Myotis_lucifugus Locus Mono:496:SNORA74
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:496:SNORA74
Myotis_lucifugus
Mono:496:SNORA74
scaffold_4370
SNORA74
214..414
1414
CCCCATGCTAGACTTATCAGGGGATCACTCTATATGTTATATTAATGTCAAACCACTAT
TATATACACTTGAAACTAATATTGAATGTCATCTCTAATTGAAAAAAATTAAATTAGTAA
AATAATTTTTAATAAAAATAAAAAACCAAATCAGAGTGATCTTTAAAAAATATAAATCAG
ATCATTACAGTCTGTGCCTAAAAGCCTTAAGTGCTCCAGCAGGGGTCAGCTCTCCAGACA
GCATCATGCCTGTGAGGGTGTTACACTGCTGGGGAGGAATGCCCTGTCTTCTTCCTCCAG
TTGCCCATTCACTGTTCTGGTGACGTGTGGCACTGGTGCAGGGCAGAACTGTGCTTCCAT
GAGAGTGAGCTAAGCATCACTTTGGTTGCTTTGTTCTAGTGAAGGAGCAAACAAAAAAAA
ACATTTAAAAAAAATCTTAATGGTTCTAATAGCATTTCAACCCACCCAAGGGACCTTTAA
CTGCCCTTTTCTGTCCCCCCAACCCCGGCCAGCCTGGCTCACCCAGCCTTGAGGAAAGAA
GGCAGGGTTGGTGCTGCTCAGGCTGCCAGTGAGCATGCATCTGGTCAGACATCTGAAGAA
CTGCAGTTATCTTAGGATGGAAATGGAGGGTCGCATCTGCTAGGATCAGGCACACAGGAG
GGGACTAAACTGTGTGGGAAATAGTGACAGGTTCAGAGCTGCGTGACCCCACCATGCTCT
CCCTCTCCAGCTGCATCCCAGGGGACCATGAATAGTCCACAACAGGAAGCAGCCCCATGG
CCTCTGACAACCCACAGACCCTCTGCAAAGCCCTTGAGCTCACATGGCTGATGTCAGACT
ATCCCTGATACCCTAAGTACTGCAATGTGGCCTGTTTGGACCTTTGAATTCTACTCTTAC
AAGAAAGCCAGGTCTGAGCCTCTTGTCCACTGCTCAAAGGTGTGTGAGGACCCAGTAGGG
GGCAGCTAGACCTGCTATACCATGGGGCATTTGCTGAGTGGCCTCAGTCCCTGCACAGTC
ACCAAGATTAAGCCTGTATCAATCTGGTGACCACCGCTGGCCCCTTCGTGGAGACACACT
GAGAAACTACCTCATGCAACTTGAGTCCCTCCCGAGGCTCTTTGAGTGACCGAGACTAAC
AGGCACCCACATGTGGAGGTGGGCAGAGGCAGAACACAGGGGGCCTTGGGACTTTTGCTG
ACATTCCCTCATCCAAGTGCAGGTAAAAGGCAGACTTGGTGCACTGCTTGGACCTTCCTG
CTCTTACTCTGAACCAGCAGAGGCAGCCATACACTGTGAATTGTTTTCAGCTCCAAATAG
AATTCACAAGGCCAGTCAGAGGAAGCATCTGACATTGGCCAGCACCAGAGTCTCTCTCAT
TTGCCTCTAGGACGACCCACACAGTGGCCAACTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved