Ornithorhynchus_anatinus Locus ENSOANG00000022655
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000022655
Ornithorhynchus_anatinus
ENSOANG00000022655
Contig14108
SNORD35, SNORD33
1675..1763, 2862..2945
4093
TTATTATTATTAAAATGGAATTTTAATTCTTCCTCCAGTGTCTTCATTCATTTAATCAT
ATTGAGCGCTTGCTGTGTGCAGAGCACTGTACTAAGCGCTTGGGAAAGTACCATACAGTA
GAAAACAGTGACCTTAATAATAATAATGTTGGTATTTGTTAAGCGCTTACTATGTGCTGA
GCACTGTTATAAACACTGGGGTAGATACAGGGTAATCAGGTTGTCGCACCTGAGGCTCAC
AGTTAATCCCCATTTTACAGATGAGGTAACTGAGGCACAGTGAAGTGACTTGCCCACAGT
CACACAGCTGACAAGTGGCAGGGTCAGGAGTCGAACCCATGACCTCTGACTCCCAAGCCC
AGGCTCTTTCCACTGAGCCACGCTGCTGCTCCAAGTTAAGTAACTTGTTAAGTAAGCACT
TAACAAATACCAACATTATTATTGTTAAAATGGAATTTTAATTCTCCCTCCAGTGTCTTC
ATTTAATCATATCGAGCACTTGCTGGGTGCAGAGCACTGTACTAAGCGCTTGGGAAAGTA
CCATACAATAGAAAACAGTGACCTTCCCTGCCCACAACCATCTTACAGTTTGGGGGTGGG
GGACAGACGCCAATGCAAATAAATTTATTTATTTAGACCGTGAGCCTCATGTGGGTCATG
GACTGGGTCGAATCTGCTGATCTCTTAAATACCCCAGCGTTTAGCCCAGTGCCTGGCCCT
TGATAAGCCCTTGCAAATGCCCCATGACTAGTAGCATGGCCTATAAGGCTAACGTGAGGG
GAGGTCACGTGACCCGAGCCGTCATGGCCGCCCGCTGGAAAGCGTGGAGAGACCACGTGG
TGCCGGGCCGGGCAACGGCCTCCGCCCATACCTCGTCACGTGATCGACGTCCTTTCCGAC
CGTCCAATGGGAAGACGCGATGGCAACTACGTCACCTGGGCCCGCCCCTCCGAGTCGGCT
TAAAAGGCTCCGCGCAGGAGCGGGCGCCCTCTTTGTCCAAAGGCGGTCAGGCATGGAAGG
AGCCAGGTGAGGAGCTTGGGAGCGCTGCAGTCGGAAGGAGCTGGGCTAGACTCTGTTAGG
GAGGGCGGCTTCGTGCATTCAATAGTATTTATTGAGCGCTTCCTATGTGCAGAGCACTGT
ACTAAGCGCTTCTGTGGGAGGAGGGTGGGGGGCCCGAGAGGAAAGAGGTGCGAAGCGCGG
TCAGGCCCAGAGCGGGTTGGGTCGCGGACGACTTGGCGAAGGCCTGGAGCCCTCGGGTTT
GGGACTCAGAAGGTCATGGGTTCTAATTCCCATGCTTGTTTGCTTTGTGACCTTGGACAA
GTCGCTTCCCTGCCTCACTTGGAAAATGAGGATTGCCACGTGGGACAGGGACTGTCCAAG
CCGAGTTGCTTGTGCCCACCCCAGCTCCTACTGCAATGTGTGGCCCAAACTAAGCGTTTA
ATAAATACAATTATTATTAACTCACCGCTTCCCAACCTGGAGTCCGCGCAGTCCCGTATG
GGGTTACGGGGAGGCCCCTGGGCACGTGGCTTCCGGCCTTCCCTGACCTCTATCTTCTCC
TGCAGACCATCAAGGACATCTCCATCGACAAGAAGTGCCCGGGGACCACAAATGCATCCA
TCCGCGGCCTCTCCCTCTTTGGTGAGTGGCACTGAGGGCCTACCCTTCCCTTCCTGGCAG
ATGATGTCTATTCTCACGATGGTCTTCAGATTGCCCCCCGTGGGCGCTGGCGACACCGCC
AAACGGCTTAACTGATGCCAGGGGGACCAGGGGGTGGTGGTCATCGGGTCCGTGTGTAGA
GCACTCCCAAATGCTGTGCTTATAGTGTTTGAATGCTTACTATTTGCCAAAGATAGTACT
AAATGCTAGGGTGGACATATGATTTGGCCCCACGTGTTTGAAAGAGAAAAGGATACTAAA
TCTCCATTTTGAAAGGGACTTGCAAAATGCGGCTGCAGTTTTTCAGGAGATCACCCAGTG
TGATCGCCTCATTTCCCTCTGTTCTCACTCCCATGTGTGGTGTCCAAGATAAAATGCGCA
AGACCACCGATGTAATCAAAGCTGCGTAGAGAAAGGCCTCCACGAGAAGGAAAGTCTGCT
TTAGGCAAGCTGGGGTGGCTACCACTTCCCTGGGCTTGGGCCTCTGGCGGTGTTGCTGAC
TGGAAGTGCATCAAGAGACTAGTTTAAATCCATTCCTATTCATTTACCACTTTAAACTGT
TGTATGCCAAGCACTGGGGTGGATTATCAGAGTGAGCAGTCTGCAAACGATGGGATCCAA
ACCGCATTTTGTAGATGAGTTAACTCCCCTGGGCCTCAGTTAAGGTCACGCAGCAGGCGA
GTCCAGGTCTCGTGACTCGCAGGCCTGTCATGTGGGCCATGGAAGCCTGTCCAGGACAGA
GTGGTTTAGTAGAAAGGTGGGTATGTAGATGTGGGGTGATGAGGGGCACTGGGAGAATTG
GGAATTTGGACCCCCTGAACAAGAACCAGTGGGAGAAAGGCTAGAGATGGATCTGATGTA
ATTTGGCTTGGGTGCATCAATGCTCTGTACACATTAAGTACTCCATAAAGGAGTGGCAGA
GCCAGGATGAGAACCCAGGTCCTGGAGCTCAGGCCCATGCTCATTCCACTAGCCACGCTG
CTTCCTTGACCTTGATGGGTGGGTGGGGGCTGCCTACTAGGATACCTGTGGTGCTGCCGG
TGAAGGATTGCCCCGAGAGCTGTGGCTCAACCCTTGTCCCCTGCCCTTTCCAGGAGCTGG
CGATTGATGGGTGGGGCCGCCTGGCTGCCGTTGACTGACTGAACAGATGCTCCTGGGTAA
GTGTTGCCTGTGCCCTGGACCCCCTGTAGCAGTCCCCAACCCCCGGCCAGTGATGAGGAA
CATTCACCATCTTTCGTTCGAGTCTCGCGACTGTGAGACCAACTCCATGCACCGCTCTGA
GGCCTCTCCTCTGCTCCCTAAATGTCTCCAGGCAGAAGTCCCTGGGTCTTGAGGGGGTGG
GGGCTGAGGGGCAGGGGCCAGAAGGACACTAAATAAGGTCAGCCATCCTTGTCTCCTAGG
GAGGTACCTGGTGTTCCTGAGGAACCGGATGGATATCATCCCGTCCAGAGGGCTGGACTG
CTCTCGAACCCTGACCTGCATCTTCTGACAGATGGTGAGAAGGGGTCTGGGGTGGGGGAA
CATGGGTCTGTGATGATGACTTTCACTTTATTTCGAGTCTCACGACCTTGAGATCACAGC
TCCATGCACTACCATCTGAGACCCCTGAGAGGGTGGGGTTGGGTTCTGGGGTGGGAGGTG
CTGGTCATCTGACCTCCATCTTTTTTCCTTAGGGATGCTGTCCCACAAGATCAAATGGGG
CCAGGTGGCCCTGGAGAGACTTGAGGTGTTGGAGATTCCCCTCTGCCCTACAAAAAGGTA
CCAGACCCTTGTTGTCCCTTCCCTCTGTACTCCCTTCCCCAAGGGCCGATGATGCTGTTC
AATTACCTACATTGTTTGATTTTCCTGTGAGAAAACAGCTATATCTGAGGCCCCTAGGGA
TACCAGCATCCATTGATGTCCCTGTCCTTTTCTGGCTCCCCTGCACCACCCCCCTGCCAA
AAAGGGTGGGGTGGAGGATCACTTGTCTTTTTAGGAGAGAATGACTAAGTGGCGTTAAGT
ACTCACTCTGTCAAAACACTTAAATCCCCATTTTTCATGGAAACTGAGCCATAGAAGTTA
GGTGACTTGTTCCTCAGCAGATTAGTGGTCTTTCTGACTCCCAGGCTCGTGTTCTTTCTG
CTAAACCACAATGCTTTTTCAACTGGTTGTTTGACATCCTTTTCTCCACCTCACTAGGAT
GTGTGTGAAGAGAGCTCAGAAGACCATCTGCTAAAGGAGGATGGAATCCTGGTTTAACCT
GCAATGAGATTGTCCGGCTTCTCACTTCTGGGTGTAGTCATTTTCACTAGATTGTTAGCT
CTTTGAGGGCAGAGATCAATCTTGTCTACTGTACTCTCCCATGTGAGCAATAAATGAAGT
TCGGCTTGAGAACAGGCTATCCTGGTGTGATTTCTCCAATTCCCAGGTCAGGGTGCCTCC
CCTCAAGTGAGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1565..1640, 2753..2815, 3059..3093
1012..1025, 1565..1640, 2753..2797
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved