Ornithorhynchus_anatinus Locus RPL13A
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RPL13A
Ornithorhynchus_anatinus
RPL13A
Contig14108
SNORD33, SNORD33
2703..2786, 3208..3291
5258
CCGACTTGTTCATTCCAAGCGCTTAGTACAGTGCTCTGCACACGGTAAGCGCTCAATCA
ATACGATTGANNNNNNNNNNCATAGTAAGCGCTCAATAAATACTATTGAATGAATGAATG
TGCAGAGCACTGTACTAAGCGCTTCCATTCAATCGTATTTATCGAGCGCTTACCGTGTGC
AGATCACTATACTAAGCGCTTGCATTCAATCGTATTGAGCGCTTACCGCGTGCAGAGCAC
TGTACTAAGCGCTGGCATTCGATCGTATTTACCGAGCGCTTACCGCGTGCACAGCACTGT
ATTAAGCGCTTGCATTCAATCGCATATATTGAGCGCTTACCGCGTGCAGATCACTGTACT
AAGCGCTTGCATTCCATCGTATTTATTGAGCGCTTACCGCGTGCACAGCACTGTACTAAG
CGCTTGCATTCCATCGCCTTTATTGAGCGCTTACCGTGTGCAGAGCACCGTACTTGGTGC
TCGGGAGAAGACAAAACGACAATAAACAGACACATTCCCTAGCTTTCTGAGCCCACACTG
GTCTAAGTGCTTGGGAGAGGAAACTCAGGTCCTTCCAACTCCCAGGCCGGGGCTCTTTCC
ACTAAGCCTCGCGGCTTCTCTGTCACCGTCGTCCGCACTTAAAAATACGACAGTTGTTAT
TATCCTGGGTGTTGCAGGGGGCAGGGAGGGCGGGGCGGCGGAGCTTCCTGCGCCGCTTCC
GCCTGGGCCCGTCCGTACGGCCAGGGCTTGTACGGCGGCGGCCCACCTGAGCAATGGCGC
CCCCCATAGACCACGTGACGGCGCTCTAGCCTCCCCATTGGCTCCCCCTTCCGCGTGACC
CGCGCCGCCCCCCCGCGCCTCCCCCTCCGCCGAGGCGGCCGACCAATAGAGAGGCGAGCC
GGCTTCCCGCCCTCACGCGTCACTTCCGGCGGCCCCTGCGCCGGCGATAAGGAGACCCCG
GGGGGGCGGCGCGCTCCTTCTTTCGCAGGCGGCGGCCGAAGATGGCGGAAGGCCAGGTGG
GGCGCTCCGGGCTGGGCCGCGGGAGGACCGGCCGCGCGGGGATGGACGCGGGGCTCGTGG
GTCCTTGCGGCGCGGAGGGGGCGAGGGAGCAGCACCCTTGGCGAGGGGCCGCCGCGCCTC
CAGGACCCACGCGGTCTCGGCTATGAGCTGAGCGCCCCTCGAGGGCCCGGACCNNNNNNN
NNNTTGATTCCCTTTATTTGCTATTGTTTTAATGAGATGTTCTTCCCCTCGATTCTATTT
ATTGCCATTGTTCTAATAATAATAATATGCGTATTGGTTAAGCGCTTGCTATGTGCAGAG
CACTGTTCCAAGCGCTGGGGTAGACACAGGGGAATCAGGATGTCCCACCTGGGGCTCACA
GTCTTCATCCCCGTTTTACTGAGGTCCAGAGAAGTGAAGTGACTTGCCCACAGTCACCCA
GCTGACAAGTGGCAGAGCTGGGATTTGAACTCATGACCTCTGACTCCAAAGCCCAGGCGC
TTTCCACTGAGCCACGCTGCTTCTCTGTTCTTGTCTGGCCGTCTCCCCCGATTAGACTGT
GCGCCCGTCAAAGGGCAGGGACTGGCTCTAGCTGTTAGCCATTTGTCCATTCCAAGCGCT
TAGTAATAATAATGTTGGTATTTGTTAAGCGCTTACTATGTGCCCAGCACTGTTCTAAGC
GCTGGGGGAGATACAGGCGTAGTACAGTGCTCTGCACGTAGTAAGCGCTCAATAAATACT
ACCGAATGAATGAACTATGCCTTTCCGGTGGAATCCACCCAAAAGCCTCATCTGTTGGGC
GCCTGCTGTCTGCAGAGCACTGTGCTAAACGCTCCGCAAAGCACCCCATGCCAGAGTTCC
TTGCCCAGGAGTTGACACCTCGTTTAAGCGTCGTTGTCGGGCCGAAGGGCCCCACCGAGC
CATCAGGACTGGGAGCCCGTCGTTGGGCAGGGGTGGTCTCTATCTGTTGCTCCATTTTCC
ATTCCAAGCGCTTAGTACAGCGTTCTGCACAGTATGCGCGCAATAAGTGCAATTGAATGA
GTGAATGAGTATTTGCTGGGGGCTGTGTGCGGAGCACTGTGCTACTCCCTTGGGGAGTGA
GTCAGTCACTGGTATTTTCTGAGCAGTTACTGTGTGCAGAACGCTCTATTAAGGCCTTGG
GAGCGAGGCAATCACTGGTGGTTTTTGAGCGCTTACTGTGTGCAAAACACTCAGCTAAGA
CCTTGGGAGTGAGACAGCCACTGGTATTTTTTTGAGCTATCATTGTGCGGAACACACTAC
CAAGCCCTTGGGTGTGAGGCAATCACCGGTGTTTTTTGAGCGTTTACTGTGTGCAGAACA
GTCAATTGGGTGTGAATCAATCGATGGTTGGAGTTCTTAGTATGTGCAGAGCACTGTAGT
AAGCGCTTGGTAGAGTACAACAGAATTGGCAGGTACTTATCCTGCCCAAAGTGAGTTTAA
AGTGAACGACGCTGGTAGATGTGAGCCCTGTCCTGAAAGAGTTTGGTGTTTAGCAGAGGA
CACAGACCCTGAGACAACTTGCCGTGCGTGGGGGACCGAGTACGAAGAGGCCGCTGGCAT
GTTAAAATACACTCTCCCTTCCAGGTGCTGGTGATAGACGGCCGGGGCCACTTGCTGGGA
CGCCTGGCAGCCATTGTGGCAAAACAAGTGTTGCTGGGTAGGTGCCGCCCCCTCCCTGGA
CCCCCGGCCCGTGATGAGGAACATTCACCATCTTTCGTTCGAGTCTTGCGACCGTGAGAC
CGACTCCATGCACCGCTCTGAGGCCTCTTCCCCCAGCCCCCTCCCCTCTCTTTCCTTCTG
GGTCCCCATCGTCCCCATCCCTGGGGCTGGTGGGAAGGAGGAAGCTGAGGATCTGGGGCA
GGATCGCTAACCCTGTAAAACTCGCACCCTAGGACGCAAGGTGGTGGTGGTGAGATGCGA
AGGAATCAACATCTCCGGCAACTTCTACCGGAATAAGCGTGAGTAAAGGAGTCCGTCAGG
CCGGGCGAGGACGGCAGGTCGCCCGGGTCCCCTGACTCCTCCTTTCCGTCTTCTCCCAGT
GAAGTACCTGGCGTTCCTGAGGAAGCGGATGAACACCAACCCCTCCAGGGGCCCTTACCA
TTTCCGGGCCCCGAGCCGAATCTTCTGGCGGACAGTGAGAGGTGAGAGGGGACCTGGGCG
TGAGGAGGACGATGGTGGGGCGGGGACACCGGTCTGTGATGACGACTGTCCACTTTATTT
CGAGTCTCCCGACCTTGAGATCACATCTCCATGCACTACCATCTGAGACCGTCCAGCGGC
CGGGGAGGGATTGGGGCTCTGGGTGTGGGAGCCTGTTCCTCTGACCCCCATCTTCCCTTT
AGGGATGTTGCCCCACAAGACCAAACGTGGCCAGGCGGCCCTAGAGAGGCTCAAGGTGTT
CGACGGGATCCCCCCACCTTACGATAAGGTACCGGACCCTTGGACTCCCTCCCGCCCCTC
TGAGCCCCTTTCCCCTGGGGGTCAGTGATGCTGCACAATTACCTACATTGCTTGATTTTT
CCCCATGAGAACATAACTGTGACTGAGGCCCCGCCCCCCCAGACACCATCTCCCACTGAC
ATCCTTCTCTCTGACCCCATATCCTGACTCTGACCCACCCTTCCCTTTGCAGAGGAAGCG
CATGGTGGTCCCTGCTGCCCTCAAGGTGGTCCGGCTGAAGCCCACCCGCAAGGTGAGTTA
GCTCCAGGACCCTGGAAGGTGGGTCTACCTTGGTCAGGGCAGCCACTTGCCCTGGACCCC
TGGCACACACTGGGGAGGAGGTTGAGGGGGCTGACTCATGGGCAGCTGGAGGGCTTGGCC
CCCCTGAAGACTGGAAGTGACCGTGTAAGCTCTTAACTTTATCGACCCCCGGTCTCCTTC
TCAGTTTGCTTTCCTGGGGCGCCTGGCCCATGAGGTTGGCTGGAAGTACCAGGCCGTGAC
AGCCACTCTGGAGGAGAAGCGGAAGGAGAAGGCCAAACTGCACTACCGGCGCAAGAAGAA
GCAGACGGTGAGGCCTGTCGGAATAGGGGTGTTGGGAGCTTGGGGAGCCCCGGAGCCGGA
GGCTGGGAGGGAGTGGGTAGAGTTGACATGACTCTGAACTAACCTGCCTTCCCTCCTGCA
GAGGCTGCGCAAACAGGCGGAGAAAAACGTGGAGAGCAAGATCAGCAAGTACACAGAGGT
GCTGAAACAGCATGGTATCTTGGTCTAACTCTCCCAATAAACGGCTCTTTGGCTCACTCA
TCTGCCTACTGGATTGATGGGGGGTGACTTTCACCTGGATCATGCCAGGAGTTGGCCCTG
TAGGACACAGATGGGACAGATGGACCATTGGGTAGACCCTTATAGCTTTATGGTTGATGT
TGGCAAAGTCAGCCGGAGGAGGATTCCTTCGTCATCTTGTCTTTGTAAACTCCTTGTTAG
ACTGGAAGCTCTTTGAGAGTTCTGTCCTCTCTCCCAAGCGTGCTTCCAACTTAACAGGCG
CTCAGTGGATACCGTCAGTTGGCCGAACATTTCGAGTGATTGCCGGAAGAAATATTTTCA
AAGAGGTCACAAATGAAAGGGGTCAGACAGCCGACTTGAATTAAGGGGGAAAAAGAAAGG
CAGTTTAAGTGCTGATTTGGTTGATGGGTTTCACCCACGAAGGTCTCACTCCTACCCTGT
GGTGGGCGAAGTTCATTCAATCACTGACATTGAGTGCTTATTGTGTGCAGAGCAGTTTAT
TCATACAATCAATCCTATTTATTGAGTGCTTACTATGTGCAGGGCACTGTACTAAGCACC
TGGAATGTAGTAAGCACTTGAGAGAGCCCAGGTTAATTGTAGGTAGTGGCAATCCGTAAG
AAACTTGCAGTCTTCAACAAATGTAATTAAGCTATTTAGCAGTTTGGTCCATGATCATGC
AGCATGGGTCAGGGAGGGGTTTTATCGTGGTATTTAACTGCTTACTATGTGCCATTCACT
CTTACTAAAACCTGGGGTAGATTGAGGCTACTCAGATTGGACAGTCTGTGTCTCACATGG
GGCTCAGTCTTAATCCTCATTTTACACATAACAGAGAAGTGGAGTGATTGGCCCAGGGAC
ACACAGCAGACAAGTGGGAAAGCTGGAATTAGAGCCCAGGTCCTGATTTCCAGGCCCATG
CTCTAGCCCCTTACAGCTCTTTCTAAAAAAAATCCACACATCTCCAAAACCCGTGGCTTA
GCAATTGTGCCTAGATCAGTCTAGGCTGATCTTTGGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 2604..2675, 2911..2977, 3059..3160, 3362..3447, 3652..3711, 3904..4026, 4141..4258
1001..1015, 2604..2675, 2911..2977, 3059..3160, 3362..3447, 3652..3711, 3904..4026, 4141..4227
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved