTAGGACAGGACTCTGCACACCATAAGCGTT
TAGGACAGGGCTCTGCACGTAGGAAGCGCTCAATAAATTCTGTCGAATGAACGGATTTTG
CAGATGAGGTCGCTGGGGCACAGAGAAGAGAAGTGACTTGCTAATAATAATAATAATGAT
GCTGTTAAGCGCATACTATGTGCCAAGCACTCTTCTAAGCACTGGGGGAGGAACAAGCTC
ATCAGGTTGTCCCCACGTTGGGGGGGGTTTCACAGTCTTCAGCCCCATTTACGATCCAAG
CGCTTAGCACAGTGCTCTGCACATAGCGCGCAAGGACAACCTGATTACCCCGTATCTCCC
CCAGCGCTTAGAACATAACGCTTAACAAATACCAATATTATTATCATTAGCTGCTGTTGA
ATGAATGGATTTCTCAGATGAGGTCCCAGGGGCACAGGGAAGTGAAGTGACTTGCTAATA
ATGGTATTTGTTAAGCGCTTGCTCTGTGCCAAGCACTCTTCTAAGCGCTGGGGCAGAGAT
GCTCATCAGGTGGTCCCCACGTGGGATTCACAGTCTTCAGCCCCATGTACATTCCAAGCG
TTTAGTACAGTGCTCTGCACATAGCGCTGAATAGATGCTGTCGAATGAATGGATTTTACC
AATGAGGTCACTGGGGCACAGAGAAGTGATTTACTGATAATAATCGTGTTTGTTAAGCTC
TTACCGTGTGCCAAGCACTCTTCTAAGCTCTGGGGGAAGAGACAAGCTCATCGGTTTGTC
CCCACGTGGGGCTCACAGTCTTCAGCCCCATTTTACAGATGGGGTCACTGAGGCACAGTG
AAGTGACCTGCCCAAAGTCACAGCTGAGCAGTGACGGAGCTGGTCTTCTTACAGCAGTGC
ATATTTGTACATATTATTGGTGACTATTTTGTTAACAATGTGTATATATCTATGATTCTA
TTTATCTTATTGATATCTATACCTGACTTCTTGTTTTGTTTGTCTGTCTCCCCCGTTTTG
ACTGTGGGAGACAATCCTTGGGCAGGGATTGTCTCTTATCTGTTGGCGAATTTACATTCC
AAGCACTCAGTACAGGGCTTTGCACATAGTAAGCTCCCAGTAAATAGGGTTGAATGAGGC
CTAGAGAAGGGAAGTGACTTGCCCAAAGTCACACAGCTGATGAGCAGGCAGAGCTGGGAT
TCGAACCCAGGACCATGATGGGGGTGTCGCCCTGGGAGGAGATCTCGCCGAGAGGTTGGA
CCCTAACGCCTGCTTACTTTGTTTTCCATGTAGCATTGCTGCTGGAGGTGTAATGGACGT
CAACACTGCGCTCCAAGAAGTGCTGAAGACCGCACTCATCCACGACGGCCTCGCCCGTGG
CATCCGCGAAGCTGCCAAAGCCCTGGACAAGTAATGACGATGACAGTAATAATCTCGGTA
CTTGCTAAGCGCTTAATGGGTGCCAGGTACTGGACTAAGCGCTGGGGTAGATGCGAGCAA
ATCAGGTTGGAACATGTCTGCTCTTTCTGTTGTATTGTAGTCTCCCAGGTGCTTAGTACA
GGGCTTTGCACATAGTAAGTGCTCAATAAATATCAGTGATTGATTGAACACTTACTGCGT
GCAGAGCAATGCATTGTTTGGGAGAGTACAATTCAAGAGAATTGGTAGACGTGTTCCCTG
CCCAGAAGAATTTGGTCTTTGGGGCCAGAGAGCAAAATTCCTGTCCCATGTGGGGCTTAT
GCTCTCAATCCCCATTTTACAGATGAGATAGCTGAGGCACAGGGAAAGTGTTTTGCCCAA
GGTCACACAGCAGACAAGTGGCAGAGCTGGGATTAGACCCCAGGCCCGTGCTCCTTTCCC
TAGCCTGTGTGGCTTCCTTCTTGTGAATTCGTGCCAAAGACCATAACGGGTTGTTAGCTC
AGAGCCTGGAAAATGGCCCGAGACAACTTCACTGTTGATGTTTCCGTGTCCACGCTTTGG
GCACGCGAATCGCCATGAACTAGCCAGGAGGCCGTCGGTTTTTGTGGGAGTTCACTTTTA
TGGCTCTCACGTCTATTTTCTCCATCACTGTCTACCACCGGATGCCACTTGCTTAAGTAG
GAACTCACAGAGGCATCTTCATTCTCAATTTATACCTAATACAAAGTGGCAGCTAATTCT
AAGGCGTGTTATTTAAAGGTGGTGGTACTTGGGCCGGTGCACTAGCTAACAGTTTGAAAA
GGTGGCCAGCGGTAGGCGGGAGGGGTGTAACAAACCTTGATGCCTTTTTGGAGGGTCTGT
GTAACTAGGTACAGTTAATGGTAAGGCAAGAAGGGAATTAGTGGAAGAATAAAGGCATCG
GATCTTAGGTGAGGCAGTCACCTACAGGACTTGAATGATGACTAGATTGTCGGATACCCC
TACACTCCAACGTATGAGTGAAAAAAAAGTCTGACAATCCTGTAGGATTATTGTGTGGCA
GGAACGTGGCGAGGGAGAAATGAAAACGTTGATCTTGGCACAAGCTGTGTTCAACAGGTT
TTTCAGATTATTGCACCTCCTTGTCGTTTTTATCCACTGACAATGGGGGCTTTTCCTTGG
AAAACTGACTACAAAGTTATGAAAAGTGTATGGAAAAATGATGAATTAGATTCAGGTGTG
AGTTATAAAGGGGACTAACTATCTTCTGGACTGGAGATGGGAGTTTATTTTCTACTTCTG
GTTTTGATTTAGCTTTTTGGAAACTGGTAATACGAATATTCACAAGCTTCACTCTAGTGA
AGCTTAAGTCTTTCGTGCTAGCTTTTATGGAAAAGTAGTAGGAAAGTCTCTAGTAATGAA
GAAAATGTTCCATTTAATGAATACTAGCATTTTGTTTATATATACTATATATCAAGCGTT
GTATTAAGGTAGATGAAAGATCAGGGGTAAGCAGATGGGGAAATAGACATGGACTTGGTC
AAGGACAAGATAGCTTCTAGATTAGGACCTGAGTCCTCTGATTTCCAGGTCCATGCTGCT
TTTCATGTGATTTACTCATCTAGCAGTTTTACATATTAGGCTAATTGAGGGAATATGAAA
AATCATTTTCCTTTTGATGAGTTACCCATAAATGTTTAAAAGTTCAAAGGATTTTTCCTG
GTCTGGTTACACTGGCAAAGTGACTGCATGTGTGATATCCCAACAGCTTTTGAAATATAT
GCTGGAAGGTTTCTCAACCTGATAATTTCAAGTCAGTTCAATTCACTTTGGTGTAGACTG
GCAGTCCAATCCACTGGAAGCTTCACTCGGCTGGCTGGATGTGCCTCAGCAGCTCCTGGC
ATGAATCCCTTACGCCATGAGGCATCGTGGCAATGCTGCACAGTTTAAAAATGGATTCTA
ATCGGCTGTCTAGCCCAGGAACAGGTAACAACCCTTCCTATATCCGGTGGCTGATTCTGT
TACCACCTGTCCTCACTAAAGGCCTAGCTTGGAAAGGCCTTACCATGAAAGCGGTCCGTG
GAGGCCACCAAGTCTCGATGCTTGCTCTTACAAAGTAGATCAAGATCCTTGTAATGTTTG
CCATTTGCAGTTCAACTGATGTAACTTCGTGAGCCTTTAATGCTGGGGAAATGTCCCAGC
TTCCATTTTGCATGTTTGCCAGTGTAGACAGCACAGAAAAATCGTTACTTTAATTTTGAT
GTAGCGTGGGTGTGAATGTTGGGCACAGGCATTCGAACAGCTGTTGGATGAAATGTCCCG
TCTCTTTCAGGCGCCAAGCCCATCTCTGTGTTCTCGCTTCCAACTGTGATGAACCAATGT
ATGTGAAGTTGGTTGAGGCCCTGTGTGCAGAGCACCAAATCAACCTGATCAAGGTGAGGA
ATGGTGTAATTTAGTTGAGCAGGTTGGTTTTAGAGTTGCAGTCAGCCTGTATTACATGCG
ACCTCCATTTCACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCACAAGACATCTGTTCCCCTCACTGA
CACATATCACCAAGGGGAGAAATCAGGATGGGACGGGTGCTCGTGGATGAGCATGAAACA
GCGAGCTCATGTGACCCGAGGCCCCTTTAATGCAGACTTCCATTTTATCCCTGTTCCGCC
ATCTCAGTTGTAACTGACCACAGACTCTAGGTTGGAAGTCAACGTCCATGTCTGGGAGCC
AGCCATCGAGTCTCCGACCCATGGGCGTCTCTCTCCCAGAGTGTTCCGCTTCCCATCTGC
AATCTGGTAGTGTGAAATTCATTCAGAACGCGGCTTCAAAGGAAAAAGGGATAGCTTAGA
TCCAGGGTGGACAAACGGGTGGTGTCAGGGGTGGGAATCCAAGATTGATTTCTCAACTGA
TAGTCCGGCAGTGGCAAGTTACGTATTCTGGCTTGGTGAAATAGCAGGTACACGGGGTTC
TGGTGCTGTACATGATGATAGCTTGGCTCCCTCTACTGAAAATGGTGAGGATAATAGCCA
TGTCACCCAATAGTATCTGAACGTACAGCCGCTTGAATCTCCCCGTCTGATAGGTTTGGA
GTTGTGCAGCATATTCATTGTAATTAATTTACACAACAGGTGGACGACAACAAGAAACTG
GGTGAATGGGTAGGCCTCTGCAAAATCGACAGAGAAGGGAAACCCAGAAAAGTTGTGGGC
TGCAGCTGTGTGGTTGTCAAGGTAAGCGCTCTAATTGTCAGTGGGATGGGGCAGAGGAAA
ACCGAGATGGCTGCAATAAATCATGGGTTCTGGTTTGCAAATTGCCAAAACCCTATAAGC
CAGTATACTTCATCTGCTTAACTGAACGTGTTTTGCAGAAGGGATGTGTGAATATGCTGG
CAATAGCATAGCCTGGGTACGAGCCTTGAAGACTCTGTAGTCATTAAGGTCCCTGAAATT
GGCAACATCTCTCTACAGCCTCCATCCGTGTTATATGCCGGGAGCCCGTTCCCTCCTTGG
CCCCGGCAAGGTAAATCGCACCTGATTATGCCTACATTTCCCCATTTGGACACATGAAAG
AAAATGCTGTCCTTCCACAGTAGAAAGTCAGTTGAGTGGGAGAAGGACAAAACAAGTGGC
CTGTGACTGAGGCCCACTGGCTGCTAAGGCATCTTTTTACAAACTGTTAGGGTCTTTTCT
CTAAAGACTTATTTTTCTTTTATTTCAGGACTATGGCAAAGAATCTCAGGCCAAAGATGT
CATCGAAGAATATTTCAAGTGCAAAAAATGAACAAATAAAAGCCTTGGCCTGATCAGCAT
TCCTTTGTTTGAAGGGATGGGTAGCAGAGTGGGAGTTGGGACACTACAATGTTCATAACT
TAGATTTTGCATGTGGCAAAACCAGGAAAGGCCTAGAGGTGTAATTTCAGAAGTAGCTTT
GAAGATGGAGAGCTGTGGTCTTGGTGCATAAGGGTGTTTCAGGAAAATGGTCAGGTGATT
GGAAGGTACAGAATGTTTTGAGTGTAGTGGGAGAAGGTGATAGTTGTCGTGGCAAGATGC
AGATCAGTGGATGATCACTGAAGGAAGCTTACATGATTTAAAATTCTATTTTCTGTATAC
CTCTTAACTGTAAGCACACTATGGTCAGGGAACATGTCTACCAACTGTACTCATGTGCCT
ACTACAGTACTCTGCTCACAGTAAGGGTGCAAATACCTTTGATAAGTGAGTAGTGATAAT
CAATACAAAAACTTGGTTGACTATGTCCAGTCAGTTAATCATTGAGTGCTTACTGTGCAG
AAGAGCCCTGTACCGAATGCTTTGGAGAGTGCAATATAATGGTAACCACATTCCCTGCCC
ATGAGTTTAGAGTGGGGGCGACAAATTGATGAAGGTATAAAATTCTAAATACGAACACAA
GTGCTGTGGGGTTGGGTCACGGAGGGAGGGGAATGAGTAAAGGAGCAGATCAGGGTGATG
CAGAGAAGAGAGGAGGCAAGGAGGGCCTAGTCAAGGAGGTTAGGGGAATGGGGTCTTACA
GCTTTTGAAGGTGGGGAGATGTGGGCAAGAAGTCATTGAGATAAAGGAGATTCAGGTAGA
TTAGTTTTTGAGGATTGAACTGTATCCATGGGCTTGGATAGCTAGGGGATAGGGTGATTG
AGTGCTCTAAGGCTGTTGGTAAGTTGCTTCAGGCTCACTAGAGCCTCTCGGCCAGCATTT
TAGAAAAGCAGCATGGTTCAATGTGGAGAGCACAGGTTTGGGAGTCAGGTCAAGGGTTTT
AATCCTAGCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1157, 1304..1353, 3513..3630, 5951..6052, 7059..7160, 7648..7710
1340..1353, 3513..3630, 5951..6052, 7059..7160, 7648..7710
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved