Myotis_lucifugus Locus RPL13A
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus RPL13A
Myotis_lucifugus
RPL13A
scaffold_1432
SNORD32, SNORD33, SNORD34, SNORD35
1492..1574, 2241..2325, 2521..2590, 2782..2867
4336
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
gttttttcccccccattgcttttgtttgatagacctcgaaaggctagtaacggggggccc
caaaagggcccgcggccccagacgacgctctccataaaacacataaattttttccttttt
cacccggcgctgcgtagaaggggggggggggtagggggccctggtgagcttcacgcgacg
ggcctgtggttacggaaaaccacgctgggagccagacaagtgggagtcccctgagcgtgc
ccggcccagtttgcattgtgttttctgtaacaatgtttctgaggcagatgttatcctcat
cttccaggtgaggaggtggaagcgcggagagctgcagatctttgccccaagtcacagtgt
caggaagtctggctttagattctgtacctttctgccttccaacagtcaccacgtatataa
ccagcactccatagagtggggactttgacccttgatgaagaagctataatctgggcataa
aaactcctgcccttcaagcggctgagatgtgagaggagttcttaccccgctcattgaaat
caccatttgctattttggcctcgtctgtgaagtgagccttgggtcctaggtctggtgcct
ggataggaggcgccctgggggataaggtgtaacggagacaatgaacagtggttgcttggg
gtggggagacgggaagttcggggtgactaagccctcctctgtcttcaacaggtcctggtg
cttgatggccgaggccatctcctgggccgcctggcggccatcgtggccaagcaggtactg
ctgggtaagtctgccctgtgcccacagccctccagacctgaggtcagaccggcagtccgt
gatgaggagcaatcaccatctttcgtttgagtctcacgaccatgagatcaaccccatgca
ccgctctgagacctgccagccactccctcccctggaggtgggggctctggggttaacatt
ttctgttgggcaaattcatttaaccgtgaatgtagctctgccagttactgctctgtgact
ggggccaggggttcccttgctgggcccttggctgtcttgcccttgtggtccagtcctgac
ctgggaggatcgccctttggttcctcagcagtaactgggcagggggtggctgcttggcct
gagccccccgcgagtgcctcactgtcctcctctctaggccgcaaggtggtggttgtgcgc
tgtgagggcatcaacatttctggcaatttctacagaaacaagtgtaagttgtggcatggg
agaaggacgagagagggttgatgtgtgaggtgctcagactccatagaccctgaaagcgat
ccccccagtggttggggggggctggtttgagttccagaataggcccttggaagtgggtgt
gggaagaagctggtgtttccctggggactatacagcctcacgctctcccctctcagtgaa
gtacctggccttcctgcgcaaacggatgaacaccaacccgtcccgcggcccttaccactt
ccgagcccccagccgcatcttttggcggacggtgcgaggtgagctgggcctgaggaccga
ccgcaggtggggatggggcgggtggcccgtgatgaggacttctcccactcaagttcgagt
ttcccaaccatgagatgactccacatgcactaccatctgaggccaccggtctgcctgcct
ggtgatggggtcttggcgagcccctctgagcagggttgctgtccctctgcccgcaggcat
gctgccccacaagaccaagcgaggccaggccgccttggaccgcctcaaggtgtttgacgg
gatcccaccgccctatgacaaggtaagcgagaccgggccgtcccaggatccctgtgtctg
gcgtgtccgtgatgatccacgattacctacattgtttgaacctcatgagaacagcactgg
ctgagacaccggccccagccagccttcttccctgtctgtccctcactccaggtccctaag
cccctctccttctctaacagaaaaagcgaatggtggttcccgccgccctcaaggttgtgc
gtctgaagcctacccggaaggtgagttccgggttacgtggagcagactgacatggggggc
tgaacgtggtgtccccgagactggcagatgatggttttttctcacgatggtctgcggatg
ccacctgggcactgccgaaaatgccaatggcttagctgatgccaggaggagcagggagcc
ccttacacggggggcggggggggtgtcttctgctttaaaattggatcctttgagaagtct
tccgctccccaatctaggctcccatttatttacaatttcatttccccccaccccagtttg
cctaccttgggcgcctggctcatgaggttggctggaagtaccaggccgtcacagccaccc
tggaggagaagaggaaggagaaggccaagatgcattaccgcaagaaaaagcagctcatgg
tgagggcaggggcaccgcacacctgggcagtgggacctgggtccctgggaaggggtggtc
acaggcagcagccactgaccacagcctgttctaaccccacagaggctacggaaacaggcc
gaaaagaacgtggagacgaaaattaacaaattcacagaggtcctcaagacccatggactc
ctggtctgagcccaataaaattgactgttattcctcatgcttggcctggcctgcccttcc
tccatcgccgccctaggatgtggggaaccccaggggctgttccggggccacaggcacctt
accttgggccttagaaggctggggacacagaagggaccttagccactgctatttaagaaa
ggccttttaaaagcttggcatggccctgtcagttgggcataatttgcctgtgacctactc
agagttttaggaaatgagcagctggaacagctggttccctttcaggatttataagctgga
aaactctctaaacttcccacatgatactagaccgcagctgttaggatgtagcaaatgctt
gggggcaggtggacctggtgttgtacagagggatttacagatgcagacaggacggcagcc
agcttcaggcatcgcacttgcacgttcctgtaccttgtgatcagaaaatgaataaattat
ttttaaagaaatttggcgtctttgccgtgtgtgtctgcaacggaggcaggcccttggggg
ctggccacagataaatggctaaattcctaacccgttagtgcatgggagaattaaccttta
gaggtcaacctgccaacaatttactcaaaccattgtctggtgcctggtgccccaattgac
agagccgtctacactcttcagctgcagggtgtggaactgccccgttttagagccaccccc
tttgtgggacgagggctacttcactcgggtcatctgccacacttgctttgggggaagaaa
tgggcaagaaacattttgcatgtgtggggtgtttacaatggaagtaggcatgttagatct
gcctgggtgcggacctgaaagggtagatgaacaggtggaagccctcaggtcacctttgat
cacctccatcaggcccgtctccctttcactgatgaggtttaggaggagtcacctgatcca
gagccaaacccagaattccacacaagccctcgggtttgatgaaggcaaatctgtcctgga
aaagaagctgaattcat
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1230, 1371..1443, 1837..1902, 2096..2197, 2396..2481, 2660..2719, 2996..3118, 3222..3336
2125..2197, 2396..2481, 2660..2719, 2996..3118, 3222..3308
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved