Ornithorhynchus_anatinus Locus NOP56
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus NOP56
Ornithorhynchus_anatinus
NOP56
Contig17567
SNORA51, SNORD56, SNORD57
5843..5975, 7529..7601, 7836..7903
10299
ATTCTCGGACTAAACCACGTGGCCGTGCTTCCCCCCCTCCCGGCCGGCAGTGGTACAGC
CCCACGTCTCCGATTGGTGGATCCGAGGGCGCGGGGCGGGGCCAGCCGAGAGGGGAATCC
GGCCGACCGCGCGCAGGCGCCGCACTGTGCCCTGGGCAGCGGAGCCGCCAGCATGGTGAG
TGGCGCGGCGCATGCGCGGGAGGCCTAGGCCCTGCAGCGGGAAGGGGAGCGGGGTGGCTT
GCGGTGACCCGGGCGCTTTCGCGCATCGTGGCAGGATAATGGGCGTCGGTGGTGGGGAAG
GGGCGAACGGGGTCGAATCTGGGTCGTTATCGAGCTCTTTCTTTGTGCATAGCACTGTCC
TAAGCGCTTGCAACCGTTCGCAGTGCACATTGCAACCGTTCCCCGCCCACAACTCGGGCT
AGTCCGTAGGCCAGCGGTATTTATTGAGCGCCGCCCTCGTGCAGACCGCTCTACTTCGGC
GCCCTGGGAAGAGGCTCATATAATGGNNNNNNNNNNCCTATTATTATTAATTGCCGTCCC
GCAAAAGGGCGGGAAAGAGGCACGCGCCGGCCCTCAACGGCCGCTCCCCCCATTCTCGGG
CTAAACCCTGGCTCCGCCCTCCCCCGCCGGCGGGCAGTGGTACAGTCCCACGTCTCCGAT
TGGTGGATTCGCGGGCGCGGGGCGGGGCCAGCCCAGAGGGGATTCTGCCTGCCGCGCGCA
GGCGCGAATTCCTAACGGTCGCCGCCCCCATTCTCGGACTAAACCACGTGGCCGTGCTTC
CCCCCCCTCCCGGCGGGCAGTGGTACAGTCCCACGTCTCCGATTGGTGGTTCCGCGGGCG
CGGGGCGGGGCTAGCCCGGAGGGGATTCTGCCTGCCGCGCGCATGCGCTAATTCCTAACG
GTCGCCGCCCCCATTCTCGGACTAAACCACGTGGCCGTGCTTCCCCCCCCTCCCGGCGGG
CAGTGGTACAGTCCCACGTCTCCGGTTGGTGGTTCCGCGGGCGCGGGGCGGGGCCGGAGG
GGATTCCGCCTGCCGTGCGCATGCGCTAATTCCTAACGGTCGCCTCTCCCATTCTCGGAC
TAAACCACGTGGCCGTGCTTCCCCCCCTCCCGGCCGGCAGTGGTACAGCCCCACGTCTCC
GATTGGTGGATCCGAGGGCGCGGGGCGGGGCCAGCCGAGAGGGGAATCCGGCCGACCGCG
CGCAGGCGCCGCACTGTGCCCTGGGCAGCGGAGCCGTCAGCATGGTGAGTGGCGTGGCGC
ATGCGCGGGAGGCCTAGGCCCTGCAGCGGGAAGGGGAGCGGGGTGGCTTGCGGTGACCCG
GGCGCTTTCGCGCATCGTGGCAGGATAATGGGCGTCGGTGGTGGGGAAGGGGCGAACGGG
GTCGAATCAGGGTCGTTATCGAGCTCTTTCTTTGTGCATAGCACTGTTCTAAGCGCTTGC
AACCGTTCGCAGTGCACATTGCAACCGTTCCCCGCCCACAACTCGGGCTAGTCCGTAGCC
AGCGGTATTTATTGAGCGCGCCCTAGGTGCAGACCGCTCTACTCGGCGCCTGGGAGAGGC
CCATATAATGGTGCATGGACAGATTCCCTGCCCACAACGACCACAGTTTCGAGCCAATCA
CTGGTGTTAATTGGAGCCCTGAGTATGTGCAGAGCACTGTGCTAGGCGCGGGGGAGAGTC
CAATCCAACAGCTCCCTGCCCACAACGACCTTTTGGGCCGGACGGGGCATCTTCTAGACG
GGTGTTTACTGACCCCTTGCTCTGTGCGGAGCACTGTACTAAGCGCAAGGGAGAGTTAAA
TGCAATAGTTCCCTGCCCACAACGACATGGGCGAGACGGAACAGGCCCTAGGCAACCAGA
GGGTGCTCACTGAGCGCTTCTAAAGTACAGAGCACTGTACTGAGCGCGCGCGCGCGCGAG
ATAAATACAATAGTGGCGCACAACGACGTGGGCCAGACGGAACAGCCCCTAGGCAACCAG
GGGGGTGCAGTGAGCCCTTGCCAGGTGCAGGGCGCAGTTGCCGAATTGACCATCCCAAGC
GCTTCGTCCAGTGCTCTGCGATAGCATCAATAAATGCTATCGGATGAATGAATCCGGGGC
GAGCGGGGGCGTCCAATACAACAGCCCCCTTGCCCCCCCCCACCCCCCCCCAACTTCTGG
CCTACATGCATGGTGGGNNNNNNNNNNCATCATTTGTAAAAGTGGGGCTTATGACCGCGT
GCCCAAAAAAAAGGGGAGGTGATTCCCGCCCTCCACACAGCGTTGAGCACAGTGCTGTGT
ACATCCCCCCCTCATGTCAGTCCGTCTGTCGGTTTTCCTCTTCCCTCCAGGTCCTGTTGC
ACCTGCTCTTCGAGCACGCGGCGGGCTACGCCCTGCTGGCCCTGAAGGAGGTGGAGGAGA
TCGGCCTGCTGCTGCCCCAGGTCGGTGTGGGCCCCCCAAGCCCATCGCGCATGCGCGCCG
GGTCCCTCGCGCATGCGCGCCGGGCCCCGCGGGCGCTTCCGAGGCCTGGCTCCTCCCACA
AGCCCGCGCGGCGGCGAGGCGGCGGCTGCGCATGCGCGGACCCCCATTCATTCATTCATT
CGTTCATTCATTCATTTATTCAGTAGTAGCTAGTAAGCGCTCAATAAATACTATCGAATG
AACAGTATTGAGCGCTTACCACATGCAGGGCACTGGACTAAGCGCTCGGAACGGACAGAT
GGGTCACAGTGAGCGCTGAAGGTATGCAGAGCACTGCCCTTAGCGCCTGCCCGTCCTCCG
CTTCCCTGGCCTCAGTTCCCTCATCTGTAAAATGGGGGGTTTAAAACGGGGAGCCTCGCG
CCGGGCGCAACCCCATCCGCTTGCGTTCGCCCCAGCGCTCAGTACGGTGCCTGCCACATA
ACGCAGAGCCACGGTAATTAACGGCAGGCGCTCCCCACTCATCCCTGCCAATACTTCACT
GTTCCTAAATCACTCCACGTCTCCTCTTCGCAGTTTCTGGATCCAAACTACGCCGGAGTT
AGGAGTGCCGGGGGAAGACGATGGTGATGGTTTAGTAATAATAATGCTGGTATTCGTTAA
GCGCTTACTATGTGCAGAGCGCTGTTCTAAGCGCTGGGGGGGATACAAGGTGATCGGGTT
GGCCCACGTGGGGCTCACGTTTAAGGCCACGGCACATAAAACAAAGTGAGGACCTGGCAG
ATTCCGATCCTGTCCTCTGATTATCTTCAATCGAAAGTATCTATTGTAGTAATAATAAGA
ATGCTGGTATTAAGCGCTTACTAGGTGCCGAGCACTGTGCTAAGCGCTGGGGGCGATACA
GAGTCATCAGATTCTCCCACGTGAGGCTCGCAGTCTTAATCCCCGTTTTACAGATGAGGT
AACTGAGGCCCAGAGAATGACTTGCCCAAATTCACACAGCTGACAGGTGGCGGGGCAGGG
ATTAGAACCCGGGACCTCCGGCTCCTAAGCCGTGGCTCAGTGGACAGCCACGCTGCCTAT
TGTATTCATTCAATAGTATTTATTGAGCGCTTACTATGTGCAGAGCACTGTACTAAGCGC
TTGGGATGAACAAGTCGGCAACAGATAGAGACAGTCCCTGCCGTTTGACGGGCTTACGGT
CTAATCGGGGGAGGCGGACAGACGAGAACAATGGCGATAAATAGAGTCGAGGGGGAGAAC
ATCTCGTAAAAACAATGGCAACTAAATAGAATCGAGGCGATGTACAATTCATTAACAAAA
TAAATAGGGTAATGGAAATATATACAGTTGAGCGGACGAGTACAGTGCTGAGGGGATGGG
AAGGGAGAGGGGGAGGAGCAGAGGGAAATGGGGGGAAAAGAGGGTTTAGCTGCGGAGAGG
TAAAGGGGGGATGGCAGAGGGAGTAGAGGGAGAAGAGGAGCTCAGTCTGGGAACGCCTCT
TGGAGGAGGTGAGTTTTAAGTAGGGTTTTGAAGAGGGAAAGAGAATCAGTTGTAGGCAGG
GAATGTGTGTTAACTGTTGTATTTTACTTTCTCGAGCGCTTAATACAGTGCTCCGCACAC
AGTCAGTGCTCAGTAAATAAAATTCACTGATTGGAGGGAGAAACACATGAATGCAACTCA
GTTACTGATGACAGATCCGGATGTGAGTGCCGTGGCACTGGGAGGGGGGGATGAATAAAG
GGAGCAGGGTCAGGGCGACACAGATGGAGTGGGAGAGGAGACAGGGAAGGCCTCCTGGAG
GAAGTGGCCCTTCACGAAGGCGGCGGGGAGAGTCATCCTCTGTCCAGTCATCGAGGCTCA
TTCCTTCGGCTCGCAGGTCGAGGAGTCCGTGCTGAACCTGGTCAAGTTCCTCAACCTGGT
CCGCCTCGTAGCCTTTTCGCCATTCACGTCGGCCCAGAGCGCGCTGGACAACGCCAATGC
CGTCTCCGAGGGTGAGCCTGGACCCGTTTCTGCCCTGACTCCTTGGCAGTGATGTGGTAA
CCGTCTGCCTACCCACCCCCCAGCACTTGCGTACATATCTTGTAACTCTGCTGGTTCCCT
CTAATTTATTTTCACTTGTGTTTTTCCTGCGAGATGAAACTCCCAAGGGCAGGGATTGTA
TCTGTTAAATCTAGTGAATGCTCCCGAGCACTTAGGAAAGTACTTGGCGTCATAAATACC
ATTGATTGATGGCTAAGGGAAGAGAGGTGAAGCTCCAGTCTCACCCTAAAGGACACCAAT
CATCTGTGACCCTGTTTTTTACACGCTCCCGAGGGCGAGGATCGTTTCTTTCCTAGTCAG
TAATCCCGTGTACTTGGGAAAGTGCTTTGCAGAGAGTAAACCCTCCAATGCCACTGATTG
GTGGTTCCAGTCTCGACCCAAAGGACCCCAAGAGAAGCAGCGTGGCCTAGTACACGACGC
AGGGCCTGGGTTCTCGTAGTAGCTGCCACTTATTTGCTATGTGACCTTGGTCAAGCTGCT
TAACTTGGGTGCCTCTGTGTCTTTTTTTTTTTTTTTTAATGCTCAAATGCCATACGTCAG
GCACTGGACCACACTAATCCCCGGACTAGATAGACGACGGGTTTGGACACGGTCCCCGTT
GCGTGTGGGGCTCACGCTCTTAATCCCCATTTTACCGATAAAGTAACCGAGGCCCGGAGA
AGTTAAGTGACTTGCTCAAGGTCACACAAGGTCATCGACCGCAAACTGGCGATGCGATCC
CCGCTCTTCCGCCGATCGCGATTGGGAGCCCCATGTGGGAGGGACTGTGTCGGGCTTGAT
TATCTCGTATCCATCCCCTCAAAGCGTTCGACACCTAGCGAGCGCTTACGGCCGACCCCG
AAAGGAAAGTATCCCCTGGCCAGATCCGAGGCTCCCGGCCTCCGCCCTGATCGGTGTCTG
TGGTTTCCCGCGACCTCCCAGGTGTGGTGCACGAAGACTTACGTCTGCTGCTGGAAACCA
ACCTCCCAGCCAAGAAGAAGAAGGTGGTGCTGGGGGTCGGGGACCCCAAGATCGGAGCCG
CGATCCAGGAGGAGCTGGGTTATCAGTGCCAGACGGGGGGCGTGGTGGCCGAAATCCTCA
GAGGTGAGGGGTGAGCTTGGGGGTGCCCCGAGAGAAGATGCCGGACGTTGGGCGGCGCTG
ACCAGCCGCCGCCGCGCCGCCCGTCTCCCCCCAGGTATCCGGCTGCATTTCCCGTCCCTG
GTGAAGGGTCTGACGGCCGCCTCGGCCTCCAAGGCCCAGCTGGGCCTCGGCCACAGCTAC
TCCCGCTCCAAGGTCAAGTTCAACGTCAACCGGGTGGACAACATGATCATCCAGGCCATC
AGCCTGCTGGACCAGCTGGAAAAGGACATCAACACCTTCTCCATGCGCGTCCGGTACGGG
GTCGGTCCCCCGCGCTCCCCCCGCCCCTCCTCTCGCTTACCGCAGGCAGCAGCGGCCGTG
CTGACTGTACAGAAAGAGGAGGGAGAGCAGGCGCCCCTGAATACACCCCAGTGGTGGAGT
CTGTGCCCCGACTGGACTGTGATCAGGGGGACAAGTCCGTACCCGTTTCCGCCCCCTTGG
GCGCACGGTGTGGGGTGGGCAGGGAGGACGGGAGCCGGTGGACCTCCCCCGCCGCCCCGC
CTCGCCCAGGGCTCGGCCCGGCCCTGAGGGCGTCCCCTCGGTGTCCCCCGCAGGGAGTGG
TACGGCTATCACTTCCCCGAGCTGGTGCGCATCGTCAGCGACAGCGCTTCCTACTGCCGC
CTGGCCCAGCTCATCGGCTGCCGGCGGGAACTCAGCGAGGAGAAGCTGGAGGCGCTGGAG
GAGGTGACGATGGACAGCGCCAAGGCCCAGGCCATCCTGGACGCCTCCCGTTCTTCCATG
GGTCCGTCCCGGGGGCTGGGGGACCGGTATGTTTCACGAGATGCGGCCCGGGGGGGCCGG
GGTCATCCGCGCTGACCCGGGCTGAATCCACCACANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTATTCCCTCCTCCCCAAAAATCTGCGGGCCCCGGGTGGGGGTGAGAGAGAACC
GGGGGTCCCGCCGGGCGGGCGTCGGGTGGGTGACGCGGCGTATCCCCCGTAGGTGGGCGC
CCGCCTGATCTCCCACGCCGGCAGCCTGACCAGCCTGGCCAAGTATCCCGCGTCCACGGT
GCAGATCCTGGGGGCCGAGAAGGCCTTGTTCAGGTACGGCTGCCGCGTGGTCTCGGTGAT
GGCGGCCGCCGGGCCCCCTGACCCCCGGCCTCGGGCCGCGGGCGTGACGGGCCGGCCCGG
CCACTGAGCGACCACCCAGCCCCGGGGGCCGGGCTTCCCGAGCTGACGCCCGGCAGGTCA
GCGGGCCGGGGAGGGGCGGGGTGGAAAAGAGGGCGTGGGGTGGGTCCTTGGAAACGCGCG
GCGGATGCTCCGTCCCGCCCGCCCCCGATGTCCGCTCCGGACGGAGCCGCTGACCCCCGC
CTCCCTCGCAGGGCCCTGAAGACGCGGGGGAACACCCCCAAGTACGGGCTCATCTTCCAC
TCGACCTTCATCGGCCGGGCGGCCGCCAAGAACAAGGGCCGCATCTCCCGCTACCTGGCC
AACAAGTGCAGCATCGCCGCCCGCATCGACTGCTTCTCGGGTGCGCGGCCGGCGCGGGCG
GAGAGGGGAGTGGGCGGGGACGGGGGCTTCCGCCGTGATGGAACGATTTTTCGTCAACAG
CAGTTCACCCCCGTGAGTGTTGATAAGCCTGTGTCTGAGCGAAGCCAGAGGCGGGGACGG
GGCGCGGCCGGGGGGCCGGGAGGACGGGGAGCTTACCCCACCCCCTGTGCCCCCGGCAGA
GGTGCCCACCAGCGTGTTCGGGGAGAAGCTGCGTGAGCAGGTGGAGGAGCGGCTGTCCTT
CTACGAGACCGGAGAGCCGCCCCGCAAGAACCTGGACGTGATGAAGGAGGCCGTGTTGCA
GGTCAGAGGGCGGGGGGCTGAGGGGCGAGGGCAGGGTGGAGATGATGAGCCACTTGGTCC
TGAACCTAGCGTGAGGGCAAAAGCTGATTTAATGAGCCTGATCCACCCGGGGGGAGGAGC
GAGGGGGTGGCGCGGGCAGGGGGGCTCAGCCGTCCTCCCGCTCGCCCCGCTCAGGCCGGG
GAGGTGGTGGCCGAGGTGCGCAGGAAGCTGGCCAAGAAAGAGAAGAAGCGGTTGAAGAAG
CAGCGGCGACTCCAGGCCGCGGCGGCCGAAGACGGCGGGGACGTCCCCGAGGCCAACGGC
GAGGTGAGGGGCCCCTCGCCTAACGGGGGCGGGGGGCGGGGAGCGCACCCCACCCAACGC
GCCTCCCCAACCGCTTTTCTGATGGTCCGGCCCCAGGAGACGGGACAGAAACGCAAGAAG
AAAAAGAAGCGGGGCTCGGAGCCCGAGGAGAACGGAGTGGAGGAGGAGGAGGAACTGGAG
ACCCCCAAACCCAAGAAGAGGAGGAAGTCGGAACCCCCCACAGAAGACCCGGAGCCGCCC
CCTCCTAAGAAAAGCAAAAAGAAAAAGGCCCGGGCCCAGTCCGAAGAGGACTGACCCGGC
CGGCCTCCCGCTCTCCCTTTACGGACTTTGTTTTCCCCCCCGCCCCGCTGTGACCCTCCG
CCAATAAACGACGTTTGAGTCTGTATGCCGTCGGGGCTCGGGCCCCCTTTATTGAAACCG
TGCCGCCGGCACCCACCGCCGCCGGGTCCGGCTCAAGATGGGCGGGGAGGCTGGGCCAGG
CTGGCGATGACGGCCCGGGTGAAGTCCTGGGCTGTGGCATAGCCGCCCATGTCTGCGGTG
CGGACCTGTGGGGGGGGAAGGACGGGGGCGTTCAGGGGGCTGCTGGTCACCCCTCCCTCC
GCCCACCCAGCCCTCCCGTTAGCTGATGGTATTGACGGTATTGACGCAGAGCACTGTTCT
AAGCGCTTGGAAAGCGCCAATTGGCAGTGAAAGAGTCTATGCAGAGGGGCGGCGGGGCTT
AGTTTGGGAAGGCCTCCTCCAGAAGGTGGACTTTGAGCGGCGCCCTCAAGTAATCCACCT
TCCCCATTAGAGAATGGGGTCTGAGCAGAGCACTGGGGCACACTGCCTTTTATGTCAGAC
AAGGACGGTGGCCAAGGCGGAGCCCCGGACCTCCTGGTCTGGGCTCCAGCCACTCCACCA
CGCTTCTTTCTCCTTGTGCCAAGTGTGATGTGCAAAAAAGACACAGCAATCCTCCTCCAA
ATAAGTTTATTTAGCGACTGAGCAGACACTGGCCGTCCGGCTGGGGAATGTCGTAGGTGG
AGGGAGGGGGTGGTGCTGGGGGGGAATGTGTTGCTTTCCAAGCGGGTGGGGGGTGGGGGG
GCCACCAGGGGTGCCCCAGTTAGACCCCAAACTGGGGGTGCAGGTGGTCGATGACAGACT
TGATGAAGTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1243, 2330..2423, 4280..4390, 5361..5520, 5612..5812, 6113..6390, 6849..6924, 6952..7052, 7331..7479, 7679..7800, 7974..8102, 8196..9251
1241..1243, 2330..2419, 4276..4390, 5361..5520, 5612..5812, 6113..6390, 6849..6928, 6956..7052, 7331..7479, 7679..7800, 7974..8102, 8196..8393
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved