Myotis_lucifugus Locus RPL17
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus RPL17
Myotis_lucifugus
RPL17
scaffold_16
SNORD58, SNORD58, SNORD58, SNORD58
1705..1770, 2116..2180, 2547..2611, 5172..5235
7318
GGGAGAGGCAGGAATGCCTAGTGATGACAAACTTGGTCACTGGGGCTTGTCTTTGCTTC
CAGATGTCACTTTTGGGCTGTGGGACTTTGGGGGAAGTCCCTTAATTTCTCTGTGCCTCA
ACTTCATCATTTATAGAATAGAAGTAATAGTAATATCTCTTTCTACAGTTGTCCTAAGGG
TTAATGAAAGAAATGCATCTGATTGAAAAGTACTGAAATAGTATCTTGAAATTAGTAAGC
TTTTTATTTTTTTAAATATATTTTTTATTGATTTCAGAGAGGAAGAGAGAGGGAGAGAGA
GATAGAAACATCAATGATGAAAGAGAATCATTGATTGGCTGCCTCCTGCATGCCCCCTAC
TGGGGATGGAGCCTGCAACCCTCGAATGTGCCCTGATGGGGAATCTAACTGTGACCTCCT
GGTCATATAGGTCCATGTTCAACCACTGAGCTACGTCAACCAGGCCAGTTAGCACATTCT
TTACACAGGTTGCAGTACAATTGACTGGGTGATATTTTTTTGTTGTTAAATTTGTTGAGG
TGACATTGGTTAATAAAATTATATAGGTTTCAGGTGTAAAGTTCTGGAATGCATCTTCTG
TACATTGTACTGTGTGTTCACCACCCCAAGTCAAGAGACTGGGTGATATTCTCATCCTGT
GAATTTTTTTTATTACCATAATTACATTCCATCCTTTGCATTTTCTTAATTTTCCAATTA
ATTACAAATCACTTTCAGGGATACATGATCACATAATCAAACTTAACGAATGTTGAATAA
ATGTCTTGTCTATATGTAATAATACGTGATCCTGTCCTAGAACTACAAACCTGCTTTAGT
TAATATTTAAAATTCCTAACTTTATTTCTGGATCAAAAAAGGCAGAATTTTGAGACAGTC
CCTAATGAGGCATTTCGTTTTAAGGTCTTCTAAAACTTATTTCACACTCCCTTAGTCTTC
CCCCTCCCTCCTCCCCTCTTCAAATCTCGTTTCTTTGGGTGAGAATCTCGCGAGATATTG
AGTTCTCATGAAATCTCCCAAGAGCTTCCGCTCTTCCTCTTCCCCAAAGCGGCCATAGGT
GAGTTGCTCTTCGGCGTCTCTCTCCGAGAGTTGAATCCTCCAGTTATCACCGCCATCCTG
GCCTTGGGGGCGCCAATTTTGAGGCCCCTGAGTAGAGAACTCTCGCGGTTACTGATTTCT
CGCTGAAGGCAGTGTCCCCCTGTGCGGGGGGGAGTATCCGAGCGCCCGACTTGGCGCCCG
GGCCGTGCGGCCCGAAAAGGGGTACGATGGGAGGGGTTGGGGGCTTTGGGAGCCCGGGTA
GGCCGTGGTTGGTGCCGCCTCTTACTCCGGAGGTCCAGTGTCTCGCGGTGAGTGGCGGCC
TCAGAAAATTGGGGGGTTGGGGGGAGAATAGAGTCGGGTCGAAGCTTTCCTCGTTTTAGA
GGAGTCTTCCAAGTTAGCTGCGTGCCACGTTGGTGGCAGCACGGAAGCGTGGAAAGGCAG
CATCCGTGTGAAGCTGTGCGAGGGAAGGGGGTTTCTGCGGAGGGTGGCGGCTGGGGTCTG
CCGCCCCAGGGCGCCGTGTCCTTGCTCCCGAGGGAGCCCTCGTTGCACTGAAACGGGCTG
GTTGCCGCCCAGAGAGCAATGGGGCTGGGAAGGCCGTGCCGCCCGGCCTGCAGTCACCGG
GAGGCCGGAGGGGGAGAGAGCGTGGCTGCGATGATGGCACCTCTTAGGACACCTTTGGAT
TCACCGTGAAAACAGCGGTTCTCTGAGCAGCTGCTGGCGGCACTGAGTGCAGATTGAGGC
TGTAGGTGACTGTGCATCCGCGTGCTGACAGTTGCTCCGTCCTCCCTCCCAGGTGACCCC
TGAAGATGGTTCGCTATTCGCTAGACCCGGAAAACCCCACGAAATGTAAGTGATCAGCAC
TCAGTGCGTTTCTTATTTGGGGGTAAGAGAAATGAGACAACCCGCAGTTAACCGCAGTGC
CCTCTGTTTCTTAGCATGCAAATCAAGAGGCTCCAACCTCCGCGTTCACTTCAAGGTATG
TGAACCCTTTATGCTCTAAGAGTCCCTGTGGGTGGTGCAGTGAGCTTTTATTTAACACCA
TATCCTGAGGAGGCAGCTGCAGTGATGTCTTTCTTAGGACACCTTTGGATTGACCATGAA
AACCAATCAATTCTGAGCAGCCACCTTCTGGGTGTCGGTCATGAGTGTGTCGCGACTGTC
TTGATGTTGACACCGTGAGGATTCGAGAACTTCATGCTTGCTTTGAAAATGGTGCTGCCT
TCGCATGGTTAACCGCCGGTGTGTTTCCTGTTTAGAACACGCGTGAAACTGCCCAGGCCA
TCAAGGGCATGCACATTCGAAAGGCCACCAAGTACCTGAAGGACGTCACTCTGAAGAAGC
AGTGCGTGCCATTCCGCCGCTACAACGGCGGCGTTGGTAGGTGCGCCCAGGTGAGAATGG
AGGGTTGCTCTTTGAAAAGACGGGTTGTCAGGGAAAGTGACTGGAGGGGATTGGAATGGC
TAAGGTCTTCCATCAGGCTGTTTCTGGTTGCTGTGATGACAGTCTTAGGACACCTTTGGA
TTGACCGTGAAAAAAACCATGTTCTGAGCAACCTTGAAGTGAATGAAATAAATTGTGTGT
TTTTGTTTGTGATTTTGAGAGTATGTTTACTAAAGCAGGGAACAGCGAAATGGGAATGGC
TTAGGACAGAAGCAGCAACGGGAGAGACGAGGGGGTGCTGCTTTGCTCCCTAGAAATGTT
ACGGGAAAGGAAAGGAGTGAGCCAAGGCAGCGCTGTGGTCAGCTCACTGGAAAGACAACA
TGGGGCCATGGAGACAGGTTCAGGGTTTTGGTCCAGGACAAGCTGCTGCCGCCTATTGCT
TCCCTGGTTGCAAGTCTCCGTGGGGTCCCTTAGAGTTTAGGAGATGCTAGCCTGCAGGGG
AAGAAGAGGGAGAAGGAAAAGAGGAAAGGTGTGGGTATGCTCCCAGGTGGGAGAGCTGCC
ATAAATTAATCATGGTTGTACATTTTATTTAAATTGGAACTAACTAATAGCCTGCCTTTG
TTTTCTTTAGGCAAAACAGTGGGGCTGGACACAGGGTCGGTGGCCCAAAAAGAGTGCTGA
ATTTTTGCTGCACATGCTTAAAAATGCCGAGAGCAATGCTGAACTTAAGGTACCCAAAGC
ATTAACACCTTTATATGTATCCAGCTTAGATGGTTGTTCAGTTAATGTTGTTCAGACTTA
CTATACAAACAATAAGACCCTATTGCAAAGAAACAAATATAGTTATCAAAGTGGTTGCTT
TAGTAATGGTTAATGTGGTTTATTGCCAACACTTTTAAAAAATATATTTTTAAAATATAT
TTTAAAAGGAAGGGGGCAGGGGAGAGAGAAACATCAATGATGAGAATTATTGATCAGCTG
CCTCCTCCACAACCCACATCGGGGATTGAGCCTGCAACCTGGGCATATGCCCTGACCTGG
AATCAAACCATAACCTCTTGGTTCATAGATCGATGCTCAACCACTGAGCCACGCCGGCCA
GGCTATTGCCTACAATCTTAATGGAGAGATGTTAAATTTCATTTAGAAGTTAAAACTAAA
CAAAATAGGTTTGTCTATTCCCCTTTAGCATTTGGAAATCTGGGCCAGAATTAAAAATGT
GGGTCTCTGGCTATAACCCCCTTTTATTTATATCTATAATAATAAAAGTGTAATATGCTA
ATCAGACCAGACATCCATCCTTCCGGACAAAGCCAAAGCCGCAGCGGGCAGGGGGCTGAA
GCAGAGGCCCTTGCTCAATTTCATGTGTCAGGCCTCTAGTATATATACACTGAGTGGCCA
GATTATTATGTCCACCCCATCAGTACAATGAAGTGAATTAGTTAGGCAAATAATAATAAT
AAAACCTTAAGAGTATTTGCTTAGGAAATTTTCAATATTCAGTATTTTTGGAAGTGTCAA
TGAAGTACTGATGGGGTGGTCATAATAATCTGGCCACTCAGTGCATATTTACTAGAGGCC
CAGTGCATGCGTTCGTGTACCAGTGGGGTCCCTCAGCCTGGCCTGCGGGGATCAGACTAA
AATTGGCTCACCGACAATCCCTCGATCCCCCAGGGGTCCCAGAGTGGAAGAGGGCACCCT
GCAAAGTTGCTGTCAATCAGCAGCCCCTGCATCAAGCGTCTGCCCCCTGGTGGTCAGTGC
GTGTCATAGCTAGGTTGCTTAGCCGCTTATCTTAGCCTTTTTTTATATTTATATATAGGT
TTTTAGAGAGGAACATCACTGTAAGAGTGGAACATGGGCCAAGGCCGGTTTGGCTCAGTG
GATAGAGCGTCGGCCTGCGGACTGAAGGGTCCCAGGTTCGATTCCGGTCAAGGGCATGTA
CCTGGGTTGCGGGCACATCCCCAGTGGGAGATGTGCAGGAGGCAGCTGGTCGGTGTTTCT
CTCTCTCTCTCCCTTCCTCTCTGTAAAAAAATCAATAAAATATATTTAAAAAAAAAAAAA
AAGAGTGGAACATGGATCCCTGTTGCCTCTTGCACACCCCCACCTGGGATTGGGCCCAAA
ACCCGGGCATGTGCCCTGACCATGAATCAAACTGGCAACCTTTTGGTGCACAGGACAATA
CCCAACCAAATAAGCCACACCAGCCAGGGCTGGTTGTATAATTCTTTCAGCTGCTAAGCC
ATGCTGCCAAAGTCTTGTTTATCATCAAAGCTTAGAAATTAACACTACTCTTGGTGATCT
TTAACATGCACTTAGCATAGCACTGAGTTTTGGTAGTTAGGTTTAATTTAAGGAAGGACA
TTTAGAACCAAGTTTAAAGAAACTGCTTAAACTGATCCTCGGCTTAAATTCTTAAGGATT
GCTTTTCAAAAAAGTTCGTTAAGGCAGGAACTTAATTTTCCATGGATGGTGTTAAGATAT
GTTCCTTCTCCCTTCTTCCCAGGGTTTAGATGTAGACTCTCTGGTCATTGAGCACATTCA
GGTGAACAAAGCTCCCAAGATGCGGCGTAGAACCTACAGAGCTCATGGGCGGATTAACCC
CTACATGAGCTCTCCCTGCCACATTGAGATGATCCTCACTGAAAAGGAGCAGATTGTTCC
TAAACCAGAAGAGGAGGTTGCACAGAAGAAAAAGGTAAGTTTCTTAGTCTTTGCTCAGTT
TTGGTTGTGTGGTTGCTGTGATGACTAACTTAGGACACCTTTGGAATAACCATGAAAGGA
AACTATTCTGAGCAACCAGCAACCTTGTATTTTATTTTTACTTTCGTGGATCTCATTTGT
TTCTTGATTGATACTGAATAGTAACTTTATACCATTCGGTACATCAGAACTGTGATTGTC
TGCTGATAGTCCCTCCTACATGTCCGTTGCCACTTCCAAAAATGCCCCTCAGATCTGATA
AGCCTATATTCAGTAAATGATGACAAGTCAGTGTTGTTTTTGAGAATTGCCTCATACCAT
TGTAAAGTTTAAGGTGTGCCACATGATGGCTTGATTTAAGTATACTGTGAAATGATTACC
ACAGTGGGTTCTCCTAGATACAGTAAAAATAAGAAAGAGGGGGGGGAGGGTATGGTTAAG
AATTCTTACGGTTTCTCTTCCTATCAACTTTCCTATGTATCATACAGCATTGTTAGCTAG
TCATTCAGTTGGGTAGGCCAGGAAACTGGGAGTGATTCTGAAATCTTCCCTTCACACCCA
ATAGACTTTTTGTATTGATATTGTCACTTAAATATCCTGTCATTAGCTCGTGTCACTGTC
TTCAGTGAAAATCAATTTAAACTCCTTCCCTGATTAGTCATACCACATCTCTATGCCAAA
GGACTCTTTCCTTTTATGTTTTTTAAAATATATTTTTATTGATTGCAGAGAGGAAGGGGG
AGAGAGAGAGAGAAAGATAGAAACATCAATGAGAGAGAATCATTGATCTGTTGCCTCCTG
CACAACCCCCTACTGGGGATTGAGCTCACAAGCCACGCATGTGTCCTTGACCGGAATCAA
ACCTTGGGACCCTTCAGTCTACAGACCAACGTTCTGTCCACTGAGCCAAACCAGCTAGAG
CCCTTTTATGTTGATGTTTCCAGTTCTTTCACTGAAGCTAAGACCTCTTTTTAATAAGAT
GTAGTGTGGATGTTTTTTCAGGAAATTTAACAGTCCTTTTCATTTTCTTTCCCCAGATAT
CTCAGAAGAAACTGAAGAAACAAAAACTTATGGCCCGGGAGTAAATTCAGCATAAAATAA
ATCTAAGTAAAAGTAAAAGCAGCATGTTGGTTGTCTTTATTACTAAATATATTTCAAGTG
ATAAAACAAGTTTTCTGATAAGAACTTAAAAATAGATTATTCTGTTCTGTCATTAATTTG
GGTCATAAACATGCTGTTTTGAAAGTCTTGCTGCTTTTTTGCATACGATGGGATTAAAAC
ATGGAGTTCGGAAATTTTTTTCCAGCCACTTCATTGAGATTTAACACCAGTTCACCACAG
TGCAGTGGATCTTAGTATACTGTTATGAATCTATCACTAAAATCACTTTCAGGACATTGT
AATCACCCCAGAGAGGAACCTGGGCAGTGGTTTAGCTGTTACTCCCAGCCCTAGGGAACT
ACTTAGCTGTAGATAGGCCTGTTGACATCTCAAGAAACATCACAGGATGTGTGGCCCACT
GGCTCTGGTTTTTGACAGTACTTTCAGGGTTCATCCATGTATTGTACTTGATGTATAATT
TATATTTATTGAACATTTGGGTCTTAAGCTATTGCAAATAGTGCTGCTGTGCACCTTTGT
AGGTTTTTGGATGGGCATGCTCTAGTTTCTCTTGTGTATGTGCCAAGAGTGTAATTGCCC
AGTCATGGTAACAGCCGGATCCGGCCCGTTTGAAATGAATAAAACTAAAAAAAAAAAAAA
AAGACCGTACCCTTTTATGTAATGATGTTTACTTTGAATTTATATTAGTTCACACAAACA
CTCCATCCATGCTTTTGTTCCAGGCCTCCGGTCCAGTTTAAGAACCCATTGTGGCCCTCG
AGTCAAAAAGTTTGCCCACCCCTGGCCAAGAGTGTAATTGCCCAGTCATGGTAACAGCCT
GACTACAATTGTGCCATTTACAATACCCCTTAGAGAGGGTCCGGGTTTTCTCCACGTCTT
CAACACTGACCTTAGGTGGAAGTGAAGTGGTAGCCATTTCTCTTAAATAGCCAATTAAGG
TTGACAGTCCACCCTCCCCTCGAATGGAAGTCCCTTTCAGATCCGGGAGAGGGTGGTTGT
AGTCACACATGCATGGAAAACAAGTGAAGTAGCCGCCCCTGCGGTGGGGATCCATTGGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1077, 1852..1904, 1994..2034, 2315..2449, 3070..3168, 4942..5133, 6176..6318
1865..1904, 1994..2034, 2315..2449, 3070..3168, 4942..5133, 6176..6223
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved