Ornithorhynchus_anatinus Locus ENSOANG00000022654
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000022654
Ornithorhynchus_anatinus
ENSOANG00000022654
Contig14108
SNORD33, SNORD34
1084..1166, 1362..1436
2935
TTTAGGCAAGCTGGGGTGGCTACCACTTCCCTGGGCTTGGGCCTCTGGCGGTGTTGCTG
ACTGGAAGTGCATCAAGAGACTAGTTTAAATCCATTCCTATTCATTTACCACTTTAAACT
GTTGTATGCCAAGCACTGGGGTGGATTATCAGAGTGAGCAGTCTGCAAACGATGGGATCC
AAACCGCATTTTGTAGATGAGTTAACTCCCCTGGGCCTCAGTTAAGGTCACGCAGCAGGC
GAGTCCAGGTCTCGTGACTCGCAGGCCTGTCATGTGGGCCATGGAAGCCTGTCCAGGACA
GAGTGGTTTAGTAGAAAGGTGGGTATGTAGATGTGGGGTGATGAGGGGCACTGGGAGAAT
TGGGAATTTGGACCCCCTGAACAAGAACCAGTGGGAGAAAGGCTAGAGATGGATCTGATG
TAATTTGGCTTGGGTGCATCAATGCTCTGTACACATTAAGTACTCCATAAAGGAGTGGCA
GAGCCAGGATGAGAACCCAGGTCCTGGAGCTCAGGCCCATGCTCATTCCACTAGCCACGC
TGCTTCCTTGACCTTGATGGGTGGGTGGGGGCTGCCTACTAGGATACCTGTGGTGCTGCC
GGTGAAGGATTGCCCCGAGAGCTGTGGCTCAACCCTTGTCCCCTGCCCTTTCCAGGAGCT
GGCGATTGATGGGTGGGGCCGCCTGGCTGCCGTTGACTGACTGAACAGATGCTCCTGGGT
AAGTGTTGCCTGTGCCCTGGACCCCCTGTAGCAGTCCCCAACCCCCGGCCAGTGATGAGG
AACATTCACCATCTTTCGTTCGAGTCTCGCGACTGTGAGACCAACTCCATGCACCGCTCT
GAGGCCTCTCCTCTGCTCCCTAAATGTCTCCAGGCAGAAGTCCCTGGGTCTTGAGGGGGT
GGGGGCTGAGGGGCAGGGGCCAGAAGGACACTAAATAAGGTCAGCCATCCTTGTCTCCTA
GGGAGGTACCTGGTGTTCCTGAGGAACCGGATGGATATCATCCCGTCCAGAGGGCTGGAC
TGCTCTCGAACCCTGACCTGCATCTTCTGACAGATGGTGAGAAGGGGTCTGGGGTGGGGG
AACATGGGTCTGTGATGATGACTTTCACTTTATTTCGAGTCTCACGACCTTGAGATCACA
GCTCCATGCACTACCATCTGAGACCCCTGAGAGGGTGGGGTTGGGTTCTGGGGTGGGAGG
TGCTGGTCATCTGACCTCCATCTTTTTTCCTTAGGGATGCTGTCCCACAAGATCAAATGG
GGCCAGGTGGCCCTGGAGAGACTTGAGGTGTTGGAGATTCCCCTCTGCCCTACAAAAAGG
TACCAGACCCTTGTTGTCCCTTCCCTCTGTACTCCCTTCCCCAAGGGCCGATGATGCTGT
TCAATTACCTACATTGTTTGATTTTCCTGTGAGAAAACAGCTATATCTGAGGCCCCTAGG
GATACCAGCATCCATTGATGTCCCTGTCCTTTTCTGGCTCCCCTGCACCACCCCCCTGCC
AAAAAGGGTGGGGTGGAGGATCACTTGTCTTTTTAGGAGAGAATGACTAAGTGGCGTTAA
GTACTCACTCTGTCAAAACACTTAAATCCCCATTTTTCATGGAAACTGAGCCATAGAAGT
TAGGTGACTTGTTCCTCAGCAGATTAGTGGTCTTTCTGACTCCCAGGCTCGTGTTCTTTC
TGCTAAACCACAATGCTTTTTCAACTGGTTGTTTGACATCCTTTTCTCCACCTCACTAGG
ATGTGTGTGAAGAGAGCTCAGAAGACCATCTGCTAAAGGAGGATGGAATCCTGGTTTAAC
CTGCAATGAGATTGTCCGGCTTCTCACTTCTGGGTGTAGTCATTTTCACTAGATTGTTAG
CTCTTTGAGGGCAGAGATCAATCTTGTCTACTGTACTCTCCCATGTGAGCAATAAATGAA
GTTCGGCTTGAGAACAGGCTATCCTGGTGTGATTTCTCCAATTCCCAGGTCAGGGTGCCT
CCCCTCAAGTGAGGAAATGGGTTAGGCAGAGATAAAACATTGAACATGAAACAGCAAACT
GGTTCCCTCTCCACCTTCAACTTCTTAGAAACATGCAGGAGGTGGTATAAGGATTAGCTA
AAGCAGCATTAAATTAAATTGGAAGTGTATTTTGTACTGAAGATGGTCAAATCCATTTTG
GGGTTGAATTTGGAGAAGATGTCTGCTGTTATCTTGAAAGGGAAGCCGGCTGGGGAAATG
GGAGAGCTTTGGAGGCAAGGAGTTGTTACTGTTTTGGAAGCAGTAGCTTGACTTTTGCTC
TAATCTGGCACATGCTGATGGTTTGAGTTTAGTTTTTTTTCCCTAATCTGCACAGCTTCC
TGTGTGAAGGAATTTGTGCTATTAATGGCCTGTTAGGCAAGATTGTTTCCATTTCCTTTG
GTTTGGGAAATACTACATTCAGGCCTTTAGTGCCCCCTATTCCAGAATGGTTTATCTACT
CTAAACTTGGGATCAGGGAATACACCAAATCTAGTATTCTCCCAAGTGCTCAATAAAGGA
TTGATATAATTGGACCTCCCAGTCTATTCCAGGAAAAGGTTTTTCTACCTCTTAGACATC
TTGGCTCCTTTCTGTGGCTACTAATCAAAGCAGCAGCTTGGAGTTCAGGTAGTGGATTCC
TGCAGGAAAAGTTCATCGCAAACCTAAGGAAACAAGCATTCACTTTGCTTGGAGCTACAA
TAGATCAAAGCTACCAGACTGAACTGCAAAGGGATGGCATCAGACTCTAGGGTGGAGGGG
ATGGATTTTGAGACAAGACAGGAGATCTCTAGCAATACCGCTGGGAAAGATGGGCGATAA
GGGGCCGGGGAGATATTGAGATGGGAGATAGGGGCAGGGGAGGTTTTAGGGAGATCACAC
CTGATGGTTTTGACTTTCTCAAGGTAGGTGGCTAGATTTTGGTGGTGGGGGGCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1055, 1234..1318, 1739..1935
1236..1318, 1739..1775
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved