Ornithorhynchus_anatinus Locus ENSOANG00000001161
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000001161
Ornithorhynchus_anatinus
ENSOANG00000001161
Ultra55
SNORD111, SNORD111, SNORD111, SNORD111
10657..10739, 11633..11714, 13909..13994, 19508..19592
41036
GATTGTGAGCCCCTTATGGGACAATCTGATGACCCTGTATCTCCCCCAGCACTTAGAAC
AGTGCTCTGCACAGATTAGGCGCTTAACAAATACCAACATTATTATTAGTTTACTTCTTG
GTGCCTCAGTTCCCTCATCTGTCAAATGGGGATGAAGCCTGGGAGCCCCACGTGGGACCA
CCTGACGACCCTGGATCTCCCCCAGCGCTTAGAACAGTGCTCTGCACATAATAAGCGCTT
CACAAATACCAACATCATTATAATTACTTTACTTCTTGATGCCTCAGTTCCCTCATCTGT
CAAATGGGGATGAAGCCTGGGAGCCCCACGTGGGACCACCTGATGATCATGTATCTCCCC
CAGCGCTTAGAACAGCGCTCTGCACATGGTAAGCACTTAACAAATACCAACATTATTATT
ATTACTTTACTTCTTGGTGCCTCAGTTCCCTCATCTGTCAAATGGGGATGAAGCCTGGGA
GCCCCACGGGGGACCACCTGATGACCCTGGATCTCCCCCAGCGCTTAGAACAGTGCTCTG
CACATAATAAGCGCTTCACAAATACCATCATCATTATAATTACTTTACTTCTTGATGCCT
CAGTTCCCTCATCTGTCAAATGGGGATGAAGCCTGGGAGCCCCACGGGGGACCACCTGAC
GACCCTGGATCTCCCCCAGCGCTTAGAAGAGCGCTCTGCACATGGTAAACGCTTAACAAA
TACCAACATTATTATTAGTTTACTTCTTGGTGCCTCAGTTCCCTCATCTGTTAAATGGGG
ATGAAGCCTCGGAGCCCCACATGGGACCACCTGATGATCCTGTATCTCCCCCAGCGCTTA
GAACAGTGCTCTGCACATAGTAAGCCCTTCCCAAATACCAACCTCATCATCATCATCCCC
ATTTGACAGATGAGGGAACTGAGGCATCAAGAAGTAAACTAATAATAATGTTGGTATTTG
TTAAGCGTTTACCATGTGCAGAGCGCTCTTCTAAGCGCTGGGGGAGATCCAGGGNNNNNN
NNNNCCCTCTCAGGGCGCCGCACCTCCTCGTCACACAGCCGCTCGTACACCGCCTCCAGG
TCCTGCAGCTCGGTGAGGGAGCGGATGAGGTCGAGGGAGAGGTCGGAGCGGCCGCCGACG
AGCCTCCTTCCCGCCTTCAGGGGTGAGCAAGACTCCGCCATCTTGGCTCCACCATGGCAC
TTCCGGTGAGGTGAAGGCTCCGCCTCAAGACGAGGGCCTAAGCCGGAGGAACGGACCGGC
TGCCATCCCACATCCCTCAGCCGTTTAACCACTCCCCTCTCCTTTCTCCCCAGGCCCTCC
TGGAGCAGTTAAAGGGCTTCGTGTGGTCTCGAGGAGGGGGGATTGTGGACGCCATTTTTC
AGGCACTGCTGAGGGCGCCTTTCCTCCTCCCGCCCCACTGGAAGGACCCCGGGTGGGAGG
GCTAATGGCGGCAGCCCGCGGGACGGCGGCCTAGACCGCGGCCGACGGCATCCACCCGAC
ATCGGCGCCATCGCAGCCGCTCCCGGGGTGAGAGGCGTCCCCATCTCTTCTCCGAGGCCC
GGGCCGTGAGGACAGGTCGATATGGCGGCGGCGGGGAGGCGGCGGGGAGGGCGGGAGACG
GGGGCGGCGCGGCCATGGCGGCCCAGGCCCCAGCGCTGATTTTGGAGGGACGGAGGGGAC
ACACACACTCCTACACACGTGCGGGCGGGAAATTCATTCGTTTAGTGAGCGCTTACTGTG
TGCACAGCATCCATTCATTCAGTAGTATTTATTGAGCGCTTACTATGTGCAGAGCACTGC
GCTAAGCGCGTGGAGTGCACAATTCGGCAACAGAGACCATCCTAATATCCTCATCATCCC
AGGGTAGGGAGCACTAGGCTCTCCCCCCCCAAACCCTCCTTAAATTCATGCAATCCGATT
TTTTGAGCTCTCGCTCTGTGCACAGCACTGCGCTAAGCGCGTGGAGTGCACAATTCGGCA
ACAGAGACCATCCTAATATCCTCATCCCCGAGTGGGGAGCACTGGGCTCCCCCCCCCCAA
CCCTCCTTAAATTCATGCAGGGCCTCTTTATTGAGCTCGCTCTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCTGGGCCCCACTAGAGGGCGCCATTCCAGAGGGATGGGATA
TTTGCTCTATAGGGCAGCCTTATAAGGCGCCAGATCCACTCCCGACGGCGGAAGTGTCGG
GGTAATGATGCATTGTACTGGGAGAAGAAGTTCACTCCCATGGGCAGACATATGCGTTTA
TCTTCCCCCAAAGTTTTCTAACAGAGTTTTATGAGTTGTCATACATGGCAGAGGATTCAT
ATCACACTTCGCTCCCTGTCACGATAGCTGGGTCACAATTGATAAAGCTGTGGGTACATG
TATGTATTGCCCATTTTGTAGTCGAATGTCTAGAAAATCCTGAAAGCTTCTTGTTCGAAT
CAGTGAGGCAAAAACAGGGGAGAACTGAAAATGAACTCCAGCTTCGGCATGAGGAGGGCC
TTGTCCTATAATTTTCTTGTTACGGTACAGGGTTCTTGGTTCTCCCCCCCACCCCAAATC
CTCCTTAAATTTATTCAATCCTATTTATTGAGCTCTCGTTCTGTCTTGAACACTGCACTA
AGCGCTTAGAGTGCACAATTCGGCAACAATCCTTGCCCAACAGTGAGCTCCCAGTCTAAT
CGAAAAAGCTTGGGGTCCTTTGAAGTGGCAGGAGGGCGACGAGGGACAAAGGGAAAGAGC
AATGGAGAATAATAATAATTTTGGTACTTGTGAAGCGCTTACTATGCGCTGAGCACTGTT
GCAAGCTCTGGAGTAGATACAGGGTCATCAGGTTGGCCCGCGTGTGGCTCAATGCCTTCT
TCCCCATTTTACAAACAATAATAATAATTTTAGAACTTATGCGCTTACTATGTGCTGAGC
ACTGTTCCAAGCGCTGGGGTTAGACTGTAAGCCCGTCATTGGGCAGGAATTGTCTCTATG
TGTTGCTGAATTGTACATTCCAAGCGCTTAGTACAGTGCTCTGCACATAGTAAGTGCTCA
ATGAATGAATGAATGGGGTAGATAACAGGGTAATCAGCTTGCCCTTCGTGGGGCTCTCAG
TCTTCACCCCCATTTTACAGATGATAATGTTGGTTTTTGTGAAGTGCTTACTATATCCTG
GGCACTCTTCCAAGCGCTGGGGTAGATACAGGGTAATCAGGTTGTCCCATGTGGGGCTCA
CAGTCTTCACCTCCATTTTACAGATAATAATGTTGGTATTTGTGAAGTGCTTACTATGTG
CTGAGCACTGTTCTCAGCGCTGGGGTAGATACAGGGTAATCAGGTTGCCCCACATGAGGC
AGAGCTGGGCTTGGAACCCACGACCTCCGACTCTCAAGCCCGTGCTCTTTCCACTAAGCC
ATGCTGCTTATTAACAATAACAATCACGGTATTAGGAGCCAACGATGTGCCAAACACTGT
ACTAAGCACTGGGGTGGATACAGGATCAAGTCTGACAAAGGCCCTGTACCATATAAAGAC
CCTAATCTAAGGGGGAAGGAGAAAAGATGAAGATATTGAGGCACAGAGACATTAGGTGAC
TTGCCCAAGGACACAGAGCAGGTAAGTTGCAATCAGTGGACTGTGTTGAGCGTTTACTGT
GTTGAGCACTGTGCTAAGCTTTTGGGAGAATCCAATCCAATAAAGTTGGTTGAATATGAT
CCCTGCCCATAAGGAGCTTACAGTCCAGAGGGAGAGATATATATTAAATTACAGATTGGG
GGAATCAGGGTTAGTACGTAAAGTCTCACATGGGTTTGTGCTGTTTTTCCACTAGGCCCT
GCTGTTTCTCAAATTATATCTTGATGAAGGATTTAGTTGATATGTTGAACATGAGGCCTG
GCAAAAAATGCAGACATGCAGGATCGGAGAGGGTAATATGTCACTAACCTGGGCATTTTA
CCTGGAAAAAGGCCTGGGATCCATTCCGCGTGTTCTGTGGAATTTTGTTGAAGGCACTAA
AAGTTCCAAGATCTTCATTAAATGGGAGGAAATGTCTTCCCTGTGTTTCTGCTACTCAAG
TAAGGCACATCAAGCAGCAGTTCCTGGGACAAAATGGGAAGAGAGGAGGAGGGTAAAGGG
AGAGAGGGGCAGGATTGCAGAGTTTAACCAGGCTTAGAGTAAGAGAGGGATTATTTCCTT
GTAACTCACAACCGATGTAAACTCAAGGGCTTAATTTATTTAAGACCTGTTGCTTGCAAC
CCTGAGAGCAGAAGCAGAGAACTGGAAAGGGAGAGGTAAAAAGGAGGGAAGGGAAATGAT
TAAGTAGGATCAGTAATCATGCTGCTTAGAGAAGCAGCATGGCTCAGGGGAAAGAGCCCG
GGCTTGGGTGTCAGAGATCATGGGTTCGAATCTTGGCTCTGCCACTTGTCAGCTGTGTGA
CTGGGCAAGTCACTTAACCTCTCTGTGCCTCAGTTACCTGAGTTACCTCATCTGTAAAAT
GGGGATTAAGACTGTGAGCCTCATATGGGACAACCTGATTACCCTTTATCTACCCCAGCG
CTTAGAACAGTGCTCTGCACATAGTAAGTGCTTAACAAATACCAACTTTATTATTATTAA
TAGCCCCAGCCTGTCCTTTCAAGGCTCAAGTGGGCCATTTTCCCATTTACCTTGCAGCAG
GAATCTGAAACACTGCTGCTATATAAGAAAGGTTGCCTGCGTCTTGGGAGCAGAGTCAGC
TTTTGCAGGGTCGAGGTAGGGAGCAAAACAAGCAGCGAGGCCTGGGAGTCAGGGGATCTG
GGTTTTAATTCCTGCTCTTCCACTTGTTTGCTGTATGACCTTAAGCCAGTCACGTAACTT
CTCGGTGCCTCAGTTTCCTCAGCTGTAAAAATAGGCATTCAAAACCTCCTCTCTTTCCTA
GAGTCTGAGCCCCAAGTGGGACAGAGGCAGTCCGACCTAGTTAACTTGTATCAACCCCAG
TGTTTGGATAGTGCTTGGCACCAACCAAAAAAAAAAACCAAAACCCAAAGCGGTTTCCAG
TGCACGAAGAGCAGAGTGGGAGAAAAAAACAGGCCTGAGAAAACTCAAGTTCACGGACTC
AAGCTGTTAGCTGTTATTCAGGAACAATTGTCTGCAATTTGGGGAGATGAAGCAATGGGC
AAGTTTTGCTATAGGAGATGGCATAATTAAAGTTAAATCAGGCTTTAAGGGCTATAAATC
TAATCATGCCACTTAAATAAAGGTAGCTAAATGCTCAATCAGAGGGTAGAGAATCTCCAT
CTTGTGTGTGTGCGCTACATGTTTGGATATCTGCTTCAGTGTCAGATGCAAGGATTTCCT
GCCCCACAGAGAAGTTAGTCAAGTATTAGGGCAGCTGCTGAGTGCTTGGGAAAATCCAGC
CGTAGCAAAATACATGTTTCCTGCCTTCATGGAGCTCACAATCAAATTGTGGAGGAACCT
AGTGGATGGAGCACGGGCCTGGGAGGCAGAGGGCCTGGTTTCTAATCCCTGCTTCGCCAT
TTGCCTGCTATATGACCTAGGGCAAGTCACTTAACTTCTGCCTCTGTTCCCTCATGTGCA
AAATGGGAATTCAGTACCTGTTCTCCGACCTACTTAACTTGATGATCGTGTATCTACCTC
AGCCCTTACTACATTCATTTATTCATTCATTCAATAGTATTTATTGAGCGCTTACTATGT
GCAGAGCACTGTACTAAGTGCTTGAAATGGACAGTTCGGTAACAGATAGAAACAGTCCCT
GCCCAGTAACGGGCTCACAGTCTAAACGGGTGGGTCAGCAAAGCAAAACAGAACAAAACA
GTCTGGCGTTGATTTCATCAAGACAAATAGAATCATAGATATATACACATCATTAACGAA
ATATAGTAATAAATATATACAAATATGCTCAGTGCTGAGGGGAGTGGAAGGGGCGGGAGA
GGGAGGCATATGGGAGGGGAGGAGGGAAAGGGGGGCTCAGTCTGGGAGGGCCTCCTGAAG
GGTGAGCTCTCAGTAAGGCTTTGAAGACAGTAGTGCTTCACAAATTCTGTCATTGTTTTC
ATTATTCATGAAGAGAAACATGCCTGCATCTCTGTAATGAACTTCAGACATTTAATCCCT
ACTGAAAATTTAACCTTTTGTTCTGATCTTTCACATTAGGATAATGTATGAAATCAATCC
AGAAGTGCAGTCTGAANNNNNNNNNNTTTATATGTTGAACATGCGGCCTGGGCAAAAAAT
GCAGACATGCAGGATCGGAGAGGGGTAATATGTCACTAACCTGGGCATTTTACCTGGAAA
AAAGGCCTGGGATCCATTCCGCATGTTCTGTGGAATTTTGTTGAAGGCACTAAAAGTTCC
AAGATCTTCACCACTCTATTATTAATGTCTTCCCTGTGTTTCTGGGGAGGAGGGGAGGGC
ACATCAAGCAGCAGTTCCTGGGACAAAATGGGAAGAGAGGAGGAGGGTAAAGGGAGAGAG
GGGCAGGATTGCAGAGTTTAACCAGGCTTAGAGTAAGAGAGGGATTATTTCCTTGTAACT
CACAACCGATGTAAACTCAAGGGCTTAATTTATTTAAGACCTGTTGCTTGCAACCCTGAG
AGCAGAAGCAGAGAACTGGAAAGGGAGAGGTAAAAAGGAGGGAAGGGAAATGATTAAGTA
GGATCAGTAATCATGCTGCTTAGAGAGAAAGAGCCCGGGCTTGGGTGTCAGAGATCATGG
GTTCGAATCTTGGCTCTGCCACTTGTCAGCTGTGTGACTGGGCAAGTCACTTAACCTCTC
TGTGCCTCAGTTACCTCAGTTACCTCATCTGTAAAATGGGGATTAAGACTGTGAGCCTCA
TATGGGACAACCTGATTACCCTTTATCTACCCCAGCGCTTAGAACAGTGCTCTGCACATA
GTAAGCGCTTAACAAATACCAACTTTATTATTATTAATAGCCCCAGCCTGTCCTTTCAAG
GCTCAAGTGGGCCATTTTCCCATTTACCTTGCAGCAGGAATCTGAAACACTGCTGCTATA
TAAGAAAGGTTGCCTGCGTCTTGGGAGCAGAGTCAGCTTTTGCAGGGTCGAGGTAGGGAG
CAAAACAAGCAGCGAGGCCTGGGAGTCAGGGGATCTGGGTTTTAATTCCTGCTCTTCCAC
TTGTTTGCTGTATGACCTTAAGCCAGTCACGTAACTTCTCGGTGCCTCAGTTTCCTCAGC
TCTAAAAATAGGCATTCAAAACCTCCTCTCTTTCCTAGAGTCTGAGCCCCAAGTGGGACA
GAGGCAGTCCGACCTAGTTAACTTGTATCAACCCCAGTGTTTGGATAGTGCTGGCACCAA
CCAAAAAAAAAAACCAAAACCCAAAGCGGTTTCCAGTGCACGAAGAGCAGAGTGGGAGAA
AAAAACAGGCCTGAGAAAACTCAAGTTCACGGACTCAAGCTGTTAGCTGTTATTCAGGAA
CAATTGTCTGCAATTTGGGGAGCTGAAGCAATGGGCAAGTTTTGCTATAGGAGATGGCAT
AATTAAAGTTAAATCAGGCTTTAAGGGCTATAAATCTAATCATGCCACTTAAATAAAGGT
AGCTAAATGCTCAATCAGAGGGTAGAGAATCTCCATCTTGTGTATGCTACATGTTTGGAT
ATCTGCTTCAGTGTCAGATGCAAGGATTTCCTGCCCCACAGAGAAGTTAGTCAAGTATTA
GGGCAGCTGCTGAGTGCTTGGGAAAATCCAGCCGTAGCAAAATACATGTTTCCTGCCTTC
ATGGAGCTCACAATCAAATTATGGAGGAACCTAGTGGATGGAGCACGGGCCTGGGAGGCA
GAGGGCCTGGTTTCTAATCCCTGCTTCGCCATTTGCCTGCTATATGACCTAGGGCAAGTC
ACTTAACTTCTGCCTCTGTTCCCTCATGTGCAAAATGGGAATTCAGTACCTGTTCTCCGA
CCTACTTGACTTGATGATCGTGTATCTACCTCAGCCCTTACTACATTCATTTATTCATTC
ATTCAATAGTATTTATTGAGCGCTTACTATGTGCAGAGCACTGTACTAAGTGCTTGAAAT
GGACAGTTCGGTAACAGATAGAAACAGTCCCTGCCCAGTAACGGGCTCACAGTCTAAACG
GGTGGGTCAGCAAAGCAAAACAGAACAAAACAGTCTGGCGTTGATTTCATCAAGACAAAT
AGAATCATAGATATATACACATCATTAACGAAATATAGTAATAAATATATACAAATATGC
TCAGTGCTGAGGGGAGTGGAAGGGGCGGGAGAGGGAGGCATAGGGAGGGGAGGAGGGAAA
GGGGGGCTCAGTCTGGGAGGGCCTCCTGAAGGAGGTGAGCTCTCAGTAGGGCTTTGAAGA
CAGTAGGTGCTTCACAAATTCTGTCATTGTTTTCATTATTCATGAAGGAGAAACAATGCC
TGCATCTCTGGTAATGAACTTCAGACATTTATTCCCTACCTGGAAAATTTAACCTTTTGT
TCTGATCCTTTCAACATAAGGGATAATGTATGAAATTCATTCCCAGAGGTGCAGTCTGAA
ACTTATCAAAATTCCTAAATGTGAGGTCCCTAATATATTAGAGGTCGGAAAGCCATCCCA
AAATCTTCAGGTGGGTGTCAAGAAAGGCACTTTACTTCAAGGATCCTTTGATGTCATCGT
GAGAGACAATACTGAACTGAATCGCAGTGTTTATGTACTTAGGATCATAACCCAGACAGA
CTGGAATGTGATTGTTTTTAATGAGTTGCCCACCAACTCTGAATCTCAATTTCAGATGTC
AGTTAGGATTCAACGTCTGTTTCTAAAATCCCAGGTTTCCAAGTCTCAGCCTTCGTGGGG
TTTGCAATCAGACTTTCCTGCAGCAGCGGCATCAGTGACATTGAGGCACAAGTGATCTGG
TTCTGTCGCCACCATGTTCCTCTATAACCTGACCCTGCAGCGAGCCACCGGCATCAGCTT
TGCCATTCATGGCAACTTCTCAGGTAACTGCCATCTGAGATCCTTTGAGTAGAGAAGCCA
AGTTCCCAAGTTAATCATGTTACCGTAGCACCCTTCCCTGCTACAAGATGGGAGTCCTCT
GCCACAGGTAAACCAGCATGGCACACTGCAATTAGGGAAAGAGTCGTACTTTCTGAACGG
GAAAGGCACTGCAAACATCGCACGTGACAAGAAGGAAAGTCTTTGTGAGTGTACAGTGTA
GCCCAGACTGGGTCCTGCATTGGCCTAGGCAGTCGAATTCGCTGCCCGGGAAATTTTAAA
AGTTGCAAGATAAATATAGGAAACGGCTTCCCTCAATTTCTGAAGTAGGCTAATTTAATG
TAACCATTTGTAAATGAGCTCAGCCCACTGAATCAGTTAGGTACGAGTGCTGAAATGCTT
TGAGCCCCTGGCTAAACAACTGCACTGAAATGCCTTTTGAGGGTGTCTAGATGTAAACTT
ATGAGTAGTACAAGTGAGAAATATTTTCTGTTAGCCAAGTCTATTCAGATTTCACGTGGA
TTATTTCTTTATCATGGCTAAAGGCCTGACTGGGGAGGGATAGCTTTCCTTTCAGGAAAG
TGGTGTTCTAAAGTCTATTAAAGCCTGAGATTTGGACCCCTGGAAATCTTTAGTGGGTAT
TTACATTTTTTGCTGATGTTTTATGTCATTTTTGAAAAGTAATTTTTGACACTCTTCGAT
TTATGGACTACTTAGCGGCCCTCCAGCATACAGGCATAGCCAGGGAGTATTTGTTTAGCT
TTCCCTATGTGGCACCTGCTAATTCTTCTCTTCTGATAGAGCACATTGGCTTCTGTTGAG
ATTTCTAATACGGAGACCAGTTGTCTTGGTAGATTCTTGGTCTTCCTGGAAGCAGCTGGG
TTATTTTGGGAGCCAATTTTAGCTGTTGCTCATGGCCGTTTTGGTCTTGATGTTCTAGGA
ACCAAACAACAGGAAATTGTTGTTTCTCGGGGGAAGATCCTGGAGCTTCTCCGCCCTGAC
CCCAACACCGGGAAGGTGCACACTCTCCTGACGGTGGAAGTGTTCGGTGTCATCCGGTCG
CTCATGGCCTTCAGGCTGACGGGCGGCACCAAAGATTACATTGTGGTCGGCAGTGACTCG
GGCCGGATCGTCATCCTGGAGTATCAGCCCTCCAAGAACATGTTTGAGAAGATCCACCAG
GAAACCTTTGGAAAGAGTGGGTGCCGCCGAATCGTCCCTGGCCAGTTCTTGGCTGTGGAC
CCTAAGGGCCGAGCCGTCATGATCAGTAAGTGAATTTGAGGACCGGTCTGAAACCGATCT
CTGGAAATGGGGTTCTGGCTTGAAGAGTGGCTTCTATTGATTGGGGTGTCCCAGGTTAGA
AGTTGTGATCTCCAAAGGGACTTGGCCCTGTCTTTTCAATAGTGAGGGCTGCTGTTCTTG
GAATTCTGACAGATTCCCATCGTGGGTAAACTTTTCCCCAGTTTATGAAATAGCCAGGGC
AGAAACTAGCCAGAACAGCCTTTATAAAGCTGCTGTCTCCATCCCTGTCGTCCGTCTCCT
CCCCCGCCCCGCCTTCTAGGCCGAAACCCACCGGAACCTCCAAGATACTGCCAAGTCATT
TAAAATTGGGAAGTGGATCTGTCAGAAAGGAATGGGAAGGCCTGGAATGATGATCCAGAT
TCATGTCTCTTCTCTGAGATTTCCTCTGGAGAAAATCCTGTTTTTTATCTGATCGGGCCT
TCCCCAAACCCTAATAATTCAGGGAGTGTTTTGGGCACAAAGAGTAACCCACAGGGGCAC
AAACCAGTTTGTCCCTTGATTATGCTGTGTGTCTTATGGAGAAAAGGGGTGTTGGAAAAC
CAAGTGCTGCAGGCCTAAAGAGCAGTCCTGAGTCACTTGTTGAATATAAGATGTGGTACC
ATATGTGTGGAAGTTCTCTGTGCGGTGAGTTGAGATGTTCCTCTCCTAACCTGAGGAACT
CTTGTGAATGGTTTGCCTCTTTGGTCTCCAGGTGCCATCGAGAAGCAGAAACTAGTGTAC
ATTCTGAACAGAGATGCTGCTGCTCGACTCACCATCTCTTCACCTCTGGAAGCTCACAAA
GCCAACACGTTAGTCTACCATGTGGTGGGAGTGGATGTCGGATTTGAAAACCCTATGTTT
GCCTGCCTCGAGATGGACTACGAGGTAACGTCCGCCATCCTTACCTCTTTTCTCTCTTCA
TACTTCTCATTGGAACTGCCAGTGGTTGTGAACTCTCAGTAACGATCTGAAATTTGTCTT
TTGGACACTGTGCTTTACTGTAGGAAGCAGATAATGACCCCACGGGAGAAGCAGCGGCCA
ATACCCAACAAACCCTAACTTTCTATGAGTTGGACCTTGGATTGAACCATGTGGTCCGAA
AATACAGCGAGCCACTGGAGGAGCATGGCAACTTCCTTATAACAGGTGCCTCCCCAGCGT
TGCCTTCCACCCTCATCCTTGAACCTAGCAGAACTCTACTTCGGAGTGGAGTCCAGCAGA
TTATTTGCAGGCGGGGTTAAAACTGTGTTAGAAGATAAGACCTTGATTAGATGGAGTCTC
CTGAGACCCAGTGGTGTCTGCATGGGGGTCCTCAGGAACCTTCCCAGAGTGGTTTGCCTG
AAATGATGACTATTTCATGTCTCTTCTGAGACTCCTGAAGCTCTGGAGATAGCACTTACC
TCTCTGATCAGGCATCGGTCTTGGAGCGGTTTCCTGCAGTTGCTGCCAAGCTAAATCAAG
GGCTGTTGTATTATCCAGAAATATTAAAAGAGTCCATTGTGTAAGGCCTGGTGCTGGCAA
TAGGGGGAACGATACATAAAAAGGCCCGGTCCCTGCCCTCGGGGCCCCTACGCCTAATGT
GAAAAAGAAAACGATGTTCCCGATGAGATTTACCCAAAGTTCCCCTGCATACAATACTTG
AACGTGTAGCTTCAGGGGTACAGCAGCTTACAGATGATGATGATGGTATTTGTTAAGCGC
TTACTGTGTGCCAAGCACTGTTCTCAGCACAGGGAAAGATAAAAGGTTATCAGGTTTTGC
CACTTGGGGCTCACGGTCATAATCCCCATTTTACAGATGAGGTAACTGAGGTGCAGAGAA
GTTAAGTGACTTGCCCAAAGTCACACAGCCGACAAGTGGCGTAGCCAGGATTTGATACCC
ACCTTCACCTGGCAGCTCAGGCGTACCAACAGCTTGCTGAAGTTACCCAATTTAAATCAA
GAGCTGTTTGATATTTTTATTCTAATAGAGCTTTCCCTTTTTTTTTCTTCTTTTTCCTGC
AGTCCCTGGCGGCTCAGATGGCCCAAGTGGGGTGCTTATTTGCTCTGAAAACTATATAAC
CTACAAAAATTTTGGTGACCAGCCTGATATCCGATGCCCCATTCCTAGGAGACGAGTGAG
TGTTTTTGGGGTTTTTTTGGGTCAAATTATAATAATGTGCCGGAAGGCAGCTAGAACAAA
AAGTGTCCTAAAGTTATTCTTAAGGTATTTTCTTGAACTTTTTGTGATTTCTTACTGATG
AGGCAGTAGGGGGTTGCAAGGGAACTAACGTATCTTGATTCACTAGGTTGAGTCAGGTCC
ATGTCTTCTCTAAGATCGGTTCTAAGGGACCAGTCACAAGACACACATTCTTTACTAATG
TTGAGACAGCAAGTAAGTCAGAAAAGGCAGATAAAAAGAAGGGTACATGAAGGAGAAGTA
GTTAATATAAATCAGTGTATTATAAGCCCCTCTAGACTGTGAGCTGCTTTTTTTAATGGT
ATTTAAGCGCTTAATATGTGCCAGGCTGGGGTAGAGTATAATCGGGTTTGGACCAAGTCC
AGATCCCACATGGGGCTCACAGTCTTAATCCCCATTTTAGAGATGAGGTAACTGAGGCAC
AGAGAAGTTAAGTGACTTGCCCAAGGTCTCATACTAGACAAGTGGTGGAGCTGAGCTAGG
ATCCCAGGTCCTCTGACTCCCGAGCTCTGTGCTTTCTCCCCTAGACCACACTGCTTCTCA
GCTTGTCTTTGTTGGCAGGGAACATGCCTTGATTGATTGACTGTGGTCCCATCAAATTTC
CTTTTTGGGCAATTTAGTCATCTTACTAGATTCCAAGTTGGAGAAGCCAAGTGATCTTTT
TTGGGGGTGGAGTGTGCCCTCTCCAAATTTATTGAGCGTTTACTGTGGGCGGAGCCTTGT
TCAAGACATCCCTGCCCTCAAGAAGCTTACAGTCTAGCAGTTAAATAATGCATATAAAAG
TTCTTTAAGGCCCTTTTTTCAGGCCCTGGGGCCAAGTTTAGCAGTGGCCTCTTCTTGGGG
TTCCAGTCAGTGAATATTTATTGGTAAAAACTTGGTTGGATACTAGGCATATTCTTTTGG
GTTTGGAAAAGCTGGGAAATAGTTTAATAACTAAACGTGGTATTATGTGTTTATGTGCTA
AGTACTGGGGTATTTTCAAGATAAAGCACACATGATCCTTGTCCCACCCAGGGTTCAAAG
TCTAAGAGATTAGTCCTGGACCAGTCTCCCCCTATTTCAGGAGTTGGAATTCTGGGCTAT
GTCCCAGTAGTGGAAATTAAATATTTGGTATCTTCTCTGTGTATGTGGATATAGATATAT
ATCAGGTATCTTCCCTGATTTGGGCATGTGGGAGATCATATTTTTGCCCATGCCCAGTGT
CTGACAAATGAAATATAATTCTTAATAGTTTCCAGTTGGACTAGTGTGGGTCTACTATCA
CATTGATTGGGATTGACTCCAGTTTGGCCTGTCCCTGAAATTTTCAGAGGACACTTTAGG
AACTGGGGTACATTTGGGTTAAATGAACATTTACTTTCAGACTCTGCCATATCTGTAAGT
TAAGCCAGTTTTGTAATAAGGGAATTAATTACATCACGGGCTCTGCTCCCTGCCTGAAAT
GATGAGTTCACTTCATGTCTCTTCTCTGAAATCTTCCCTGGAGACACAATTAACCTCGCT
GATCTGATCAGGCTGCGTGGAAGCAGAGCTCTTCTGTACCAGAAACCCCTGAGGGGTTGC
TAGCCGGCGAGAATTTTGAGCCATCCGGTTTCCCTGTAGGTGACTGGGCTTCTCGGGGCC
AGTTGGCTTGGTCACTAAACTGGCATTTGGAGAAGCCTTGGAAAATTTTCACTGAGGACA
GAGGTGGATAATAACCTTCACTGTCCACCGCTGCCTCTTGTGATGGGTTTTCCAATAAGG
GAAGTATTTCACCATTGTCATTATCATTTTCCTTTCATCCACCCACCCTCCAGAATGATT
TGGATGACCCCGAGAGAGGGATGATCTTTGTCTGCTCTGCCACCCACAAGACCAAGTCAA
TGTTCTTCTTCTTGGCCCAGACTGAGCAGGGAGACATCTTCAAAATTACCTTGGAGACTG
ATGAGGACATGGTAAGTGGAGAGATGAACCTCTCCTCGGTGATTCCACCTTTATGGGAAG
CTTTATGTTTTAACCTATTTTTTAGCTATCGTTGTCACCCCTTGATTGTTCACATTGTTT
TACGGTATTTAAGTGCTTCCTATGTGTCAAATAGTGTTCTAATCGCTGGAGTAGATACAA
GTTAATTAGGTTTGGATCACAGTCCCTGTCTTGCATGGGGCTCACAGTCTAAGTAGGAGG
AAGAATAGGAGAACCGAGGCCCAGAGAAGTTAAATGGTTTGCCCGAGATCACACAGCAAG
CAGTTGGCAGAGCCGGGATTAGAACCCACATCTTCGGACTCCCTGGCCCGGGCTCCTTCC
CCAGGCCATGCTGCTTCTCGCTGTTAAATGAGATATGGGAAACTCCAATCCTGGAAATGA
GTTCCTGAGTGTTCTCCGGTAAAGATGTTTAAGAACAGTATAGGTGCACACTCTACTCTC
GCACGAGAGCACTTGCCAGTGGGATTTCAAATAATAGGGTTGGTAGAAACCCCATATGGC
TTTGTGGCTACCACTGCCATTACTGGAAGGCAGTTGGTGAGATCCCATGTTTCGCTCCTA
ACTTTGATGCTTTGGAGGTGCTCAAGAAATATCAGAGGTCCAATTGAAGGGCAGAGAGCC
TTTTCCCAGTTGGAGAGACTATATTCAGTTGTATTTAGTGAGCACTTACTTTGTGCAGAG
CACTTTATTAAGCACCTCAGACTACTGATTCATTCATTCAGTCAACTTGTTTTAGCTCTT
CAAAGGAAGCAATGTGTCCGTGTCTTATTTAGGCAACTGCGTTGTGCCTTCTCCTGAGAG
TAGTGTAATTTCTATATCGGCCACAGTTTACGAGGCATAATTTGCCTAGGTGCGGCTTTA
CTGTTGGGAAACACAGCCCTTGTCCTAAAATTGCTGCCCAGGAATCCCTCCGATCAGTTC
AAGATTTTCCAGACTGAGTGGCAGGGAGGGGAAAGGAGGAGTTGTAGCCTCCCTCCTATT
CCCACCCCTCTTAAGATCAAGTACCATTCCTGTGGACTCTCAGCTCTTCGGGAGACATGC
AGAAGAAACAAGCAGTGTAAACTTGCTGCTTTATCTTTCAAGTATAACCTGTCATTATCA
CTCCCTTTTGCTGGGTTGAAAACCGGCCTAGTATTTTTTTAGTGGTATTTGCTAAGTACT
TGCTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA
CAAGTATTTACAGTTGAGGAAACTGAGGTGCGGAGAAGGTAAGTGATTTCCCCAAGGTCA
CACAGCACACAGTTGGTAGAGCCAGAATTAGAACCCAGGTCCTCTGACTCACAGGCCCAG
ACTCTTTGCCCTAGGCCGTGCTGCTTTCTTATTTACTGAAAACCCAACAGCACGTTCATT
CATTCAATAGTATTTATTGAGCACTTACTATGTGCAGAGCACTGTACTAAGCGCTTGGGA
TGAACAAGTCGGCAACAGATAGAGACAGTCCCTGCCGTTTTCTAAGCGCTCAATAAACAC
CATTGACAGTGATGATTGTCAAGAGTTTTGTTCGACACCCAAAGGAATGGGCGACCATTA
GAAGTTTTTGAAGAGATGAGGGACAAATGCAGACCATCATTTCAGAAAAGCAATCTGGGC
AGCGGAACAAAAGTAGGAACTGGTGGTAGGGTGTTCAGCCGGTGCATAGTCAAGCTAGGG
TGTCTGAACCAGAACGGTGGGCACTGGAGGAAGGGTGGAGTGTGGAGATGCCGTGGAGGA
AGAGCCAGCGGGATTTGGTGACGAGACCGAATGTGGGGTTTGAAAGAGGCAAGGATCAAG
GATAGTGCCAAGGTTACAGACATGAGAGGATGTGCGAGATGTGGTGAGGATGGTAATGTT
ACCTGGGAGGTGAAAATCAGGGTGGAGGTGAGAATTTGGGAGGGAAACTGAAGAGCTTCA
ATGCACTCATCTCTCTGTTTCAGGTGACAGAGATCCGGCTGAAATATTTTGATACTGTGC
CAGTGGCTGCTGCCATGTGTGTCCTCAAGACAGGCTTTCTCTTTGTGGCATCAGAATTTG
GAAATCAGTGAGTATCCCCTTCATGGTTTACTAATATTGGCGGTATTTTGTTAAATGCTT
ACTATGTACTAAGCACAAGATATTCAGGCTGGGTGCCGTCCCTGTCCCACACAGGGCTCC
CAGTTTAAGGGGGAGAAAGCTGGCATCGTATCCCCATTTTACAAATGAGGCAACAGAGGC
ATGGAGAAGTTAAATGACTTGTCCAAGATCACCCAGCAGACAGGTGTCAGAGTCAGGATT
CGATCCCAGGTCCTCTGACTCCCAGGCCCGTTCTCTTTCCACTAGGCCACGCTGTTTCTC
CTCATTTGACCTTGGTTGGGTAGTGGAGATTGGAATAGCCCGGTTCAAATCAGGCTAGAA
CCGAAACTGCCTTTGGAAAACTTAAGCACAAGGAGGCAGGAGACTGTAGTTCTGTCACTT
ACTGTCTTTGGGTAAATGATTTAACATCTCTGGGCCTCAGTTTACTTCCAGAAAGTAGGA
GTGGTCAATGTGTGCTCTTCTTACCCCTGAAGAAATTTTTAAAGACCAGAAAAAGGAAAT
CTGTAGAGCTTCTTTTACACAGGTTTATTGTTCAGTGACAGATGTTAACTGTGTTTTTAA
GATGTGTGGTACCTCTTAATTAACTGGAAGGATTTGAAAAATTCCTAGGGAATAAAATGG
CCAGCAGTTTTTGGAAATGGAGGGAGAGCTGATATGAGCTTACTTTTACTGCATTTAAAA
AGTTGCACCAGAGCAAACAGGGGAGATTGTTTTGGGTGGACATACCTCTAAATTGTATTC
TTAAATGTGACATCTGTCGAATTATTTCTTAGCTCTGTTGTGCTGCCATCGTTTCATTTT
CCAAGTAATTAGTGGCGAGCAGTCCTTGGTTTTGTAATGATAGAATTAAAGGCACTCGTG
ATTATATAGCTTTACACTTGAAATCCGTAATGACTGCATAATGGTGGTATTGACATTAAT
CTTCAGTGACAGTAATACCGCCGCACATTGTCAACATCCCTATTGTGGAGCCCCCACATT
GTGCCTAATAGACATTTTGTGAGTTTACAATAGAAGCAAGTCTTGCCTTTGAAGAATTAA
TCTAACAGATCAGAAACCAGGTTATTTGAAAGAGCAGATTTTGATTTGCTTGCAGTACCA
CCACTAATATCTGTCTCTCCCTTCTCGACTGTAAACATAATAATAATAATGGTGGTATTT
CTTAAGTGCTTACTATGTGCAAAGCACCGATCTAAGCGCTAGGGGAGTACAAGGTGATCA
GGTTGTCCCATGTGGGGCTCACAGACTTCATCCCCATTTTACAGATGAGGTAACTGAGGT
CCAGAGAAGTGAAGTGACTTGCCCAAAGTCACACAGCTGGAAAGCGGCGGAGCCGGGATA
AGAACCAGCGACCTCCGACTCCTAAGCCCGTGCTCTTTCCACTGAGCCACGCTACATTCT
ATGGGCAGGGGACGTATCTGCTAATTTTGTATTGTGCTCTCCCAAGTGCTTAGTCCAGTG
CTTTGCACACTGTAAATACAATCGATAAAATTCCAGAGTTGCTGGGGCCACGAACCGCCA
GTACTGATGGTGCCTGGCCCCAGTCCCGGTGACGGACCTTGGTTTCCATTAGTCATTTTT
CCCCCACCAGTCGGGGAACTGACTTAGTATTTAATGCTTACTTTCCGGATCGAAAGATCA
ACATATTTGGGAGTCTTTTATTACGATCTATTTTGCTCATCCACACGTTGCTGCTGCTCC
CTCGTAGTAGCTGCCTATGGGCCAGTTTTGTGTTCACTGGCCAGAGGGCAGTAGTGAAGC
TGAAAATAATATGCAGTGGCCAGGAACAATTCGGTAGTGTTCATCCAAGGGCTTGGGCCT
TGAGAATCTCCTCCCAGCTTCCAAACCGGGTTGCTTTAACTTTGACTAGTAGAAGACTAT
GCCGAACCTCAGGGACTTGGAATGAGCTACTGGCCCAATACACAACCAGCTATTAAGATT
GGGTCAGTAGAAGGTGAAACCAGTGAGTTAGAATGAGCTCTTTGGATCGCCTGTGACCTT
GCTTTTTACACACCCCTCCATTTAAATGAATGACTGAGAAATATTGTTACCGTCAGTTGT
ATCAGGTTCAGTCTTGCCTGCAGTACAGACCAGAAACAGTTTGGAAATAACCATTGTTTC
TTTAAAGGGAGTAGTCATTTTTCTTGCTGAAGTTCTGAAGGAGAATTATAGGTCGGCTCA
TTGGCCCTAGGATCCTCTTCTTTCCGAGCCTCACACCCTGATCCTTTCTCCCACTGGGGG
TTGGGCTGACCGAAAGCATGTGGCCCTTCTGTTCTCCCCTCCAGTTACCTGTATCAGATC
GCCCACCTGGGAGATGATGACGAGGAGCCAGAGTTCTCTTCTGCCATGCCTTTGGAAGAG
GGAGACACATTCTTCTTCCAGCCTCGACCTCTGAAGAACCTGGTGTTGGTGGATGAGCTG
GACAGCCTCTCCCCCATCTTGTTCTGCCAGGTACAGCTTGTCCTTTAATAATAATAATTG
TGCTACTTGTTAAGCGCTTACTATGTGCTGGGCACTGTACTAAATCCTGAGATAGATCCT
TTCTCTTTGCTAATAGGAGCTGCTACCAGCTCCTGGTGGGGGGATTATTTAGTATCGGGT
CATCAGGCTTTGCATGTGTTGCCTTTAGGGGAGGAGACCACCTGTGGTTAATTCAGAGGG
CTTATGACCAGCCTAAGTGATAATGATTCTTCCTGTCTCTTCTCTGAGATTTGCTATGAA
GAGGCTTGTATTTTTATTCCTCTGATCAGACTGGTGAAGGAACTTCCTAGCTCTCCTCAT
TTGCAGAGTTGGTCTGAGTGCTTGCCAGACGTGACCTGGGCCATGCCATAGTGGGTCAAG
CTAAAGATCCATGGGTCTGACAGGGTCATCTATTGGGTCTTGGAGGAACAGACGATGCTT
GCCCTTCTCGATGTCGGGCACCAATGCACATATATGCACACTTCGTGGGGCCTGGCTTTC
AATGTAATGGAAGGAAAACTGGTGCTGGCCAAAGGAGTTTATGGCCTTCCTGTTTTGTCT
TAGAAAATGAAAGGTCGTGGGAAGGGAACCTATCTGCTACCTCTGTTTTGTTGTACTCAA
ACGCTCAGTACAGTGCTCTTCCCATAGTAAGTGCTCAATAAATACTATCGATTGGTTGAC
TTTGCTTGTCTGAAGTTGCCAAGTGACTTTCACCTGCTGAATTTCTGCCAGCAGAATGAG
GGTTTCATGGTTCAAGGTAAAGCTCATTTGCATACTTGGTGTCAGAAGTGTGAAGCGACA
TCTTGAACAGTGTTTGGGGCCAAGGCTGTGTTTGGTAAGGGCAGGCAAACAGAGAGGGTT
GTGTTTCTGAGATCATAGTTGCCCACTTTTCATTTTGGACAAAAAGGAGGCAGCAGTTTG
AGGGGGATGAGGCTCGTAGGGGCCAGGCTTCAAAGAGCTCCTAGGCCAGAAAGCGTTGGG
CTCTCTTCTGTCTCGATTGGAAACTCCCAGTACTTGTCAGAGACCTGGAGATGAGCAATC
TTGGTTGTCCAGCTCAGAAAACTGGGGATTGATCACTGCTAGTGGCCCTGCAGAGTAAGC
AGCTCTGTCTAGAGCAATTCTCTCTTAACCTTTCTTCCTTTGTGCAGATAGCAGATCTGG
CCAATGAAGACACCCCACAACTCTACGTGGCCTGTGGTAGAGGACCTCGGTCATCTCTGA
GGGTCCTGAGGCATGGACTTGAGGTAAGGTCTGATCTTTCCGATCATATGATAAGGAAGA
AATGGGCTTGATCACTGGAGCCCTGAGGACCTGTGATAATGAAGTGGGAGCTAAAAGTGA
TTCCTATTGCTGGGTGAATTAAAGATTACTCGAATGGAGAAATAAGAACAGTCAAAAAAG
TGATTAAGTGGGAATGAGGAAACTTGCATTATCAGACTCAGCATAGAAAATAATCTGCCT
TTCAAAATGAGATGGCCAAAGCAAATCATTCACCATTTCCTTCCCCTGAGGCATTTTTGT
CTCATTGTTTTTGGTGTTGATGGAGTCATTTTCCTTGCCTCTCATCTTAGAGAAACAGTG
TGGTCTAGTGGATAGAGCACAAGCTGGGAGTCGGAAAGACCTAGGTTTTAATCCCGGCTC
TGCCACTCGTCTGCTGTGGGCCTCGGGCAAGTCATTTAACTTCTGTGCCTCAGTTACCAT
GTCTGTAAAATGGAGATTAAGACTGTGAGCGCTGTGTGGGATTTGGACTATGTCCAACCT
GATTACCATGCGTCTGCCTCAGCACTTAGTCCAGTGCCAGGTACATAGTAAGCACTTAAC
AAATACCATTAAAAAAGGTCTGGCTATATTGAACTGTCTGCTCCAGAACTTTTGCTGCAG
ACTAAGAAGTGAAATGTTAGGTATTTTCTCTGAGCCGTTGTGCTATCTTTAGCTACTGGT
GCCTCTAAGAGGGGCTTCTGGTTTGGTTTAATTAGGGCACATAGTTGATTTCCTATTTTA
AGTTTAAAGAAAATCTTTGAACCTGGAAGATTTTAATCTTCCTTTCGGCTTGCTTCCTCA
CTCCATTCATCTGTAAGGATTCAAGCAGAGCCACTGACTAGCTTCCTTTAGCTCCCACTT
TACAGAGGGCCCTGGACAATTTGTGCAGCTGATTCCTAATCAGAGACTTGAGTGTGAGGT
TGCTTTAGGGAGAAGAGAAGTCAACTCTGTTCAGACTTTCACTGCCCTCCTGCCGTAGCT
GTTCTAGCCCTATCAGTGGCTAGAGAAAGGATTGCTAGGCTCCCCCAGGGATCTGGCATA
GGTCATAAAAATGTTGACTCTGTTCTGTGTCTATAGCTGAGAAAACAGATGTGGTTATTG
ACCTAGCTGCCTGCCATCCTCCTTTCTGGGTACTTCGATTTTTGCTTCTGAGATCAATCA
TCAGTTGAGTTGCTTCCCTCTTTCTTTCGGGGCTTTTGCTGACTGGTCTTTCTCCACCTG
GCAGGTATCTGAAATGGCTGTCTCCGAACTGCCGGGTAACCCCAATGCTGTCTGGACTGT
TCGGCGACACATCGAAGGTAAGCAATCTTTCCCCACCGGCTCGACAAGGTACCAAGACTT
AAAAGGCTAGAGGCTGCAGTCAAGATGCTTCTGTCTCTTTTATCCAGCACAAGCTTTGGG
AGGTTTTCATTCTGTTGGCCAGTTCAGGATCTGTTTGCTCAGTCATCCCCCTTTGTCAAT
CAGGCTTCCTGGTTGTGGCTAATTTTTAAGAGCCAGAGCTCTGAGCTCCAGACCTTCTGA
GCTCCAAGGATGAATTAGTGAGAGGGAAAGTGGATCTAGGAATTGGCAGGTATTTCTTCT
AACCTTTCACCACTGTTCTGCAGCAGCTTGGGAGAGGCTGCCGGGTAACAGTGGAGTCCC
AAGAGGTCGTAGGGATTGCCCCAAGTTTATTGCCATGAAAACCTGCCTCCCTGAAAATCT
TTTTGTTTTTTTCCAGTTTGTTTCAACTCTTAGGACAGCAACCGGTGGTGTTTGTGCTCT
CCTAGCTCATTCCGAGGGCTGAGAGTTTTAATTTTACTTTTCTAAAACGTAATACCATAG
GATAATGCTCTTTTGTGGGGGGGATTTGGCCAATGTGAGAAGCCGGGTATGGTGGACAGT
TTTGTTAAAGGAAGCCAAGGATTCCCTGCTTGAACTACCTCTTGAGTAGCAGGGAAGGCT
GGCATTATGGAGTTTGCAGAGTTAAAGGGAAGTGGAGGAAGCCTAACTACTAGTTTTAAG
GCCTTTAGGAGGTAATGAGATTGAATCATTTTAAGCAAAGATGGAATCATCACCACCTCC
TTAAAAGCTGAAAACGAATCACAAAGTCTAGTAGAGCTTTCAAGTTTCCCATTCCAAAGT
AATGATCCTGACCCAGGAGTCCCTTTGGCAATGTTGTAACCTTTGTACAAGAATATCTGA
GGGTGGGTTAGGTAACCCCAGGGCCTAACTCAGAGCATATTATAAGTGTTGAAAGATCTT
GAAGTCTAATATTTTTGTTTTGCGGAGCCATCCCAAGAGTGAACTTGAACATTACTAGAG
GAATGTAGTTACTCAGCTAGCTAGAGATCGACTTGAATGGATATCACCCTTGAGTTGGCT
GTAGGGTTCAGTTTGGTGTGAACAGGAAATAGCTGGGAACAAGGCCATGAACAGGAAATA
GCTGGGAACAGGGCCATGGTACACCCAGGCTCTAGAGAATTACCAGATTCACACTTTTAT
GAAGATTTCAGAATTGTGTTCCCGGAAATGTAACTCAAGACGAACATAGTATGTTTATCT
TGCAACATCTTGCAGAAGTGGCAGGGCTTTGGAGTTTGTTATAAACCAGGGATACCTTGA
ACAGAGCAAGGGAATGTGGGAAGCGTCCTGGAAGTTTCAAGAAATGTGCCAGCTTTGCCC
TAAATTATTACTACTTCACCCCCTAGTCCATAGTTACGGTCAACACAGAAATCCTCCCAA
CATGCAACACAGCCTGACCAAAGTGACTGATGGGAGCCTTGTTTTATGGTGGGACTTGTG
ACCGGGTAATAAGCTGGAAATCAAGCCTCCACAGAGTTTGTCTAATTGAGCCATTTATCA
CTCCTTTCTTGCCTCCGTGTACATTCCTTTTCTCCAGAAGCCCCAGGTTACAGTTGGGTG
ACTTAGCCATCTTATCCGCACAGGCTGCAGTCTTCGAGGCAAATACTAACTAACCCTGGC
TGGTACTTGGCGATGCACACTACCAATACCAAGCCTTTTTTTCTCTTCCACAGGTGGCTG
GTGGAGGTGCTGATCACCACAGGTGTGTACCTACTGCTAGGGTCAACTGTGCTGGCTTGC
AGGTTACCCAGGGAGAGGGAAATGCAAAGTCTTGGGACTGCCTTGACAGCAAAGCAATTC
CCGGAGTGCAACTTTGCAGGTGGAAATCCAACTGCATTGAATTGACATTGTGCTTCCACC
TCCTCAGACCTTCAGCATTGAGGCTAAAAGCTGTTTACCCGGTGCCCCACCCCCACCCAC
AACCATATCCTCCTGTCAAGTCTTAGGGAACATGCAAGGAACACCGCTTCTTGGCCAGGC
TAGAGAGTGAGGAATTATCTTCTCCCCAACCTGAGGTGGCAGACATTGCACATTCTAGAG
CCAAGAGTTGAAGGATCCCAGGAAAGCATCCTCCACGTTCAGGGACCTGATCGAGGCTGG
AGAAGAGCAGCATAGGCATTGTCTGTATTAGTAAAACAAGGTGGATCAGATGATTTGGGC
GAAATGTTTTTAGTTTGAATGGGGTTGGGTGTTGTTTTTTTTGTTGTTGTTGTTTTGTGA
ACTCCTGGGTCACCCCGCTGATCATCCCAGTTCTTTGTTTTATTTTAGAGGGGCCCAGGC
TAGCCGGCGACTCTCCAGCCGGGATTTTCACACAATGGGAAAGCGGACAGAAGGGGGAAC
ATTCCCCTCCCACTTACTTTCATTGGGCAGCCCAGCAGGGGTTGAACCGAAGGGTCCGCT
GAGACTGGGCACAATGGCTCCCCTCAGTCTGTGGTGACTAAGCTTTTATCTCTCTGGTGG
GGGTTGTGCTGGAGCGGTTACTGGTTCACGTGTTTACTTTGTTCGGTCAGATTAATAGCT
TTTATTGATTGTGGGTTTGTTAGCACCATCCCACAAGACTGAATAAAGAGCCACATAAAT
ATTTATAACTCCCTAGGGACATGCTACAAATTAAAGCTGATGTGGGGGTTTTTTGCAGCC
TGTAACAGATTTGCAAGGATTAGGAGCCTTATGGCAATTGATCAGGTGTGTTGGAGAGGG
GAGTAGGATCCACCTAACCCTTTGGGTCATTTTGTACTGACCTCAGCTGACTTCTGCTCA
GGAAGAAGCTGCAGAGTGTCCAGAAAATGTTTTGGGGACTTTGGGAGTGATTGCGGGAAT
GAACTGTGATATTTGAAAATCGGTCGATACTCTTTCAGCTAAAGAAATTTACCGATCAAG
ATGTCAGTTGATGCAGCATCATTGACCATATAATAATTATGGTAATTGTTAAGTGCTTAC
TATGTGCAAAGCGCCAAGGTAAATACAAGGTAATCGGGTTGTCCCATGTGGGGCTCACAG
TCTTAATCCCCATTTTACAGATGAGGGATCTGAGGCATAGAGATGTGAAGTAGCTTGCCC
AAGGTCACGTGGCAGACGAGTGGTGGTGGAGCCGGGATTAGAACTCACGTCCTCTGACTC
CCAAGCCTGTGCTCTTGCCACTAAGCCACGCTATCTCTGTACTCCAGTGGCTACCTTAGA
AGTCGGCCGCCTTGTGGTCCTGACTGTAGTTCCATCGGTCTTTGGGTGAGGTTGGACGGA
ACCCTTAGGAGAAACAGGTCAGATCTCCTTCACTTTGGGGGCAGTCAGTTTCCCATTTGG
GCCAGCTCCGGCAACTGGGAAACGGCCGCCAGGACTTTGACTTTAATTCGTTGTCTCGCG
AGGCCCTGCTGGTGTCAGAATCTAGTAATGGGAAACAAGGGACAGAAATGAAAGCCTCCC
TCTGTAAACTTTCAGCCAGGCAATAATTGGCAGTCTTGCTCAACAGTGTTCTTTCAAATG
TCGAGTGCCAAGCGGAACATCTCCCTCAGCTACGGCTTACGGGAAGCCAAATTGTAAAAT
CTTGGTTTCTGTGGGTTTCTGTTCCATCGGTGGACTCCACCCAGATTGCTAGAGAATTTT
GCCCTCAGGTACAGGGTGAGGGCTGCTGATGTGGAGAGACGACTTCTCAAATGCCTGAAA
GTATTTGGCTTGGAAAGCCACCTCCATTTTTGGCCAAAGAGAAAGAAGCAAAGAATGTGG
TTGCTTGTTCAGGGTTACTCAGGCATGTGCGTGCAAGGTTAGAAATAGTGTTCTTGGTGG
ACAGATTGGAGAAGAGTTTCTGGGAGAGATTTCATCTTTGGCATTTGACCTGTAAATGAC
TCCGCTGTCATCTAACACCCCACCAGTGGATTGCTGGACGAGCGGTTACGGTATTGTGAA
TCTCTCTGCCTTTTAAGTTTCAGTGTGGTGGATTTTTATTTCACCTTTTGGTCTATATAT
ATAAGCCCAGGCTTCTTTCATATAGGGCAACATAGGAACTCCAGCCCATTAGCAGGGAAG
GGGGAAAACTCACGTATGCTTAGTACAGTGAGTGAGCAAAGCCCTGGGCTAAAAAGAGAT
CGGTGGAGGGAGGAAGCTTGGAATGAATTTGCCTGCGGCCCCTAACACAGGGCCAGCTGT
TCAGAGGTTCCCTGATTTGGACTCTGGGACCAGCCTTAAGTAATTTCTCACATACACGTT
TTCTTTCTTTATCTCTCTCTCACTCTCACTCACTGGCACTGCCAGACTTGAACCCCAGAA
GTCTGCGCTTCTAAGCTTTATGTATAAGTAGAAGAAACATAGAAAAATAGAAAGAACAAG
ACTCCTTGACATAAAAAATGAGAGGCAAATGTCCGCTTTAGTTTGTCAGCCCTTAAAGAG
CCCGGCCCCTTAGGGCCTCCTCCATTGATCGGTTGGTTGCCATCCAGAATGTTCCTCAAG
AGCTCTCCCTTGTTCTTCACTCTTCATATGCATTGTTGCGCTGACTCTCAGAAAGGGAAA
GAAGAGGGGGAGGAGGAGGGGCACAGGCCCAGGGCAAGCATTCCAATCTGAAGAAAAATC
TCAAAAGGTTGCTGGGAAGATCCACAGGCATTAATCTGGATAATTGGGGCTGAAATTGGG
TATGTCGTGGAAATCTGATGGCCTGCATCTACTGGACTTATTTAAGGAGTATTAGTTAAG
GCAGTTTAGTATACAGGTCTAGTCCTCTGGTCTATTATAGAAACTCATTAGTGTTTGTTT
ATCTAAACTGTTTCCTTAAGGAATAGTTGGTTTTAGTCAGTCGTTCTTAGTCCACAGAAA
TTTGTTCAAGTCATCATGCCATATTAACTATCTGCAAATGTTAAAGACTAGCAATATAAA
CTTTCCGCTTGCCTCTATTCCTTTTCATATTAGGAAGGTCTAGGATCCTCTCCCACTTCT
ACCCCTGCGCCCCATTACAGTTATCCTTGCTGCAATTTGGGTTACTCTACATTTCCTCCC
CTTGGGCCTTTGCTCTCTAATAATTCTCTTGCAGTTTGCAATGGAAGCAGTTGGGAGATA
CCCAATAGTATCTCCTTTGGGCTATGATTGGGCAGCTGTCCCAAATTCATATCCTCAGCT
TCAGTACCTAAAGAGAGTGGTGTATTTGCTCTATAAGCCATCTGCCCACGCCCGGATCAC
TACAGTATCAACTTAACCCCACCTGGACATAAGTTTCTGATTTTGGTTAGGGCAAATTTA
GCTCATTTGAGCTCGTATTTGAGGTGTTCGTGTCTCGGCAGAAATTGAAAATTAGTCCTT
TTCCAAACTGGGGAGGCTGTTATTTGCTTCAGGGGTTGGCCTTGCACTTCAAGAGCCTGG
TGCCTTGCTGATGGGGCACTTTGTACATTTCTTGACCTTGAGTTTGCCGAGAGCTGGTGA
TCACAGATAAGGAGTTGGGCTCTTGGTGGGCTTCTGTAAAGGACCTCTTAGTTCTGTGTA
TATATGAAGGCATGCTTAGAGTTGGAGCTCTTGCAGGTGCCCAGCTAACCAGCTCCTCTC
TCCCCTCTCTTCTTTCCCTAGACGAATTTGATGCCTACATCATCGTGTCTTTCGTGAATG
CCACCCTGGTTCTCTCCATCGGGGAAACTGTAGAGGAAGTGACTGATTCCGGATTCCTGG
GTACCACCCCAACCTTGTCCTGCTCCCTATTGGGAGATGATGCTTTGGTGCAGGTAAGGA
ATTCAAGTCATCTTGTTGACAGATCTACGTTTTGCCCACTACTGAGGTATTGGCTGCAGT
GACCTGATAGGATGTCCCCAAGTTTGATCAAGAACGTGACAGTAATAAGCCTCTTCTTTG
GCCTTTCCCAGAGGCAGAATAGCTTAGTTGGGTACTTTTTAGCACTGGAAACCGAGAGCC
CAGGATTTTGTGTCAATTCTGCCACTAACTCGCTGACGAAGTAATTACCCTTGAGTTCCC
TAACTGTTAAAGGGTGAGAATAATCCCAACTTTGGGCTTACTGGAACCAGATAGCATAAA
TCCAAAAATTGGTTTAAAGTTGATCTCTCCTATGACCTGTTGCTCCCACTTGAGTTGACC
GACTGTCCTTTGCCTTTGACTAAGGGCTGTGGGAGCTTTTGGTCCAACAGGAAGGGAGGT
GTAAATGAGGGACCACCCGAGTGACGGTGAAATCAAGCCCCTTCTGGTTTAATCTCTAGG
TGTATCCAGACGGTATCCGTCACATCCGAGCGGACAAGAGAGTGAATGAATGGAAGACGC
CGGGAAAGAAGACTATCGTCAAGTGTGCCGTGAACCAGCGGCAAGTGGTGATTGCCTTGA
CTGGAGGAGAGCTGGTCTACTTTGAGATGGACCCCGTACGTGACTTTGAACCAATTTCTC
CACGGCTGTGGGGTTGAGAGTTGGAAGGGAGAGACTGTGTTCTTTTCTGTCTCAGATGTG
TTCCCTGAGAGACCTGAAGTGAGAGGTCAGCCCTAGGTTAAATCCTTTCCCATAATGCAG
AGATCCTACATTGGAGGAAACAGCCTCTTGGATCTAAGAGTGTAAGGAAATTCCACCCAA
AGCATACTAGCTCCCTCTCCTCACCCTTTCCCATTAAAGTGTTTGCTTTACAGGACTGCA
GCCTGTTAGCTTCTCCTTAACCTACTCACCTCTGCTCTCCAAAGCTTTCCTATAAAAGGT
AGAAGCCGCAAGCAGAGTTCCAGTGTATTACCTTGCAACGTACCCAGTCGTGGTTTCTGG
GTGTGACTTGCCTCCCAGGGTTCCTGTAAAAATGGCACGGTCTGCCTGTGATCTTTAATT
GTATATTTCCCCAACTGATTAAGTATACAAAACACTGACTCCAGGTGGCCCAGAATGCCC
CTAGTAGTAGGATTTATTGAGTGCTTACTGTAAGTAGAGCACCGTACTAAGTAAGCGCTG
GGGAAGAATACACAAGTGGGAATTAGACCCAGTATCTGTCCCTTGGGCTTTGGGCCTTAG
GAGCTATGAGTTTCACTGACGGTGGTCCAAATGTGACACATGGATGGGAAGTTGAGAAAT
GAATAAAAAAGGATTTAAAGCTGATGTTGATAGTGACAGAGGTGCCTACTTTTCATTCTG
AGCACAGGAGCGAAAGGGGGCTGGGTTTTTTGGGAGAATGAGACTGGGGATGGGCCCGAG
CTTCAAAGAGATAATAGACCAGAAGCCTCCATTTGGGGTCTTTTCATCCCTGATTGGAAA
CTTTGAAAGCCTGTCAGAGGCCTGGGATAAACAATTCTGAGAAATCACCAGCCGCCAAGT
CTGTAGGGGTCATCTCTTCCAAGGATGGGGATCACAGTTTGTGATTCGCTTGGAGGTTAT
CTGGAGTTTCTCAAATGCGTTTTCCCAACCAGAAACAGGTTCTCTTATCCAAACAGGGCT
AAGTGTACCTGCAGGGTTGTGAGGATCCGCTTCTCGGAGGGTATGGTGCCTCAGCTTCAG
GTGAAGCTGAGAGGGTTTGGGCTGGGACTGGGGTTGGGGTCGGTTCTGTTGGCGTGGCCT
TCTCTGCTGTGGTCAATGAATCATTCATCCCTGCTTTGTCTCTGCAGTCGGGTCAGCTGA
ATGAATACACGGAGCGGAAGGAGATGTCAGCCGATGTGGTGTGTATGAGCTTGGCCAATG
TGCCCCCAGGCGAGCAGCGCTCTCGCTTCCTGGCCGTGGGGCTGGTGGACAACACCGTCA
GGATCATCTCTCTGGACCCTTCGGTGAGTGGGAGCCCAATCCCCTGGAGCGGGGGTTAGT
CTGGGCCCGGGAGCGTCTGGCACCCCAGAGCTTCCATACCCTATCTCAGCAAGCCGATGG
AACCGTGGTTTCTGCCTGACCCCTCATCTGTTCCCCGCTTTGGGGACTGAACATGGATGT
TGCCTGATGTAGACACAATCCCTGCCCACAAGGAGACTCCAGTTGTATATCTATTCCTCC
CCAGAGGACATGAAAAATAAAACATTTTCATTCCTCCATCTAACTTTAAACCTCTCAAAC
TACAAAATGAAAGGTCCTTTTCCCATTCCCTTCCTCTATGTAGTTGTGTCATTTGTGTCT
CCCCCCCACAATGAATTCATTCATGGGAAATTTACATTCACATCCTCCCTGTGGCCTGGA
ACTTCCTCCCCTTCCATATCTGACAGACTACCACTCCCCCATCTTGAAAGCCTTATTAAA
ACTACATTTCCTCCAAGAGGCCTTCCCTCACTAAGCTCTTATCTCCTCTACTCCTCCCTT
GTGCATTACCTGTGCATTTAGATCTGTGCCATGTAAGTACTTCATATTCACCCCACCCTC
AACCCTACAGCATTTATATATACAGCTGGAATTTATTTTAATGTCCATCTCCTATAGAGT
CTATGCTCCTTGTGGGCCAGGGATGCATCTACCAAGACTCGCTCAAACGTTTAGTCCAGT
GCTCTCCTCACAGTAAGCGCTCAGTAAATACCACTGATTGAGGCAGTAGACTGTAGTGTG
ATAATGCCACTGCACAACTGAGGAGATTCTAGACCCTAAGCTCTATCCTCTGCTGCCAGA
AGAGACCCTCTGTCATTTCTCCGTGGGTGGTGAGGCCCCCTCCGGCAGCTGAGGAAGCAG
TGTAGCCTAGTGGAAAGAATACAGGCCTGAGAATCAGGGGACCTAGATTATAATCCTGGC
TCTGCCAGTTGACTCCTGCATGACCTTGGTCAGGTCACTTAATTTTTCTCAACCTCAGTT
TTCTCATCCCTAAAATGGGGATTAACTCCTACTTCCTCCTACTTAAACTGTAAACCTTAT
GTTAGACATGGATTATGCTTGACCTGATTGTTTGTACCTAACCTAGCATTTAATATAGTG
CTTGGCATCCAGTAAGCACGTAACACACACCATAAAAAAAAAAAACTCAACAAAACTGAA
TGGTCTTCAACTTCTTGTGGACCCTATATTTGGTGTCCTTGGGGTTAATGCCTCCTCTGG
TATTAGCCATTGGGGTGGTAAATACTAGAACCTTAAAAATTTTGCTCTGACTCGACTGCA
ACTAGGTAGCACTGGAACAAGTAATACCCTACTGAAAATACTCCCTTGTCAGAGGAGTCC
AGATTCTGGCCAGAGATGGATTCCAGGGAGAGGATCTGGTTCTTGATTTCACTGTAGGTA
ATTCCCATCATCATCCCTCAGTCTGTGCCATCTGTCTGTCTTTCCCCAGGACTGTCTGCA
GCCCCTGAGCATGCAGGCCCTCCCTGCCCAGCCCGAGTCCCTGTGTATCGTGGAGATGGG
TGGGGCCGAGAAACAGGATGAGTTGGGAGAGAGAGGCTCCATTGGCTTCCTCTACCTGAA
CATTGGACTGCAGGTGAGTGACGGGGAAGAAAGGAGGGCTGCTTTTGGATTGAATACTTC
CTGTGAGTCCCTTCTCCCCCTGCCTCCCTTCCCCCAGCCAGTTGACAGACAACAGAAAGG
CACCTGAGTGGTAGGCTTAGGGCTCAGTCTTGCATTCATGGTGTGCCCTGAAAGGAAGCC
TGTTAGGTCAACTGGTCCAAGCCAGAGAAGGGAATGTGCAAGTCTTGCACAGCATCCAAC
CTCCAAGATAAAGCCCCCACTCTGCAAGACCCCTTTCTGGGCAGGTTTGGACTGGCTGGG
ACCTTCCCAGAAGCCCCAACACCTCTCCACTCAGCACCTCTGCCGGTGAGCAGCAACAGA
GTAGTGAGGAAATTCTGCTTGGGTCAGCCTCACTTTTCTTGGGGTTCATGTCCACTGGTT
GACATCTTTCCAGGCCTTGGATTTGAAAACCTCTGAGTGTTTAGTGTAGTTACATAGGAG
GCATATAAAAGGGGAGAGGGGTGAGCCAGCCCCCTTCAAACCCACCAGGCCTTTCTCAAC
CACCTGCCCCGGAATTGTCAGAGCTTCATTATCCATGGAGGAAAAAAGCTGCCAAAGAAG
AGTTCGTGTGAGGTGGTTCTTCACTGCATGTAGGTGAACTTTAGGCTTTTCGCTTCAGTG
TGACTACAGCCTAATGTGTGTTTCCCCCTGCCCTTTTTTTCTTTCTCTCTCTCTCATATA
TATATATCTATATATCAGAACGGTGTGTTGCTGAGAACTGTCCTGGATCCTGTCACCGGG
GATCTGTCTGATACCCGCACCAGATATCTCGGCTCCCGCCCCGTGAAGCTCTTCCGAGTC
CGAATGCAGGGCCAAGAGGCGGTCAGTGACCTGGAAACCAAGCCGCAGAAATTCCATCCC
CTCATCGTGCCCGCCGGTGGGAGGAGGGGCTGGATAGAGCTGGGTGCAGACTAGCTGTGC
TCCTGGTCCACTGGCATGTAGAACTGTTGCCGAGTGCTAACGATGTGTAGCTTCCCCATC
CTCTCGTCGAGCTCATGTGCCCTCCTCAGAGCCTTCCACCTTACATTTTGCTGCCCGAAA
GTTTGAAACATGGCTCGGGGTAGCCGACCCTGTCCATGAAGCTGGCTAGTGCCTCTCTTT
CTGACTTTACTGACTTTCTTTCTCAGGTGCTGGCCATGTCAAGTCGCTCGTGGCTAAGTT
ATTCTTACCAGTCCCGTTTCCACCTGACGCCCTTGTCCTATGAGACCCTGGAATTTGCCT
CTGGTTTTGCTTCGGAGCAGTGTCCTGAGGGAATTGTGGCCATTTCCACCAATACACTCA
GGTGAGTCATATGGAAAGAGCACAGACTTGGGAGTCAGGAGACCTGGGTTCTAATCTCAG
CTCCCCCACTAGTCTTCTGTGTGACCTTGGGCAAGTCACTTAACTTCTCTGGGCCTCACT
TACCTCATCATTAAAATAGGGATTAAGACCCTGAGCCCAGTGTGGGACATGGACTGTTTC
TAACCTGATTAACTTATATCTATTCCAGTGTGTAGTACAGTTCTTAGCACATAGTAAGCA
CTTGATAAGTACGATATAAAAAAAGAGTAGAAGGGAAGCACCCTGTGATCCCAAAGCCAT
TTCTGTCCCTTCTTGAGGAGTCATTGGAAGGGAGTTGGGTGGTGGTGGAGGGAGGAGCGG
AGAGTGCTGAAATGGGACCAGATCATCATGGTCTGATGAGGGATTTGGCCAGAGGGAGAT
ATTTGCGTAGCTTTAGTGGTAGAAAGGCTGGTAACCTTCATGGCAGAGCCTCTTCAGAAG
TTCAGTAAGTCCTTAACGATAAGATGTTCAAGTACCTGCAACTCTGAGGTCACTGGATGT
AGGGCACCTTCCCACCCCGGAGCATCAGATAAATAGGATGGCTAAAAAACTCCTTTTTCT
TCTACTTCAGGATTTTGGCTTTGGAGAAACTGGGTGCTGTCTTCAACCAGGTGGCCTTCC
CGCTGCAGTACACCCCCAGGAAGTTCGTTATCCACCCCGAGAGCAACAACCTGATCATCA
TCGAGACAGACCACAATGCCTACACCGAGGCCACCAAGGCCCAGAGGAAGCAGCAGATGG
CAGAGGTAACTGCCCGGATCTCCTTCATGAGAACCCAGGGAGGGGCCAGTTCTCTGGCTG
CTCTTTTGGGTCCCAGGACCCTTCTCCGTGCCAGTATTAAGGCATTGGGTCTGTTTGGCT
TCGAGTCTGTCATCGAGCCAGTCCTCTTGGCCAAAGGCAGCTCTGCATAATCAATCCCCC
AGCTGGAGCTGAGGTCTACATCCTCACGTCCGCAACTGCTAATTGTTCATCCTGGATGTC
TGTGCATTTAGCTTTCGTTTTCCCATAAACACTCTCCGGAAAGTGGCTTACATCTCCAAA
ATAGAAACAGTCCATTTAAATCTCAAACTAATTTGTGACTGAGGAGGCAGAGCTCCTTCA
AATGAAATGCTGTTCCTGACAAGGAGGTTTACAAAGATTTATAGCCGGTACCTTCTTTGA
GATTTGTCTGCTAGTTGANNNNNNNNNNGTGGAGGGAGGAGCGGAGAGTGCTGAATGGAT
CAGATCATCATGTCTGATGAGGATTTGGGGAGAGGGAGATATTTGCGTAGCTTAGTGTAG
AAAGGCTGGTAACCTTCATGGCAGAGCCTCTTCAGAAGTTCAGTAAGTCCTTAACGATAA
GATGTTCAAGTACTGCAACTCTGAGGTCACTGGATGTAGGGCACCTTCCCACCCCGGAGC
ATCAGATAAATAGGATGGCTAAAAAACTCCTTTTTCTTCTACTTCAGGATTTTGGCTTTG
GAGAAACTGGGTGCTGTCTTCAACCAGGTGGCCTTCCCGCTGCAGTACACCCCCAGGAAG
TTCGTTATCCACCCCGAGAGCAACAACCTGATCATCATCGAGACAGACCACAATGCCTAC
ACCGAGGCCACCAAGGCCCAGAGGAAGCAGCAGATGGCAGAGGTAACTGCCCGGATCTCC
TTCATGAGAACCCAGGGAGGGGCCTGCTCTTTTGGGTCCCAGGACCCTTCTCCGTGCCAG
TATTAAGGCATTGGGTCTGTTTGGCTTCGAGTCTGTCATCGAGCCAGTCCTCTTGGCCAA
AGGCAGCTCTGCATAATCAATCCCCCAGCTGGAGCTGAGGTCTACATCCTCACGTCCGCA
ACTGCTAATTGTTCATCCTGGATGTCTGTGCATTTAGCTTTCGTTTTCCCATAAACACTC
TCCGGAAAGTGGCTTACATCTCCAAAATAGAAACAGTCCATTTAAATCTCAAACTAATTT
GTGACTGAGGAGGCAGAGCTCCTTCAAATGAAATGCTGTTCCTGACAAGGAGGTTTACAA
AGATTTATAGCCGGTACCTTCTTTGAGATTTGTCTGCTAGTTGATGTTTTTGCCCCTTAT
GTTACCTCCATAAGTGCTTGTCTCTGCTCTTCTGTTCCCACTAACAGAAGACTGTGTATG
TTCCTTTCCTTTCCCCCCTTTCCATCCGTAGTCTGTATTTTCTATCCTGGGTTCCAAGTC
CACATTTATGAATTTAGTGGATTTATGTTGGGCCTTAGGGTCCCAAGCATGTCAATTGCT
TTTCGAGTTCTTCTCTCTCTCTCCCCCTATCTCTTGTCCTCCATCTCCAACGCGCAGGCC
CCAAGCATCCTCAAAGCCCTCTCTAACCCTTTGCCTTTCTGTCGTGGATGGCAGGAAATG
GTGGAAGCGGCAGGAGAAGACGAGAGAGAACTAGCTGCAGAGATGGCTGCCGCCTTTCTG
AATGAAAACTTGCCGGAATCCATCTTTGGAGCCCCCAAGGCAGGGAACGGGCAGTGGGCC
TCAGTGGTCCGAGTGATGAACCCCATCCAGGGAAACACACTGGACCTGGTTCAGTTAGAG
CAGAACGAGGCTGCTTTTAGGTATGGAGGTGCTGGGGGCTCGAGAGGCTGAAGCGGGTGG
TGAGGGGGCAGAAGTTTCCAGGCTGTAGATTAAGGAGATTTCTGATCCCTCCGGCTTTGT
CCACAGTGTGGCTGTTTGCCGGTTCTCTAACACCGGTGATGACTGGTATGTCCTGGTGGG
GGTGGCCAAAGACCTCATCCTCAATCCCCGCTCTGTGGCTGGGGGTTTCGTCTACACCTA
CAAGCTGGTGAACAGTGGAGAGAAGCTTGAGTTTCTGCACAAGGTAAGAATCACTTCCCA
CTTCCCCATCCCAAGTGACACTGACCCTTCAGTTGCCACTTGCTTGTGAGTCAGACCTAC
AGGGCTTGTGAGAGGGTGCGATCAGAGGCCCTCACTCATGTCCCCTGTGAGCGACAGAGC
CGGGATTTCCCTACTTGCCCCTCTCCGCGGCCCAAAAGAGGCCTTTCAGGAAGAGCCAGA
CTGAATTGGCCCCTTCACTAGTCTAATTGAGTTCGCCTTATTCCAAGGCCAGCAATTCTG
AAGAATTTATCCTCTTGTCTGTCGCCCTCAAAGAAATATGAGCAGAGTCTTTCTTGCCTG
AGTTGATTGGAGTTGTGGGTATATCAGACGTGATCTGAATAGGTATTTTGTCCAGTTTCC
CTTCTCATTCTTAGGCGGGAACAGGCTAATTTTGGGGTACCAGTGATCCGGTCCGTGCTT
TGCGCCCTCTCCTATCCCATTCCCACTTCTCTGTGCCCAAGTCAGTGGCTGTTAGTTAGC
CAGCACTGCCTTGGTTTAAATAGGGCCAAATAGGTGACCTTTATACTCAGCCTACAGAAG
ACCCGATGTGGTCAGTACTGGTCAAGTGGAACACACAGGTTTCAGATCCTGTTCTGGGAT
AAGGGTGGAAGGAATGATGGGACTGATCTTTGGGCCAGGGTAGAATTTGCCCACCTGTGT
GCATGTGTGTGTTGTGTGTGTGCCCATCCTAAAAATGGTGTCCCCCTTCTCCCCATGTGC
AGACCCCAGTGGAGGAGGTTCCTGCTGCCATCGCTCCATTCCAGGGCCGGGTACTGATTG
GTGTGGGCAAGCTCCTGCGGGTGTACGACCTTGGGAAGAAGAAGTTGCTCCGCAAGTGTG
AGAACAAAGTAAGGGGCTAGAGTGAGTTTAAGGAGGCAGAGGGAGCAGGAGAGGGAAGGT
TACAGTAAATTGGAGACTAGAATGTAGGGGTTGGATTTGAGAGGTGAATGTGTTAACCTT
TCAGTCCCACCTTCCTCACTGGGTGCTCTGCCACAGCTTTCCTTCCATTCCCCAATGTTC
CTGGGGGCCTTGGGTAAGTAGGCTGTCTGTGGGGAAGTTAAAGCACTGCCAGTGACACCT
GCCTTCAAGCTGAGAGCCACTAGGGAACAGATTAGTGCTCACAATCAGTGGCATTTACTG
GACGTTTTCTGTGTGCAGAGCACTGTACTGAACGGTTGGGAGTGTCCGGTAAAATAGAGT
TGGTAGACGAGGTCCCTGCCCTCACAGCTGAGCCTGAACTCGAGCAAGAACCTGCTGCTT
TGGGAGAGGAGTTCTTTGTATCCAGGTCGGGGGGAGTTCCTCCAGCTGTAAAATGATCAG
CCCACCTCTGGTCATCCTACTGGCGAGCCTCCTCCTTATAGGAAGCTCAGAGTCTCCGGT
AAACATCCATGGCATTTCAAAACCAGTCCCATTCACAGAAAGCACAAGTTGGGGACAGGG
AGAGAGCGGAAGCCAGTGGGGCTTTCACACAACCAGGCTCCGGTTCTCCAGCCTTATCCC
GACTTATCGTCTCCCCTCTCCTCAGCACATCGCCAACTACATCTCGGGAATCCAGACCAT
CGGGCACCGCGTGATCGTGTCCGACGTCCAGGAGAGTTTCATCTGGGTCCGCTACAAGAG
GAACGAGAACCAGCTCATCATCTTCGCCGATGACACCTACCCCCGTTGGGTTACCACCGC
CAGCCTCCTGGACTACGACACGGTGGCTGGGGCCGACAAGTTTGGCAATATCTGCGTGGT
GAGTTGGTGGCATTAAGCGTCTGCGGGGCCTTGATCCTTTATTTAAATAAAACCCAGGCC
TAACAGCCAAATGCCTCCGAAAGCAGGAGTTTCTTCCTGAAAGGTTGGAGGGAGGACCAT
GGCCTATTCCTAGGTAGGGCAGTCTTGAAGAAGGACAGAAAAACCTCCACCTCGTGATAT
TTTTACCGTTCTGCTGGAATTCCTCCAGTTCTTCGTACATTTTGCCATTTCTAAAAGATC
GGTGATGGCTGTGAACATCAGTGGCCTTAATAACGGTGGTTTGGATTTTCAATTTTTCCT
AGAATTCTCAGTTGTAGGAGCGTGATTACTTTGGAGATCAACCTGCTCCCGTTTTCCTGC
TTGGAAATGAGTCACTCATCAGAGCAATTCCCACGCCTGCCGTGCCAAAAATGGGGCGGA
CTCTTCCGCGGCTGCCTACTGGCTAGTCGTCGTCATGCGTCTTTGTTCGGGGACAGGACA
GGACAAGACTGGGTTGAGGCGGGGACTGTACGCAGCCGGGCCCGGTGCGAATCTCCAGAC
TTCTGTTTCTGACTCCCTAACAGGTGAGGCTCCCGCCGAACACCAACGATGAAGTGGATG
AGGATCCGACCGGGAACAAGGCTCTGTGGGACCGTGGGCTGCTCAATGGGGCCTCTCAGA
AGGTAGCGCACCCCAATGCTCCTCCCTCCCCGCCCTGACCCGAGCATCCCTCTGCAGGGC
TGTGCTCTCCCAACATTTTCCTCATTGATTCAATAATCTGCGAATGTCCCTTCCCCATTC
ACAAGACCCTAGGGTTGGGCCCCCTCCAACCTCCGTCCCCAGGGAGTTTGCAAGCTAAGA
CCTTCCGTGCTATCGCCGGGGACCCGGATCCTCAAGGTGGGTGTGGAGATGGGAACCTAG
GCTTCTGGCCTTGTGCCCGAGGAGTAAGTTCTCTGCCCAGAGTCACTGTGACGTGTGGGT
GTTGGCTTTTCTCCAGCTGAGCCTTTTCTCCCAGTTTTTTTAATTGAACACCTGGTCCGT
TCCACTCCCATCAGTCAGCCCTGCTCCGCACGGGCCTGAGGGACCACCAGAAGCGTGGGC
TTTGCCTGGCTCAAAATCAGGCTGGACCCAGCCGGGTCCCAGCAGTTGTGAAGGGTCATC
TCCAATTCTCTATGTGTGAGAGTGGCAACAGCCCAGACTTAGTGCCTGAGCCCCGGAGGG
CCCTTATCAGTTTTAGACGACATGTCATTTAAAACCAGACCCTAGCCCCCCCATCTCCTG
AAGCGGAGACCAGGCCCCCAAGAGGTGGTCAATGCCCAAAGCCAGCTGTGCCGATAAGTT
GCCATCTCACTTTCTGGTTTGCAGGCTGAAGTGATCATGAACTACCACGTCGGGGAGACG
GTGCTTTCCTTACAGAAGACCACCCTGATCCCCGGAGGCTCTGAATCCCTCGTCTACACC
ACCCTGTCCGGGGGCATTGGGATTCTGGTGCCCTTCACGTCCCACGAGGTGAGTGTGCTC
TGTCTTCCTTGGGCTCTGCCACCTTCTCCCCACCCCACAGCTGTTTCTTTAAGTTAACAC
AGAACCTGTAAAGGACCTCCCTGCCCTAGGGGATTCAGTCACTTGTTCGAACGGGGGGTC
TCGGCCCTTATGGAGTGAGTGTCTGGAAAGTGGCCCGTGATGCTGGTTTGGTTCTAAAGT
TCAAGCAGTGGCTTCCTAGAGTGGGTTCTGAACCCAGAACCACACTTACTTTTCCTGACT
ACCCTGAGCTGGGTCAAAACAATATATGTCTCCAGAGTGGGAGAGGTGAGGTGGACTTCC
ATGTGGGGGCTCCCCCTGCCAGAAAAGCCCAAGTAAAAACCCCCCAGGCCTGCGTGCTGA
GCATAACAGAGGCTTCCTGGATCCCGTATGGAAGAAAACGGGCTGAGAGCTGCAGTTTCC
ACAAGTGGCTTCTCCTCCTCTGTCTGGATGTGATCCATTTTTATACCAACTCAGCGCACT
CTCATCTCCCTCGTAGTGTGTCCCACAACGTCCTTGCTGTGGACAGAAAGCGAGAGAGTG
TGTGTGTATACATGCGTGCCTGGAGGGGGAGCAGGCCAAAAGCAGCATCTTTTCTGCCGG
GTGCTTTCCGAGTCATACGCTCCCCTCCCACTGCTCAGTTGTTCTTCTCTTGTTTCTTTT
AGGACCACGACTTCTTTCAGCATGTGGAGATGCACCTACGGTCTGAACATCCCCCTCTCT
GTGGGCGGGACCACCTCAGCTTCCGCTCTTACTATTTCCCTGTCAAGGTGGGTCTGTGCT
CCTCCATCCAGTTTCCATCTGCTCTGAGAACAGATTTTCCCTTTCCTTGGGCCTCCCCAG
CATCATTTCCTGCCGCCCGTGGCCACCCTGTATTTATCCCCAGAGGAATGCTGAATAAGT
GAATTGGCAAGGGGAAGAACTTGGAACATGCTCGGTTTGCTGGGGGGCGAGGCCAGGGAT
CAGCTGTGCTCAAACCCCCTAACCCTCTCACTGAATTCCCACAAGAAACGATCCCCTGCG
GTTAGCCCAGCTGAAGTGACACGACTGTAAAATCGGAATGTTTTGGGTCACCGCTCTGGT
CCCTGCTTAGCTGAAATTCACTACCGTGGCCCCTTTTGGCAATCTGGATTGAACAACCTC
TGGGAGAGAGCAGTTTTCCCTGCTTCTCCTTCCTCTTGCTTTCTTCCAAATCAGTGGAGA
AGCGATGGTCTTTATGGCAGAACCCCTAACTTTTCCCTGTGCCCTCTTCCCTGTAGAATG
TGATAGATGGAGACCTCTGTGAGCAGTTCAACTCCATGGAGCCCAACAAGCAGAAGAACG
TATCTGAAGAACTGGACCGGACACCCCCCGAGGTGTCCAAGAAGCTGGAGGACATCCGCA
CCCGCTATGCCTTCTGAACCCTGGCCTGCGGGCCATTCCGGTTAAAGACTCTTGACTTCT
CACTAGGGTTGCGGAGATGCAGGTTTTGGTTCCTTTTCCTTTCCCCTGTGATAATCCTGC
TCCTATCCCCGGCAGCCGTTGAGCTCCTGAAAGGTTAAAACTATCGATGTTTTCCATACA
CTTTTTCACTTCCCTCAGGAAATCTGAATTTCCTGGCATGTGGACATCCCTCCTTCTTGG
ATTCCAAGTGCTGCAAAGACCTGTAAACCTAGCATTACAGGAAATCCTCCTTTTCAGAGA
GGAGAGCGAGGCACCCGGTGTGCCGTCTCACATCGCTGCCTTGGATTTGCAGAAACTTCC
GAGCGAAGCGGTTGACAGCAGTGGGGTTCCCGATGGTGGTTCCCCCCCCGCTTCCGCAGG
CGGTGATGCTTTTTCCCCCTGCTCCCCCTCCCCAAACCCCTCTCCAGTGCCCCGACTTTC
TTGCTGTCTCATCTGCTTTTGTACACACCCTTCACTTTTCACCAGTTTCCTTGTAAATAA
TAGTTTTGTACAATGTTAATGTTAAGTCGGAGAAGAGGAACACTGGGGCGGGATCATGGT
TGTAATGCAATACCAGTGAGCTCGGCCACAGAACATGAAATAAAAGCTTAAGTTTTTAAA
GTGGCTGGACTGCGTGCTCTTGATGTGATCCAGGAAGCAGAAGCCCGAGAAAACGGATTG
AATTTTTTGTGGCATCGAGCCTGGATCGGTTTCCACCTGCCCGTATGCATTCCCCTTCTT
GGCTGACTTTAAAGTTTCCTGTGGCCAGTAAGTTGGGACTATAATAGGTGGTCAGAGGGG
CAGAATGGCAATCAGTGCTACTTATTGAGCACTTACTCTGTGCAGAGCCTTGTACGGAGC
GCTTGGGAGAGTACAATACAGCAGAATTAGCAGACACATTCCCCGCCTGCAAAGTGTTTA
CAATGCAGAGGGGGAGACAACTGAGCCAAGTCGGGCAGGTGACACTACAAAATACAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1574, 8854..9022, 9958..10284, 11011..11183, 11303..11444, 12302..12414, 14273..14410, 16703..16806, 19124..19289, 20447..20542, 21784..21856, 27441..27592, 28079..28234, 29447..29602, 31069..31212, 31938..32060, 32366..32520, 33130..33304, 34914..35119, 35226..35382, 36122..36247, 36925..37137, 37703..37801, 38484..38627, 39302..39406, 39896..40036
8953..9022, 9958..10284, 11011..11183, 11303..11444, 12302..12414, 14273..14410, 16703..16806, 19124..19289, 20447..20542, 21784..21856, 27441..27592, 28079..28234, 29447..29602, 31069..31212, 31938..32060, 32366..32520, 33130..33304, 34914..35119, 35226..35382, 36122..36247, 36925..37137, 37703..37801, 38484..38627, 39302..39406, 39896..40036
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved