Myotis_lucifugus Locus Mono:495:SNORA74
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:495:SNORA74
Myotis_lucifugus
Mono:495:SNORA74
scaffold_939
SNORA74
1001..1200
2200
CCCCTCTGCCTTTTCCCTCCATGGAGGGTCTTCTGTTTCCCTGGCCTGAGCCCTCACTC
ACAGGCATCTGAGGGGCATATGCTCTGGTCTGTCCAGTGTTCATCTCTCCTGCCTCCAGG
CTGTGGCCACTGTCTGTACCTGAAGCACATTCTCACCCTCTTCATCTGTCTAAATCCTAC
CTGAGCCCTCAAGACACATCTCAAATATCATTTCAAATGTCAAATCACAAGCAGGGGAAG
GGGGGTGGGGGGTGGGGGTGGGGGTGAAGGGTGGGAGGTAGGGGGTGGGGGTTGGGGGCT
GGTGGGTGGTGGGTGGAGGCTGTGTCATATGGGGTGTGGGATGTGGGGTGGCAGGTGGGA
GTAGGGGGTAAGAGGGGTATGGGGGTGAGGGGTATTATTGGGGTGTAGGGGCAGGCTGGT
GGGAGGTGGCGGGTGAGGACTGGGGGTGTGGCGTGTGGGTAGCAGGAGGGGCTGGTGGGT
GTGGGGTGGCAGGTGGGGGTGGCATGTTTGGAGTGGTGATAGGGTTGGCGGGTGAAGGGT
AGGTGGAGGAAGAAGAGGGCATAGGGGCGATTAATGGTGATGGAAGGAGACTTGACTTGA
AGGCAGTGAGCACACAATGCGATATACAAATGATGCATTATAGAATTGCACACCTGACCT
ATGCAATTTTATTAATGAATGTCACCCAAATAAGTTTGATTAAAATAAATAAAAGGTGGG
TCTATTGAGGGTGATTAGGTTATGAGGGTGGAGCCCTCATGAATTTCATTAATACCCTTT
TAAAAGATCCCCCATGCTATACTTATCAGGGGTTCACTCTATATGTCATATTAATGTCAA
ACCACTATTATATACACTTGAAACTAATATTGAATGTCATCTCTAATATAAAAAATTAAA
TTAGTAAAATAATTTTTAATAAAAATAAAAATGCAAATCAGAGTGATCTTTAAAAAATAT
AAATCAGATCATTACACTCTGTGCCTAAAAGCCTTAAGCTCTCCAGCAGGGGTCAGCTCT
CCAGACAGCATCATGCCTGTGAGGGTGTTACACTGCTGGGGAGGAATGCCCTGTCTTCTT
CCTCCAGTTGCCCCTTCACTGCTCTGGTGACCTGTGGCACTGGTGCAGGCAGAACTGTGC
TTCTATGAGAGTGAGCTAAGCATCACTTTGGTTGCTTTGTTCTAATGAAGGAGCAGACAC
AGGAAAAATATTTTTAAAAATCTTAATGGTTCTAATAGCATTTCAACCCACCCAAGGGCC
CTTTATCTGCCCTTCCCTGCACCCCAGCCAGCCTGGCTCACCCAGCTTAAGGAAAGAAGG
CAGGGATGGTGCTGCCCATGCAGCCAGTGAACATGCATCTGGTCAGACATCCGAAGAGAA
CTGCAGTTATCTTAGGATGGAAATGGAGGGATGCATCTGTGAGGATCAGGTACACACCAG
AGGACTAAACTTTTTGTGACACAGTGATGGGATCAGAGCTGCAGGACATCACCATCATCT
CACTCTCCAGCTGCATCCCAGGGGACCATGAATCACCCACAACAAGAAGCAGCTCCATGG
CCTCGGACAACCCTCTGACCCTCTGCAAAGTACTTGAGCTCACATGGCTGATCTCAGAAA
CCTTATGAATCCCAGAAATCTTAAACCCTACGAAGTAGCCTGTTTTGACATTCTAGTTCT
ATTCCTACAAAGAAAGCCAGGCCTGGGTCTTTTGTAGCCTTCTCAAAGGTGTGTGAGACC
CAGTAGGTGGAAGCTAGACCTGGTATACCCTGGAACATTTGCTGAATGCCCTCAAACCCA
GCACAGACAACAAGTTTGAACCTGCATCAATCTGGTGAACACCGTTCACTCTACCTGAGA
ACTCACTGAGAAGTTACCTCATGCTACTTGAATACCTCCAAGAGGCTCTTTCAGTGACTG
AGCTTAACAGGCACATGGCAGATGCAGGCAGGCAGAGGCAGATCTAAGGGTTGTCTTGGG
TCTTTTGCTGAACTTCCCCCAGTCCCACTGCAGGTAAAAGTCAGCCTTGGTGCACTGCTT
GGACCTTCCTGAACTCACTCTGACCCAGCAGAGGCAGCCGCAAACTGAATTGCTCTGCAG
CTCCAAATAGAATGCCCAGGGCCAGTCACAGAAAGCATCTGAAATTGGCCGGCACCAGAG
TCCCTCCCAGGACAAACACACAGTGGCCAACTTTAGACGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved