Ornithorhynchus_anatinus Locus RPS11
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RPS11
Ornithorhynchus_anatinus
RPS11
Contig14108
SNORD35
3141..3229
4988
ACCATAATAATAATAACACTAATCAGGGCTTAGAGAAGTTCCTGGCACATAGTAAGTAC
TTAATAAATACCATAATAATAATGACACTTATTATGTGTCACTAATGAGTGCTTAGAACA
GTGCCTGGCATATAGTAAGTGCTTAACAAATACCATAATAATAACAACACTAATCAGCGC
TTAGAACAGTTCCTGGCACATAGGTGCTTAATAAATACCATAATAATAACATTAATCAGT
GCTTAGAACAGTCTCTGGAACATAGTAGGTGCTTAATAAATACCATAATAATAATAACGA
CCCTAATAAGCCTCAGAACAGTTCTTGGAACATAGGTGTTTAATAAATATAATAATAATA
ATGACACTAATCAGCGCTTAGAACAGTTCCTGGCACATAGGTGCTTAATAAATATCAACA
TCAACATCATAATAAAGACACTAATAAGCGCTGAGAACCGTTTCTGGCACATAGTAGGTG
CTTAATAAATACCATAATAATAACACTACTAAATAGGGCTTAGAACAGTTCCTGGCACAT
AGTAGGTGCTTAATAAATACCATAATAATAATGACACTAATCAGGGCTCTAAATACCATA
ATAATAATAATAATGACACTAATCAGGGCTTAGAACAGTTCCTGGCACATAGTAGGTGCT
TAATAAATACCATAATAGTAATAACGACACTACTAAGCGCTTAGAACAGCGCCCGGCACA
TGGTAAGGGCCTAACAAGTACCGTAATAGTAGTAATGATCAGAGTCATTCCCAACACCGC
TCCCCAGAGGGCGCCATCTCGGGGCCGCCGGCGTGCCTCCGCGGGAAACCACGTGACCTC
CCCCCCCCGCCCCTCCCGCAACGACGTTCAGCGTCGCCGGGCGCGCGCGCCCCCTAGCGA
TCCCCGCGCGCGCCCGGGCGGTCACGTGATCCGGGCGCCTCTCTCTCCCCTCCCGAGCGG
CCTCCCGAGGCGGGGCGTTACGTCACTTCCGCCCGGCCCCTGCTCGGGGGATAAGACGAG
CCCGGCGGGGCGCGCGCCTCCCTTCCGCGCGGCGGCCGGCGAAGATGGCGGACATCCAGG
TGGAGGAGCGAGGGCCGGGAGGGAGGGAGGGAGGGAGGGAGGCCGGGACCGGCGGGAGCG
GGGCCGAAGCAAGGGTCTCCTCCCCCTCACGGGCGACCCCGCTTTTCCTCCTCCCTGCAG
ACGGAGCGCGCCTACCAGAAGCAGCCCACCATCTTCCAGAACAAGAAGCGGGTGCTGCTG
GGCGAGGGCGCCAAGGAGAAGCTCCCGCGCTACTACAAGAACATCGGCCTGGGCTTCAAG
ACCCCCAGGGAGGTGGGCTCGGAGAGGGGCCGGTCCTGGCCGCGGGGGCTTCTGGGTCAG
GGCCTCCCCGGACACGTGGGTCAGGCGGGCCCGCTTGGCCATTCCAAGCGCTCAGTACAG
TGCCCCGCCCGGCGTAAGCGCTCAGGAAATACTTCCGAATGAGTGGCTCGGGGGAAAGAG
AAGAAGAAGAAGAGAGGAAGAAGAAAATCGGTATTTGTTAAGCGCTTCCTATGTGCAGAG
CACTGTTGATAATAATGATGTTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAATACCCATCAGGATAAAATTAATTCATGGGATATATTACACAATTAATGTAAAG
AGTAATAAATAAAAATATGCCCAATATACACAAAGTGATGGCCCATCCCTCACGATGGTC
GTCCAAGCCCCCCCCGGTGAAACGGGCCGCTGCCAACTGGCTCAGCTGAAGCCGGGGGGG
GCGAGGTGCAGTTGTCGAAAAACCCCAGCGTTCTGCCCTCTTCTCCATCCCCCTGTGCCA
GCCCCTTTCCCTGATCTCTAACTTCTCCTGCAGGCCATCGAGGGCACCTACATCGACAAG
AAGTGTCCGTTCACCGGCAACGTGTCCATCCGCGGCCGCATCCTCTCCGGTGAGTGACTC
CGAGGGCCGCCCCTTCCCTCTGGCAGATGATGTCCATTCTCACGATGGTCTTCAGATTGC
CCCCCGTGGGCCCTGATGACACCGCCGAAAGGCTCAGCTGATGCCAGGGGGACCCGGAAG
GGCGGCCGGGGGAGGTGGGTCAGGTGGGAGGCTCAGAAAAGTAGGGCTGATTTTTGTTTT
GTGGGGAGAAGCAGCATGGCGTAGAGGGGAGAGCACGGGCCTGGAAGTCAGATGGTCATA
GGTTCTAATTCGACTACCCCACTTGTCTGCTGTGTGACCTTGTGCAAGTCACTTCTCTTC
AGTGTACCCTAGAGCACAGAACAGTGCTTGACATAGTAAGCACTTAACAAATACCATAAT
TGTTATTCTAAGAGTGTTGGCTCGCAGTAGCTCCTGGCTGTTCCGGGAATATTGGCCCCC
GGAAGCTCCTGGGGCCTTGCCAGGGAGTCTGTATTTACTGCTCTTTGTAGGCTGTAAGCT
CGTGTGGACAGAAAATATATCTGTTGTACTCTCCCAAGGGCTTAGGACAGTGCTCTGCAC
ACAGTAGGTACTCAGTAAATAGGACTGACTGACTGACTGACACACAAGAAACCTGAAGTC
TGGTACGTTAGTGGAGCCGGTTGGTTTTCCAAAGAAGGGCTCAGCATGGCAAGGATGTCT
CCGGGGGCTGCGCAGCGAAGCGCTTGAGACGACCCGCCCCCGACTTCGGGTTTCTGACTC
TTCCGCTGTCCCCAGGGGTGGTGACCAAGATGAAGATGCAGCGGACGATTGTGATCCGGC
GGGATTACCTGCACTACATCCGCAAGTACAACCGTTTCGAGAAACGCCACAAGAACATGA
GCGTCCACCTCTCGCCCTGCTTCAGGTGAGCCTGGGGCCAGTGGACGGCTGGTGGGCACA
ACCAGGGTTGTCTGGGTCCCCTCCCTCAGCGGTGAAACTAGCCAGCGTTGGCATTTGTAA
TCCTCTGTCCACCACTGCCTTTAGCTCATCTGCAAAATGGAGGTGAAGGCTGGGAGGCCC
ATGTGGGACCTGGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1078, 1200..1331, 3033..3108, 3855..3988
1064..1078, 1200..1331, 3033..3108, 3855..3988
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved