Ornithorhynchus_anatinus Locus RPL23
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RPL23
Ornithorhynchus_anatinus
RPL23
Contig5953
SNORA21, SNORA21
3021..3157, 4269..4407
8144
ATGTCTGTGTCCTCCCCTTCTAGACTGTGAGCCCGTTGTGGGCAGGGACTGTCTCTCTT
TCTTGCTGCATTGTACTTTCCAAGCGCTTGGTACAGTGCTCTGCACACAGCAAGTGCACA
ATAAATACAACTGAATAAATGAATGGTCCCCACCTTGCTCCAGTTCATTTAGATTTTAGT
GCCTCAGCACGATTCTGAGTGAAGCTGTGGGGAGGAGATGGGGTTAAAGGGAGCCTCTGC
TGTGAAGCTGCAGAGAAGGTTGCTCCTCCAGCCCCTTTTTGTGTGGCTTAGTGGCAGGAG
CCCGGGCTTGGGAGTCAGAGGCTGTGGGTTCTAATCCTGAGTCCGCCACTTATGAGCTGT
GTGATTTGGGCAAGTCACGTCACTGCTCTGTGCCTCAGTGACCTCATCTGTGAAATGGGG
ATAAAAACTGTGAGCCCCACGTGGGACAACCTGATTACCTTATATCTACCCCAGGGCTTA
GATCATAATAATACTATGAATGAATGAACAGTGCTGGGCACATAATAAGCGCTTAACAAA
TACCATTATTATTACCCCAGGGATTGGAACAGTGCTTGGCACATAGTAAGCGCATAACAA
ATACTATCATTGTTATTATTACATCTACCCCGGAGCTTAGATCAGTGCTTGGCACGTAGT
AAGCGCTTAAGAAATACCATTGTTGTTATTATTCTATCTACCCCAGCGCTTAGAACAGTG
CTTGGCACCTAGTAGGCGCTTAACAAATACCATCATTATTATTATTATTACCCCAAGGAT
TGGAACAGTGCTTGGCACCTAGTAAGCGCTTAACAAATACCATCATTGTTATTATTCTAT
CCACCCCGGAGCTTAGAACAGTGCTTGGCACGTAGTAAGCGCTTAAGAAATACCATTGTT
GTTATTATTCCATCTACCCCAGCGCTTAGAACAGTGCTTGGCACCTAGTAAGCGTTTAAC
AAATCCCAACATTATTATTAACTGAATTGAGGAGGGTGAGGGTTTAGGCCTTCCTTTCAT
TGCAGGTTTGTCGAACAACCTGCAATACACTCATTCATTCAATCGTCTTTATGGAGCGCC
CACGATGTGCAGAGCACTGCGCTAAGCGCTTGGAATGGACGATGGGGCAACAGACAGAGA
TTCGCAACTTCAGGCTTGACGCTCCACGGCCTTGGCTTCCCCGCGTCGCCTGTAGGGGGC
GCTGCCGCCCGCCCGCCCGCCCGACCCCCGTCACGTGACAGGGGCCGGCCCGTCCTTCCG
GTGGGCGGTGCGTCACGTGGAGAGTGAGCGGGTGGAGGCCATATCCCGGCAGCCTTTGCG
GCCCCCCCCTCCTTCTCTCTTTGGCGCTGCCAAGATGTCGAAGCGAGGTGAGGCTGTGGT
GGGAAGGGCGGGCGGGAGAATCCGCTGCCATCCGGCGCGCTGGGGGTCGGGGCGGCCCCC
GGGGGAAGGTGGAATGGCGCTGCCGCTAATCTCCCGGGAGAAATGGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTAATAATAATGTTGGTATTTGTTAAGCGCTTACTATGTGCAGAGCACTGTCCTAAG
CGCTGGGGGAGATACAGGATCATCAGGTTGTCCCCCGTGGGCTCCCAATCTTCACCCCCA
TTTTACAGGTGAGGGGACTGAGGCCCAGTGAAGTGACTTGCCCAAAGGCACCCAGACAGA
CAGGTGGTGGAGGCGGGATTAGAACCCACGACCTCTGACTCCCAACCCTGACCTCTTGGC
ATTGGGCCATGCTGTTTTGTGGGCAGGAGTATGGCAGTTTGTTGTACTGGGCCCTCCCAA
GCGCTTAATACAGTGCTTTGCACACAGTAAGCGCTCAATAGATGCGATTGGGTGGCAGTT
GTCCTACTTTACTTTCCCAAGCGCTTAATACAGCGCTTTGCATGCAGTAAGCGCTCAGTA
GATGCGATTGAGTGAATGGAGGCAGTTTGCTGTCATACTGTACTCTTCCAGGCGCCTAAT
ACAGTGCTTTGCACGCAGTAAGCGCTCAATAGATGCGATTGGCTGGCAGTTTGTTGTCCT
ACTTTACCTTCCCAAGCGCTTAATACAGCGCTTTGCACGCAGTAGGCGCTCAGTAGTTGC
GATTGAGTGAATGGAGGCAGTTTGCTGTCATACTGTACTCTTCCAGGCGCTTAATACAGT
GCTTTGCACACAGTAAGCCCTCAATAGATGCGATTGAGTGAATGGGGGCAGTTTGCTGTC
ATATTCTCCCCTCCCAAGTGCGTAATATGGCGGTTTGCATGCAGTATGTGCTCAGTAGAT
GCGATTGAGTGAAAGGTGTTGGAGGAAGGGAGCCCTCCTTGATGGGACGGAGGAGCGAGA
CTCTGAGCTCGTTGTGGGCAGGAACGTGTCTGTTATAGTGTCCTCTCCCAAGTGCGTAGT
ACAGTGCTTTGCACACTGCAAGCGCTCAATAAGTACGACCGAATGAATGAAGGAGCCAGC
GAGGTTGTTGGGAGGGAACGGCCCCCGGGTTTAGGCAAGCAGTGCTTAGCAGCGGAGGGT
TTCCCGAATTAGTGGCCTGCAGGACGAGGCGGCCTGTTCGTTCAATAGTATTTCATTCAG
TAGTATTTATTGAGCGCGTATTATGTGCAGAGCACTGTACTAAGCGCTTGAAATGTACAA
ATCGGCAACAGATTTGTGACTCCTTGAGGTCTCTTTTGCACCCCCTAGGACGTGGAGGGT
CGTCCGGAGCCAAATTTCGCATCTCCCTGGGTCTCCCGGTTGGGGCCGTGATCAACTGTG
CAGATAATACAGGTGAGTCTGGGCCGAAGAGGGGTGGGAGCGGTGCTCTGTCGGGTGCAG
GGGGACTCTTGGGGTCTCTAAACCCTTCCAAAAGCACTCATCTGGCCTCAACCCCGTGAC
CCGATGAGCCGTCGTGAAAGGGCAGAGCAAGAAACATCGCTTTTGGGTGAAGGAGCAGCA
ACTTGTGCTGCTTTACTTCAATCGGCGATGAGACAGGCTAGTGGTGGCCCCGGGCCTAAT
GGCCCAGTGGAAACTGGCGGAGTGGGGAAATGACAACAACTCTGGGGTCCTCTTTTACAG
GCGCCAAGAACCTGTACATCATCTCTGTGAAAGGGATCAAGGGGCGACTGAACAGGCTTC
CTGCAGCCGGTGTGGGTGACATGGTGATGGCCACCGTCAAGAAAGGAAAACCAGAGCTCC
GGAAAAAGGGTGAGGATGGGGGTTCGGCCGGGGCCCCCCAAAGACTGAGCTAGGTGGCTC
TCGGATGTGTGCCGAGGGGAGTCAGGCTTGCTGGATGACAGCCTTGGGCCGGAATAGATT
GTATAAGCAGTTTGGACACACTTCTTGCCCCACTTGGGCCTTGTTGTCTAAGCATGGGGG
TGGGGAGGGGAGAACAAGCATCTTAACTCCATTTTTGCAGTCAACTGAGAGACAAACTAA
GTGACTTGCCCATGGAAGTCCAACTGAGACTAGAATCGAGGTCTCCTCACTCCAGTACCT
GTGCTCTTTTTATGGTATTTGTCATGCACTGTACTAAACGATGGGGTAGATACAAGATGA
TCTGGTTGGATAGAGTCCCCCACCCCGCTCTGTGCTCACAGTCTTACTCCCCATTTTACA
GATATGGTCACTGAGGTACAGAGAAGTGACTGGCCCAAAGTCACATGCAGACAAGCGGCA
GCGCGGGAATTAGAACCCAGAGCTTTCTGATTTCTAGACCCAGGCTCTATCCACTAGGCC
TCACCGCTTTCCACTGGATTTATGCCGCCTCCCTGCTTCAGACCGGAGGGTTGCCAGTCT
GAGTTCAGGGTTGGCCTGTAGCCTAGAGGGAAGGATCAAAGGGGGTCTGAGAAATGTCCA
CTTAAATTAGCTTTGCCCTTGATGCAAAAAGCAAGATTCTCCTGAGTTAGTGATATGAGG
GCCGGGAGGTTATAGGTTTGCTTGGTATCAGAATTGCCTCCTGTAGTTGATTCTTGACTT
TGGGGGGTGGCTAGAGAGATCTTGATTTAGAGTTGCCCGTCGGTTGGGGTTCTGGAGTTG
ATTTTTCCCTTGGGGCCTGGATCCCCAAATACATTAATGGGGTTGGGTTGGGGCTTCCAG
GGCAGGTTGGCCCTTTGCAAAGCACTTGCCTGGCCTTATCTGTGGCTTGGGGAGCTGTCG
TGGAAGGGCAGAGCAGAAGCAGATCCATCGCTAGTGGGTGAGGTGGCAGCAGGCTGTGCT
GCTGGCCTCAGTCAGTGGTGTGACATGGGGCCTTTAATTTGGTGGCCCTCTCCAGGGCTG
TAGCAGTAAGGAGGGCAAATTCTAAGTCTTGGGCACCCCGCCTTCCCCAGGGTGGCCTTC
TGGTAATAGTCGTAGTGTTTATTATATGCCAGGCACCTCACTAAACGTGGGGGTGGGATA
ACAGGCAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGCTCTAACCAGTAGGCCACGCTGCCTCTTCTGTGTTTGGA
GTGGGTTTGCCAGGGGCCGATTCTTGCTGACTGACTTGACTCTGCCCCTCTGCAGTGCAC
CCGGCAGTGGTGATACGGCAGCGGAAGTCATACCGGAGAAAAGACGGGGTGTTCCTCTAT
TTCGAAGACAACGCGGGAGTTATAGTGAACAACAAAGGCGAGATGAAAGGTGAGGGGCTG
GGACAGGAGGGGAGGAGAGGGGCTGTCGCGGGGGACGGGACCTTCAAAGCTGAACCCTCT
CCCCAATCTCTCCTGCCAGGTTCTGCCATCACAGGCCCCGTGGCGAAGGAATGTGCCGAC
CTGTGGCCCAGGATCGCCTCTAATGCTGGCAGCATCGCCTAACCCTCCATCCCTGTTTAT
AAAGGAGTCAACTATTAAAATGTCCGTCTGCCCCACTTCCTTCTCCTTGGCCACCCATCT
TGGCTCTCTAGCACCAATCCGGCCTGGAGCTCACAGAAGCAAGCTGTTTTATCCCCACCG
AAGCAGCTGTTCAGGGTGTCCGGAAAGAAAGTTACCCCAGGCAACTGCAGTCTTGCACAG
GATGGCGGGGATTGTGGGGAAATAAGGAGTTTGATGAAAGCAAATTGCAGTTTTTGCCAC
CTCCCATTCCTCTGAGGGAATTATTATTACTACCAGAAAGCCACCACAAGCAGCCCCAAA
CCCAGCCCTGTTTTCTGCCTCTGCACCATCTTCGGGCATCGTACATTCATACATTCAGTG
GTATTTATTGAGCGCTTACTGTGTGCAGAGCACTGCACTAAGCTTTTGGAAAGTACAGTT
CAGGAATAAACGTGGGGGGGTCAACTAAGTGCTGGGGCCTTGATCAGCACTATCAATTTA
TGGAGCACTAGTGGGGAGTGGGAAGGACCTGGGTTCTAATGCTGGCTCAGCTACTTGTTT
GCTGTGACCTTGGGCAAGTCACTTCACTTCTCTGGACCTGTTACCTCATCTGTACCATAG
CGATTGAGACCCATGTGAGACAGATCGTCAAAGTGGATGCATGGGGCTCACAGAACCCCA
AGTAGGAGGGGAAAAACAGGTATCAAATCTGCACTTTACATATGTGGAAAGTGAGGACCA
GGGAAGTTAAGTGACTTGCCTATGGTCACAGAGGTCACAAATGGCAAAGCCAGGATAAGA
ACCCAATTCCACTGGCTTCTAGGCCTGTACTCTTTGTTAGGCCGCCATGCTGCTTCTGCC
TTCACGGTTGCCCCAGTCCCTGTCCAATATAGCCCAGCCTTACGATATCCCTTCCCTACC
ACCCCTGATCAGGGCTGGAGGTTGTAGACCGGTTTCATGCTCTAGAAACCAAACTTTGGT
TTAATAGTGGGGGGAGTGTAGTTCTCAGGTGGGCTGTGAGAGGAAAGGTAAGTGAGAAAC
TTTTGGTTTCCCTTACGTGACTTGTCTCTACAGAGCCACAGCCTTTCCTCTTCCTCGCCC
CCTCAAACCCCACAAAAACCCAAACAACCAACAAACATCTGGCTGTGAGCTATTTTACAA
AGAGGTCTGACTTCACACAGTGTTGGTGGGGGGCAGCTGCACCCCTGGGCTACAAGATTT
GGTTCAAATGCTTGGACCAGTGAGGTTTGTAGAAATCTGAACAATGGTGTTGGGCACTTA
AAGGTGACTGTACTGAGCACTTGGGAGAGTACAGCATTGGTAGGCAGCCCTGCTGATAAG
GAGCCTACAGGGCCCCAAAGACGTGGAGTGAATATCAAAGGGTTTAGTCTAGTGCGTATT
CTATGCAAACTGCTGGTTTCTGGGTCGCTGAGCCTTCAGTTGTTAACTTGGCGGGCGGGG
TGGGTTTGAATGACTTCCCAGCAGGAGGCATTGGCAGGTAGGATTAGGGCAAAATTTAGG
AGTCGATATCAATTAGATCATAAACTGGTATTTATCATTGGATTTAAGTACCTTTATTGC
ACTTCTCGGGAAAGATGCATCCAGCTGGAGTCGAGTAGGATATTTTTGATGGGGTAGGCA
ATTGCATTTATTGAGTAGTTAGTATTCATTCAGTCGTATTCATTGAGCATTTAATGTGTG
CAGAGCACTGTCCTAAACCCTTGGAAAGTACAATACAGCAATAAAGAGGCGCTCCCTGAC
CACAGGGGGGGGGGGGGGGGCAGACATCAAAGCGAGTAAACGGGCAATCAATATAAATGG
AATTCTAGCTAAGTGCTGGGGTCAGGGGGCTCAGTTTGGGTGCGAAGCACTTAAAGTGGT
AGGGAGGGATTAATGCAGGAGAAAAGGTGGTGAAAANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGTTCTCGTCCGGGGGTAAGCGATTTAGACTGGAGTGA
GTCCAGGGCCCAAAAGGATTAAGAAGCGCTCAGTACACATCTCTGCTGTATGACCTTGGA
TAAGTTACTTGACTTCCCTGGCCTCAGTTATCTCATCTGTAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1366, 2868..2951, 3240..3368, 4975..5088, 5179..7144
1354..1366, 2868..2951, 3240..3368, 4975..5088, 5179..5261
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved