Myotis_lucifugus Locus EP400
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus EP400
Myotis_lucifugus
EP400
scaffold_1239
SNORA49
37619..37749
56585
AACTGTCATCCGTAGCTTCTGATTTCACACAGATGTGTGTGCCAGCAGGGTGTGGAGCG
GTGAGATCATTCATACGTATGTGCGTTGCACCTCTGTCCGTTTTTTAACTTTTCCCTTGT
GCGTTTCCTCTGACAAGCAGTGGTGCATGAACATGAAGTGGTGTTTCTGCTGGTCTCGGG
GAGGGGAGTTGGCAGCACCGCACACAGGAAGCTGGTGTGTCCGTTAGCTCCGAGGACTTG
CCGTGTGGAAAGGAGCCGTGTTTGAGCCCATGACCCCGCACTGTCGGGACAGGTGGCCTG
GAGTGCAGTTGTCCTGTTCCCACTGGAACCCTGGGCTCTAGCCGTGTCTGACTTGGGAAC
ATGGTCCCTTCTTAGCTCAGAGTTTCCCGCTCCGCCCTCGGGTGGCCCCGTCCTGAAGGC
TGAGCTTTCTCAGGGGCCCCTTCCACTCTCCCCCCCGCTCTCTAGTCATCGGCACTGAGG
AGTTGGGGGCTGGGAGCCCTTGGGGAGAGCCCAGGACATGATGGCCTCTCCGGCTGCTCC
CTGTCTCCCTGTAGATTTCCTCTTGGCAGCCCTCCCTGCTCTCACAGAGGATGCTCGGTG
TGAGCGCCGTCAGGGTTTGGCCTGGCTCCTGTGTTGGGGCTTGATTAACAGTGTAGCTGT
GAGGTAGCTCAGGTGTCACGGAACTGCTGTCTGGTGAGGGATTTGGCTGCGGTTTTGGTG
CTGAGGGGTTGTGTGTACAGCCCATCCCTGCACCGTCCCCAGCACGTTGGAGCACAGAAA
GGCCCTGAGCTGGGAGACGCGTCTGGGAAGAATCCACTGGTCACAGACCAGCATTGAGGT
CACATCCTGCTTGGCCTTGAGCAGGTGATGCTTGTGACCGTCCAGCAGCTGGTTGGTATC
CCCCACCTCGTGCCAGGCTGTGAGGGACCAGTCCCTCCTGTGTGTTGAAGGAGACCTTCT
GTAGTGTCCACGGCTCCACGTGAATTAAGACTGTCCTTTGCACCAGCTGCCGGTGGGACA
GACAGTCACATGTCTCCAGTGCTGCTGACCAGGCTCGTAATAAGGGGTGATCAGACGGTG
ATATTTGCCTTGAAGTAACTTGATTTCAACTTTGATTTTTCAGGAGAACATTAAGTTGGA
TAAAAAGGGGGGCGATAATGCACCACGGCAGCGGCCCTCCGAATGTCCAGCACCAGCTGC
AGAGGTCCCGGGCCTTCCCCAGCAGCGAAGAAGAGCAGCAGGCCCACCCAAACCCACCCC
CATCCCCCGCCACGCCTTTCGCACCCTCGGCCAGCCCATCCGCACCCCAGTCGCCCGGGT
ACCAGGTTCAGCAGCTCATGAGCAGGAGTCCCGTGGCCGGGCCGAACGTGAACCTCGCCC
TGCAGAACGTGGGGCCAGTGGTGGCAGGAAACCCCCCGCTCACGCTGGCCCCGCTGCCAC
TCCCCAGCCCCACCTCTCCGGGCTTCCAGTTCAGTGCCCAGCCGAGGCGCTTTGAGCACG
GATCGCCGTCCTACATCCAGGTCACCTCACCACTGTCCCAGCAGGTGCAGACCCAGAGCC
CCACCCAGCCCAGCCCTGGGCCGGGGCCAGGCTTACAGAATGTGCGGGCAGGCGCACCCG
GGCCTGGCCTGGGCCTGTGCAGCAGCAGCCCCACCGGGGGCTTCGTGGATGCCAGTGTGC
TGGTGAGGCAGATCAGCTTGAGCCCGTCCACGGGTGGGCACTTCGTGTTCCAGGAGGGCT
CGGGCCTCGCCCAGATGGCCCAGGGAGCCCCAGTCCCGCTGCAGCACACAGGGACTCCCA
TTGCAATGCGAGAACGGAGACTGTCCCAGCCCCACGGGCAGCCGGGGGGGACTGTGCACC
ACCTGGGACCCCAGAGCCCCGCGGCCTCGGGCGGAGCTGGCCTGCCGCCCTTGGCCAGCC
CCGGCCACATCACCACCGCCAGCCTGCCGCCCCAGATCAGCAGCATCATCCAGGGGCAGC
TGGTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGTGCTGCAGGGGCCACCATTGACCC
GGCCTCTGCTGCCCGGGGTTGGGGGGGCTTCGGCGTTCGGGATGACATCCCCGCCGCCCC
CCAGCAGCCCTTCCAGAACCTCGGTGCCCCCGGGCCTCTCCAGCCTTCCCCTCTCGTGCT
CGGGGAGCAGGAAGACACCCAAGAAGCTGGAGGAGATCCCCCCAGCCTCCCCAGAGCTGG
CCCAGATGCGGAAGCAATGCCTGGACTCTCACCTCCGGGAGATGGAGGCTTTGAGGGAGG
CCTTCAAGGAGTACCTGATTGAGCTGTTCTTCCTGCAACACCTGCAAGGGAACATGATGG
ATTTCCTGGCTTTCAAGAAGAAGCACTACGCCCCGTTACAAGCTTATCTTAGGCAGAACG
ATCTGGACCTGGAGGAGGAGGAGGAAGAGGAAGAGGAGGAGGAAGAAAAGTCTGAGGTTA
TCAATGATGAGGTGAGAAACAGCAGTTTAATCATTAGAGGACTGCGCTGCGCAGGTGTGA
GTCTAGGCAGCTGTGAACACAAAAGAACCTGTGAGCCCGGGGTGCTCCTCAGACGCGGTT
TCATAAGGATTTGACCCAGGAGTAACGTGGAAGGTGGATTTTGCTGTTTTCTTCGCAGGA
GGGAAGAGCTGCCCTAATAGTTGGGGGGCAGGGGCAGACCAGGTGCCTTCATTGAGAGCA
GAGACTCCGCTCCGGAGGGAGAGCTGGCCTGTGGGCTGCAGCCTGTGCCCCTGGCCTGTG
GGGGGTGCGCACCTTGGGCTGGTTCCCAGTTTTCACATTTTACTGAAATAGGTCCCCCCA
TTGAATCATCATGAATGTGGATTTTAAACAAGGGGTTTAACTATAAATAAATGTAAATAT
TGATGTGGTATTTTCATGATTAAAATAGTTATTATGGCAAAAACCAATTTTTAGGTGTAG
TCTTAGCTTTGAGATCATATTTTAAATTCACTTTTATAAATACCTATGAATGATATTTAA
GATGGCATCTTTTTTTAAACTGAAAATTTTGGGTGCCTGGAATGGGTGCTTAATAAATGC
CCGAATTGAGATTTCTTGATACCATTGTGATTCCAACCCATTTGTCTGCACTTCCTGAAA
AAAGCTGATCACAGCAGCGAGCGTGAGGTGGCTGTCGTGCACTGTACGTGTGCCTTTGTG
TTGTGTAGTGTACGATGTTGGTGCAGCTGACTTTGTTCTAGGAGACGGCTGAATACCTGA
GTCTTTGTCACTCTTCTGCAAAGAAATCGGCCTTTGGTGAGCAAAACTGGTCTCTTTGCT
CAGTCGTCCTCATCGACATTTATGGGCGTATCTGTGTGGCTTTGCCATTTTGTGTTTTCT
TTAACACCCTTTCCAGGATGGACCATTTTTATTTTCCAAATGGTTACCTGATTATTTTGA
GGATTTCACCTCTGAAATAGTGAAATTCCGTTATCTTTATGTTTGTACACCAGTGTTGTC
TGAAGGTCAGTGCCCTTATCTGTGCTTATGAAAAGAAAGTCCCTTTTTATAACTTCCTGT
TGAACTAGACCCTCCATCCTGACCCCCACGTGGTGGCTGATGGAGTGGCCGCTGTGCAGA
CTGCCGGAGGTGGTCGGCTTTGTTACTGGACCGCCTGCCGTCCCCACTCCAGAGTATGCA
GTTGTGCAACCAAGAGATTGCACCTGTGACTCAAATTGGAGTACCTGCAAGATTTGCAGC
TGAGTTAGGTTGCTATGTTATACATCTGTCATAAATTAGTTCATTGTCCTTTTGCAGAAT
TTGATGCAAAAACATTCCATTTTTAAACAGCAAACATCAGTGAGCTGTCAGCAGTAAAAT
TCTAACACAATTTTGAGCAGTCTTAAAAATCATGTTGCCTTTTTTTCTCAAAATATTTCC
TCTCAGGTAAAGGTTGTGACAGGAAAGGATGGGCAGACTGGTACTCCCGTTGCTATAGCA
ACCCAGCTTCCGCCAAATGTTTCTGCTGCTTTTTCATCCCAGCAGCAACCATTTCAGGTA
CTTGTCAATGGTTCTCAAATGTAGCCTCATCCCAAACTTTCCCTTCATCCAGGCATTTTA
ACCTTCAATTACTATTTGCTCTTAGCATTTTTTCCAGAGCCCATCCCTTATTTTAAGAAA
ATAAAGAAGTCTTCCTGCATATAGAGCTATAAAATTAAGTTGCATGAGTGAACGACAATC
CAGAGCTAATGCACTTTTTTGTGTTGACCTGTGCTGCAGTCGTAGCTGTAGTGTGCATGT
CCTCTAATCCTCAGCCTGTCCGTGTGCCAGGATCCTCGTGTGCTCTGTCTCCTGTGGGCT
CTCTCTGTGTCTTCTCTCTGTATTTTTGAGAACAGTGCCAAACAGAAACAAGAAAAGAAA
GATTTAAGCAGACGATACCTTGATATTTTCTCAGCTGGAAGAAACACTGAGGTGAAAGCT
CCGAAATCAGGGCCTCGGGCTTCTAAATGGCTGTTAGTGAATGCAAACTGATTATTTACA
ATTTTTGGAAATTAAGTTACTCAGTGTTCCAGTAACAGTGCTAAGGATCTAAAAGTATAG
GTCTGATTCTAGTAGTTTTGGAATGGATTGTGCTGGGTTCTGAAAGCAGTTTCATCTTTG
TGGTGATAAGTTTTTTAAAACAATTTTTTTATTTCTCAGCTACAGTTGACATATAATATT
ATATTACTTTCGGGTGTATAACAGTGATTAGACCCTTGTGTAACCTACAAAGAGATCAAC
CATACATCTAATACCCATCTGGTACACCATACATAGTTATTTTAATATTTTAATTTTGAT
ATAATTTCAAACGTAGGTAGAAGTTGCTGTAACAGTACAGAGAGCCCCCCTGATAGTCCT
CACCACATTCACCAGGGGTTACCTGTTGGCCCCGTTTGCATTACTTTCATTCTCTCTCTC
ATATTTGCACACACATCTCCCCCTGAACTAACTGACAGGAAGTTGCAGACATCCCCTCAT
GCCCTTTATCCCTACGTACTTCCGCACGTGCTGGGTGACCTTCAGATCACATGTTGCAGT
GACGCTGTACGGTGGCGAGGCCGCAGCTCAGGCAGATGTCTCCTCTCCGGATGATGTCGT
CTAGCGTTTCCCTCGGTCTGGGACCTTTGGTCTTCCTTCCTCTGGGCCGGCCCCTCGGTC
TCTCGGGACCTTGGCATTTTTGAGAAGGAGAGCCATTTATTCTGTAGTGTGTCCTTTGAT
GTGGGCTTGTCGGATGTTTCTGGTGTCTGATGCGGGTCATGCAGTTTTGAGGGGATACCA
CGGAGTGACGCTGTGTGCAGCTCAGTGTGCCACGTGAGAAAGCCGTGACGTCACTGTCCT
TCACTGGTCCCTGAGGCTTTTCCAGTGGAAAAGCTTTTCTTTGGGTGATTGATAAGTAAT
TTGGGGAAGATAGTTCAAGACCATATGAATATCTAGGATCTCATTAAACATTCGGCCACT
GATTCTAGCCTCTGTTGCATCTACTGACGAGTCCTGCCAGACGCAGCTGTCACCTTACAG
ATTGCAGAATGGACTTGCTAATTCCATTATTCCTTTTACGTTCGTTAGTTGGCACTCTGC
TGTAATGACACACTTTCTTTTCAGTTGATGTATTTTATATGTGGATTCTTCCATCAGTGG
GTTATAACATGTCACTGACGATTTATTTGTTCATTTGCACTTATTAACTCAGTAGAATTG
ACACTTTTTGGTCTGTAGTTCCATGAGTTTTGACAAACACAGGAAGCTGTGTAATGACCA
TTACAGTCAAGAACAGGAATTGTGTCATCCCCCAGGGTGCTCCCTCGCGTGTCTCTGTGG
TCGAGCCTCGCCCTGCCTTACCCGTTGTCTGCACCGCTGTGATTTCGCCTTTTCCAGATG
AGGTATTGGTGGAGTCACACTGGCTGCTTGCAGTTGGCACAGCACACGGGAGAGCCACCC
ACGTGGTTGCGTATTTCTGTTGCGCTGAGTGATAAAATTAGGGGTAAAGTTGCAGTGAAT
GTCCACAGACTGTTTTTCATGTGAACATAGGCCTTCAGTTGGGTAAATCCCTGGGGGACA
GATTGCTGGGTTGTTTGGTAAGGGTATGTATGTTCAACTCCATAACAGACTGCCCACCTT
TTCCACAGCGGTGGTACCATTCCTCACCCCAGGTGGCAACTTTGTTCTTTTTTAAAATCT
TTCTCTTTTTTTGATATCTACACAACATCCTACCAGGGTTTTGACTGAGATTACATTGAG
TTCGTTGATCAGTTTGTTGAGAAGTAATGTCTTGACAATATTGCATCTTCCAGTTCAGGA
ATATGGTACATCTCTCCATGTGTTGTGGCCTTCTTTGTCTTCTTTCTTCAGTGTTTTGTA
GTGTTCAGCATCCCAATTCCATATGTGTTTTGTTATATTTATACCCCAGTATTCCTGTTT
CTCTGTGGAATTGTAACTGGTAGTTATATCTTTAAAATGTTGTTGTTCATTGCAAGTACA
GAGTGTCTCAAAAAAATGTGTACACACTTGAACAGCTGATAGCTCAAGTTTGGGAGTTAA
ATGTATTTTAATAAACGCTGCCTTTGTAATTATTCAAAGTGTGTGTATACGTTTTTTTGT
TTTTTGGGGGGGGGCACATTCTGTATATAAGAATACAGTTTATTATTTGAACCTGTATTC
TGGAACTTTGCTAAACTCATTTATTCATTTCAGGAGCTTTTTTGGTGGATTCTGTAATAT
ATTCAACAGAGAGAATCATGTCTGCAAAGAAAGCAGGACTTACTTTTTCTTTTCCTATCT
ATACGTTTACTTCTTTTTCTTGCCTTATTGCATTGGCAAAACCAGAATAGGAGCGGTGAG
AACAGACATTCTTCCCTTCTTCCCAGTCTTAGCGGGAAAGCATTTAGTCTTTCACCGTTG
GGTCTGATGTTAGCTGTAGATGTTGTAGGTGTCCTTTATCAGGTTAAGGAAATTCCTCTA
ATTACACTATTTATCATGAATGGATGTTGAATTTTGTCAAATGCAATTTCTGCGTCTTGT
GATGTTTTTCTTCTTTGGTCTATAAATATGGTGAATTATGGGTATTGAGGCATAGTTTAT
AAGCGGGGAGTGGACACAACTTAGGTGTGACAAGTGCCCGTGTAACCCACATGCCTTTCA
AGATGTCCACTTACATCACATCCCCTTGTGCCCCCTGCTCGGCATTTGCTGCTCAGGCCC
CTCCACTGCTCTTGATGCCCAAATTATCTGTAATTTGGCCATTTGGAGCCCCTCTCCAAG
CTTCTGACGCCCCTTCTCTGAGACGCTCTCGGAGCACTTCTCCGGTGAGCACTTCCTTTC
TGGTACAAGATGCTGAGGCTCGTTGGGCACATCCCTTTCTGCAGCCCAGGACTGTGGCAT
TGCTCTACGGAGCCTACTTCCTGTTGGTGGAGAAAACTCATTTGAACCCAGTGCTTAGGT
GCTGCTTGTGCGTTTGGTACGGTTGAAGATAAGATTTGTTCAATTGGAGACGCTCAGAAC
TGACTCACGGGCACCGTTACTGCGAGTGCGTAGAGGGGCGTGTGGACGCTCTGGCGGGTG
CTTGCATGGAACAGCGGGGCAGTGCACGCAAGGAGGGCCTGCAGGCTGGTGGAGATGATG
TGCGGTCTTCACAGCGACTCACTGTCACCTCACCAGGCTGCCGGAAACGACATTGGACAG
AATCTGATGTGATGAGGGATTCCCACCACTTCTGATGGGAGCGAGCTGATGGGAGCGAGC
GTGGGCAAACCCTTTGACCAGCAGAAGCTCTAAGGTTACTCTCACGTGTGTGCACCAGAA
AGCCTTGTCTATAAAAGCCCCAAACTGGAAAGAATGGAAATGCCCACCACCACCAGCAGC
GCAGACCAGCGATCGTGCACCCTCGACAGAGGAATGCTTACGTATATTCCAGTCGGCAGA
GGGAGTCGGCAGTCACAGCACGGGTGCTGCGAGGGCTGGTCTCTGGGGCAGAGGAAGGGC
TTCCAGGAGAAGACAGGTGCAGACTTTCTTCAGGGAAAGCTCACTGGGAAGCAGAGCCAG
CAGACGCGGTGTGGCGCTTGCGCTGCAGGTGAGGGCACCGCGGTGGGAAGTGTCCCGATC
AGGCAGCGGCACCTGCCTGGGTGGTCAGGGGCTCCCTCACGCTCCGCATCCCCAAGGCAC
AGTAGCAGGTTGTTTCTTAAGCCTGGTGACGACTCCGTGGGTGGTCCCTGTAATACTGTT
TTCAACTATGTGTAAGGTTTTCCACTTTCCTCAACATTTTACTATGAAAGATGTTGAACA
GAGAGAAAAGTTTGAGTCTTCAGTCAACCTCCACATTCCACCATTTAAATTCTGATTAAC
TTTACTATGCTTTAAAAATTGCATACATATGTTAATTTCTTTTGTATATAGGATATCCTA
TATAATAAAAGCCTAATATGCTAAGTGTTTGGTCAACCGGTTGGCCATTCAACCAATCAA
AGCATAATATGCTAATGATATGCTAAGGCTCCTCAGCTCCTCGCTATGATGTGCAGCTGG
GGGCAGACGCCCTGACTGGTAGGTTAGCTTGCTGCTGGGGTCTGGCTAATTAGGACTGAG
CAAGATGGGCCGGACACGCCCTGGAGCCCTCCCGCGTCCCTCCTCGCCCCGATTGATCGT
GCACTGGTAGGGTCCCTCAGCTTGGTCTGTGCCCTCTCGCAATCCGATCAACACAGTGTG
TTTACACTTTATTTTATTTAACAAATATTCTCTATATTTTATTTACTTTAAAAAATAATC
GTTCTTTTTTTTAACTATATTTTTTTTATTGATTTCAGAGAGGAAGGGAGCAAGAGAGGG
AGAAGCATCAATGATGAGAATCATTGATTGGCTGCTTCTTACACTCAAGCCCACAATCAG
GCCCTGACCAGGAATTGAACCGTGACCTCCTGGTTCATAAGTCGATGTTCAACCACTGAG
CCATACCAGCTGAGCCAGTTTGTATTTTAAAGTCAGCAGTATCATTCCCGATAAAATAAT
CATGAAGGTAGTGTAAGAAACTAAAGATAGCCCAGCCAGCGTGGCTCACTGGTAGAGCAT
CAACCTATGAACCAGGAGGTCACACTTCGATTCCTGGTCAGGATACATGCCTGGTTGTGG
GCTTGATCCCCAGTGTGGGGCGTGCAGGAGGCAGCCGATCCATGATTCTCTCTCATCATT
GATGTTTCTCTCTCCCTTTCCCTTTCTCTCTGAAATCAATACAAATATACATTTTTAAAA
AGAAACTAAAGATAGTATTAAAAACTAAAGGTCATCCTGAAACCAGGAGTTGGTGGCAGT
GCAGGAGTCGGGAGAGAGGCTGGCCCTTCCCCCAGCGTGTCTGTCAAGAAGTTGTCATTT
TCATCCGTTTTCACAGGGATCTCGTCCTCTAACACCATTTTGTTGAAAAGACTTCTTATT
CCTTCTGGTTGCTCCCAGCCTGCAGGAAGTGATGTGATGGGCAGTCACTGGGGGCCCCCT
GCTGGGCTCCCCACTCAGTTCTGTCCATCTGTCCATCACCCTTGAGCAGCACTGCACTGT
CCTAGTGACCGTAGCCCCCAGCGCGTCTCAGGTCCAGGCCTCTGGTCCTCTCGGGACTGT
TTCAGTTCACTGCCCCCCCCCCCCCACTCTGCTACCCAGCCTTCCAGTGTGTTTTTTTAT
TTCAGATATTTTAGTTTTCAGTTTTAGAATCTCCACTTGGTTTTCTGTTTGAATAGTTCC
TTTCTTCTGTCCTTCATGACGACATATTTCCTTTGTGTCCTGGGCGCAGTTATTAAAGCC
ACTGGCAGATCCTCGCTGCCCAGTTCCAGCACGTGGGCCCGCTGTTTGCTGCCCGTCGGT
GGTTTTGAGTGTGGCTCATGCTTTCTTGTTTCTTTGTGTCTTGGAGTCGTTGTGACTTGG
ATTTCGAAGGTGGTGACTGGCCGGTGGCAGCGCGCCGGAGGAGTGCGGTTGCTTTTCTTC
CATAGTTAGCCACGGTGATTGAATTGGAGCCGGGCGCTCCGTCTCCCGAGCGTTGGCGCC
TGGAACCTTAGTGGGTGCGTGGCATTTGTGTCTGCGTGGTCCGGAGGCAGCAGAGCTGAT
GGAGAGAGCCTGCCTCTCCTTGTCCAGCCTGGTCCTGTGGCAAGTCCCGTCCTCACTGCT
GGCTTCCTGCCCGGCCCCAGTCATCTGCAGGCAGCGTGGCTGGGCTCTGGGCCGAGCCGC
GCCGCATGGCACAGACGGGCCCTCATGCTGTGCCGTGGCACCAGAACCCACTCCGGCCCT
TTCCCTACGTCCTGCAGGTCCCAGGCCCCTCCCTGAGGCTGTCCCCTGGTCCCCATGTTA
CGCTTCTTCCGGAGTTTGTGTGTGTTTGGAGTACTTTTGGTCCAGTATGACGTACTTGAC
ACCGAGCATTTCTCACTTTCTTCTATTAAAAATAACAACAACCCTTCTGATAAGTAATAC
ATGTTCATTGTGAAACATTTGGAAAATTTAGAAAGGTGCAAACACACACAGATGATAAAT
TAATTCCCTGTAATTCTGTCCCCAGAGATAACCACTGTTCATATCACCTGATTTTCAAAT
CATTCTTTTCTTCTGCCTTCTCTCTCCCTCCCACCCTCTCCTCCCCCATCTTCCTTAAAT
GTAACCGGGTGCTTACTCTCCCTTTAGTCACTCTGAGCTGTCCTCATGGGAGCTAGTGGC
CTGCAGCCTGGCTGGAACCGGCCGTGTCATGTCCACTCCGCGGGCCGCGGGGATCAGCGA
TGAGCAGTTCTCAGACATCATCCATAGCGTCTTGTGACTTTTGCATTTAAAATGCTTCAC
TAAGTAGAGTGATCATCATTGAGTCATTAAACAAGATCAGCGATGAGCAGTTCTCAGACA
TCATCCATAGCGTTTAGCGTCCCTGCATGTTGAGGTGCAGAGTGGAAGGTGCAGGCGCCA
GACTGCGCTCTGCCTTGGCCAGCGGCTGTCATTCAGACATTCACAGTGACCACTGTCCAC
ACACCACATAGGTCACGAGGGGCCCACTGTCCACACACCACATAGGTCACGGAGGGCCCA
CTGTCCACACACCACATAGGTCACGGAGGGCCCACTGTCCACACACCATTGGAAGATCCA
AGTCATCGTACTTACTAATTGGGGTTTTAGTGTCGTTTTCCTATAGGAAAACAGTTCCAA
CCTTTCTTTGCATTATTCAGCTTTGTTTTGGGGGTGAGCGATGACAGGCAGTGTGACTGG
CCAGGGAGGCTCAGCTGGGGTCCACCTCAGGCTCCCGCTTCCTGCAGCAGCCCCCCTGCT
GCTCTGTGTGCCAACCAGCTCGTGTAGGTTCACACTGACCTGAAGTTTCATTTAAAACCA
GAACGATAGGTCTTTTCTAAGTCCTTTTTTTCTTCCAGAGGTAAGTTAGAGCTTTAAATC
ACTCACAGAAATATACATTGCATATGTATATTTAAATACATTGGGTAGGTAATATTTCAT
TAAAAAGAAATAAGGTCAATGCTCGGGTAATGATGATAGTTTTAGTCGTTCTTGTACTTA
AATGACCCAAATCTGACTCTTCCCCTTTCTTTCCAGCAGCAAGCCCTCGCAGGGACCCTG
GTGGCAGGGGCTGGCAGTACGATAGAGACGGACCCCTTTAAGAGGCAGCAGGCGGGACCC
CCGGCAGGTATGTCACCGTCACGGCACGACTCAGGTGGCCCCAGGCCAGCGGCTTCGCAG
CGGGACTTACAGCTCCGCGGCCACGTGTCTCTAAATTGTGAACGCTGAGGAGCTTGGTGT
TGATTAGTTTCTTTCTACTTTGAAAGTTACTTTTTATTTGGGGCGTATTGATGTGCATGT
TCACGTGTACCGAAGGGACAGGCTCATCAGTCACGCAGGTGTATTTCGTTTTGATTTTCA
AGTGCACTTCTGGGCTTCCTAGTCCTCATGCCATGATTGAATGTAAAACCATCTGCTTTT
TCAAGTTGTCATTCATTTTTTCAAACTGAATTTTTTTCTTCGAATTATAAACTTCATACA
CATTCTATGTAACATTTTTAAACAGTTCAGGTGTCACTTAAGCCTACCTCTGGTTTCCTG
CCCACTCCCTAGCCACAGAGGTAGCTGCTGTTAACGCTTGTGAATTTCCACAGACATTCT
GTCTGCACACCAGCATTGTGACACCTGTCATTCTGGAAACAATCTATATGTGATCGGATG
TACACTGTTGTCTAACATCACGTAGGAGGCGTCTGTCCCATCCATGGGCTTCGTCGTTTG
TGCTGGCTGCCATAGTTTCCATTGCACAGGCAGTTCCTTCTTTATGCTTCAGACCCTGGT
CAGTGTTCATTTGTTAGTACCATCAACATATTGAACACTAGTCTCACATTTTTTCCTACA
AGTTTATCAGTATATCTTTTTTAAAAATATATTTTTATTACTTTCAGAGAGGAAGGGAGA
GGGAGAGAGAGAGAAACATCAATGATGAGAGCGACTCATTGATTGGTTGTCTCCTGCACG
CCCCACTCTGGAGATCAGGCCGGTAACCCGGGCATGTGCCCTGACCGGGAATCGAACCGT
GACCTGGTTCATAAGTCGATGCTCAACCACTGAGCCACGGCGGCCAGATGTCAGTATATC
TTAAGGGGAAACTCCTAGAATGAAATAGTGGATCAGAGCGACATGCGCTTAAGTGTTGGA
GACAGTCAGTTGCCCTCCAGGGGGTTGGGTCCATTTCTAATCCCATCAGCAACGTCTGGT
TCCTTCCCCTGTAGCCTTATGGATCGTCCCTCTGCGAGCCGTGGCTCTCTGCCCCTTGCT
CTGTCTGGTCCCATACTTGCCATGTCACCTGTAAGAGCTTCTGACTGTCGAGTCAGCCCG
CCTGTGCCCACCGTGTGTGCTGCAGATGTTGTCTCTGAGGATGTTGCTTGATCTTTGCCT
TTTCATGATGCTTTTCCTTATATTTGCACATCTTTAATGAAAAGAAATTATATTTATCGA
TCTTTCACGGCTTTTGGATTTGGGTTCGTGCATAGAAAGGTCTCCCTGTTTAAATATGAT
AAAAACACACATTTTTTCTACTACGCTTGTGGTTTTATGTTTACATCAAACTGCACCTTT
TCTGAAAATTATTCTAGAGCAGTCTAAGCGACCTCGGCTTGAAGTGGGTCACCAAGGGGT
AGTTTTCCAGCACCCAGGGGTGAATACAGGAGTTCCTCTCCAGCAGTTAATGCCGACAGT
TCAAGGTAAGACCCAGCGTCAGAGCCAGCTCCTGTAGCTCAGGAGGGCATGCAGAGGCCG
ACAGCCCGCGCAGACTCAGACACGTGCAGTTGAGCTGGCCTGGTTGAAGTGGCTCCTGGA
CTTGGGGTGTTCTGAGCTGTAGTAGCACAGTGTGAAGACCCCGGAGACTAGTTCTTGTCC
CTGTAACGAGCCACACGTGTGCTTGTCCTCAAGCTTCTCTCCAGTTTCCACTCCTGTGTT
TCCTCGTTGCTGCCGCCTAGGGACCCCTGTGGTTACTCAGTGCTGCCCTGCTTGATGCTG
CCTGGCCAGGCCCAGTGCCTCTGTCCTTTCTGTGTCTCATTGAGAACATTAGATCTGACG
TGACTCAGATTTCCCGCCAGTTAAGCCTCCAGACTGCGCGGTCATTCTGCGTGGCGGGTC
TGTGACGAGCCCTGGGAGGTGACATCTGACGCCTGGTCATGCTTTCGAGCTCCAGAGTCA
GTGCTGGTGGGTCTTTCCTGTCTTGCAGGAGGGATGCCTCCCGCCCCTCAGGCCGCCCAA
CTGGCCGGACAGAAGCAAAGCCAGCAGCAGTATGACCCGTCCACGGGGCCTCCGGTGCAG
AATGCCGCCAGCCTGCACACACCTCCACCGCCGCTGCCCGGCAGGCTGCCCCCGGCCGGC
CTCCCCACCGCACCCCTGCCACCCACGCTGCAGTACCCGCCACAGCCGCCGATGGGGGAG
CCGCCGACACAGCTGCACGTGGCCACAAAGGCCCAGCAGCCCAACCCCCCGGTCCCCGTG
CCCCCTGCCAGCCAGCTCCCTGTGCCCCCGCAGGCCACACAGCCGGCCCTGCTCGCCCCA
GTGCCCGGGAAGGCGCAGATGCAGGCCCCTCCGCCGCCGTCCCAGCCGCAGGTACTCTGA
CCTCGGGCTCTGAGGGGTGGAGGGGACCAGGCAGGTGTGACAGGAGGTCAGCCAGCCAGC
ATCTGAGACATGGTGTGTGTGTAAAATAAGGACTGCTTGTAGCCGAGTTGTCACTGTTGA
ATTATCAGGAAAAAATGGTTCTGATTGCTGTGCTCAGAGCAGAGAGCCGTGCGAAGGGCC
TTGTAGCCACTGTGCCACTTGATGTGCCCCGTAAGGCAGAGGCTGGGGGCAGGCGCCGGG
TGCCTGTGGTGGAGGTGAGGCTGGGAGTGGCGAGGCTGCTCCTAACCATCGGCCAAGCCC
CCCGGGGGCCCCCACGCTCTGCCCTCTGCAACAGTGTCCAGGGGTGGTTCTTCACCGGGA
CCCAGTGACACAATGAACATGCTAAAGACACAGGAGAGAGGCTGGGGAAGGAAAGGTGTG
CGATGGACCGCACGGACAAGCACAGCTTGTAGTGGTCTTAGGTGACAGGGCTGTAGACGG
GGCTCAGTTTGTGTGGTGGTTTGTGTGATCGTGGGTTCGTTTGTGTTGCTGTGGGGAGGG
ACCATGGCGTGCCTTCACCTGTCGCCTCTTTTCTGCCCACCAGACGGTGGCCTCCGCGAG
ACCACCCACAGACCCCGCCCAGCCCAGTCCTCGGCCCCCGCCCCCCTCCTCCACCTCGTC
CATCGCTCCCGGCAGTGGCTCCGGCCCGGGGGCCTCGCCAGCACGGGCCTCCCCGGTGAA
CAGACCCTCCTCAGCAGCCAGCAAGTCTCTGTCTCCAGTCACCTCCCGGTCCCCAGGGGC
AGCTGTGTCAGCCCCCCCAAAACCACAGAGCCCAGCTCAGAACGCGGCTGCACCCCAAGA
CGGTTCTCAGGACAAGCTGGCAGAGCAGATGGCACTGGTGAGGGGCTGGTGCCTTCCGTC
TGGTGACACGCGGCTGCACTCACGCTGGGAAGCAGCGTTTGTAGCTGCACGCCTGGCATG
AGGGCGGTTGGCCAGCTCTGTGGTCAGAGACCCACGATGGAAGCCAGTCATGCGACCCTG
TCCTGGGGGAGGGGGTCTCGTGTGGTCTTTTCTGTGCTGAAGTCAGTGGTCTGGGCTGCT
GTCCTCGCAGGCTGTGGATGAGGGGCCGGGACAGGGCGGGTATCGTGAGGGGGGACAGTG
CAGGGCCCCAGGTCGGTGAGGGTCATGGTCAGCCAGTGGTTTCTGCTGTTCCTCAGATGG
AGCGGTTGTCTGTTCAACTTCATTTAAAGGAATTAAAAGAAACAAAGCAAAATGGGGTGG
GCTCGGATCTAACCCCGTGACGTGTGGCCAGTCTTCTCAGTGGGTCAGTGCAGACGCCAG
GCCTCTGGTTCCCTGGTGCAGAGCGCGGGCCTGACGTGTTCTGAGGCTCCACTCCGTCAC
CTGCCCGTTCTTCCAGCTTTGGGTCCAAGTCTTACCTTTGCTGCTGAGACTGCCACAGAG
TCAGTCTCACCTGTGGGAATGAAGTTAATGATTATGTGCTCCCCCTCCCCGCAGGAAAAC
CAGATCCATCAGCGGATAGCCGAGCTGAGGAAGGAAGGCCTGTGGTCCCTGAGGCGGCTG
CCCAAGCTGCAGGAGGCCCCGCGCCCCCGTGCACACTGGGACTACCTGCTGGAGGAGATG
CAGTGGATGGCCACCGACTTCGCCCAGGAGCGGCGGTGGAAGGTGGCTGCTGCCAAGAAG
GTGGGTGAGCTGGGCCCTGGGTTGTCCATTCACTTGGGGAAGGAAGTAGTGAGCCTGGGT
CTCCCCACCCAGCGCCGACGGCCCGCAGAGCACGCGGCTGCATCTCGGAGACAGCGTGGT
CCTGGGCTGAGAACACGGGAGGAGCTTCGTGTCGCCCTGGCCAGGGTCCCGGTTGGTTGG
CGCACCGCCCGTGCGCTGGAGGGTGCAGGTTGGCTCCTCAGTCGCGCGCAGGAGACAACC
GATGGATGTTTCTCCTCTCCTTCTCCCTCTGCCTTCCTCACTCTGAAATCATTGTTTCTT
TTAAATGAAGCTTTAAAAAAAAGAAACCCGTGTCCTTTTTGTCGCGTGACAGACTAAAAC
ACGAAACCCTTAAACTTTCCCTGCCAGCTCGTCAGGACGGTGGTGCGTCATCACGAGGAG
AAGAAGCTGCGAGAGGAAAGGGGCCGGAGAGAGGAGCAGAGCCGGCTCAGGCGCATCGCC
GCCTCGGCTGCCAGGGAGATAGAGTATTTCTGGTCCAATATCGAACAGGTAAACCTGACT
CTTTAATGGGGCCCGAGACCTAGACTGCTGGGGCTGGCAAGGCAGAGCCGCAGTGTCACT
GGGGAGGGTGCGTGAGGGTGGGTCCCGCCAGCATAGCCCTCGGACTGCAGCTCCTTAGAA
GGAAGGTTCTTGCTCTGCCTGTGGCTGTGCGTGGACACGTGGACACGCATGGCTGCTGCT
GGTGCTGCATGAAGTCCATTGTCCCCGAGAGGCCTGCACGCGGCTCCTCGGAGGTGGGCA
GTCGCCAAGGAGCTGCTCTCCGGAACGGCAGCGCTTGCTCCACTCCCTTTAGAAAGCGTT
CTGAGCTCAGCACCTGACGGGACTGGGCAGATGCAGTTCGCTGCAGATCAGGGCGAGCCA
GCCGTGTGCTTGCAGACCCGTGTGTGAGTGTCTCCGTTGCTGAACATTCCGGAGCCGGTT
AACTTACATCCTCGGACACGTGCTTGTGTTTAACTCTTGTATTCAGGTTGTGGAAATCAA
ACTACAAGTCGAATTAGCGGAGAAGAGGAAGAAGGCCTTGCATTTACAGAAAGTTTCCAG
GAAAGGTATGGTCCTTGGTAAAGCCTTCCCTCTTGCGGACCGTATTCTGCCCCAGTCCTG
TGCTCGTCGGCACCTGGCGACAAGGTGGCTTCCCAGGAGGCTGCTGCTCCGACCCTGCGC
GAGCTTGTGGCGCCTGGTGATCACCTTGCTCGAGGGGCAGCCGCTCTGGCCGCATGTTCC
CATTCTTTTGAGATTGGCTGGTTGAGTCCGAACCCCAGGCTGACCAGCTTTGGGGCTCTC
ACTCTCAGTTGAGGTCTGAGCCTGTCCCCTTTGGCCAGTCCCTGGGCAGGGAGGTGGACT
CCCTGAGGTGTGTGGCCCTGGGCCCCTGTGTGTGGCCAGTGCACTGCCTCACTGCACTGC
AGGGCAGGGCAGGGCGGGGTGGGGTGGGTGGGACACTGTGACTTCCATTTTCCTGGTGTG
GAAACGGGGGAGAGGTGGCCACTGCTGAGGTCACAGCTGTGCGACCAGACGGGGCAGAAG
AAAGGAGCTTTGCTGGTAGCTCCTGTCCCTCTCCTGGGTTCCTGCCGAGGTCTCAGCGCT
GAGGGCTGGGAGCTGCCTGGGCACCTGGTGAGGGTGGCAGGGGGCTGGCTCTGCATTGTC
CCCAGGTCACCAGGAGGGGGGGCACTCGCTGGGATGTCTCCTCAGCGGGGTGTCAGGAGG
GCGTGGCCTAGACAGGCAGAGACGCCCTTGACGTGGGTGGAGAACACGGTCACAGCCCCT
GTCTCTCTAGGAAAGGAGCCGAGACCCAAGGGCCCCGAGGTGCTGCTGGAAAGTGTTCTG
GTGAGTCCGGCTGTCCCTGCACCGGTGGGCGGGGAGCGTGTGGAGCCCCCTGCTTCTGTC
CGGAGAGACGTGGAGATTACACGCGTCACTCCCTTTCATTGTGAAGTCAGGCTACCTGGG
GAAGAAACGGGTCTCTGTAGCGGTGGGTTCACGGGGGCGTTGACTGTGATTTGGATGAGG
TGCAGCACACATGTGGACTTAGCCACACCCAGGCCTGTCCTGTGACCGCGGCCTGGGGGC
GGCATGCTTGTCACAGGGCCACGGTGCCCTGAGGTGCACGCCCAACACAGTCCTGATTTG
GTTTCCATGCTGGGCTTTAAGATCACATGTTGGCAATTTTTATCCTGACTCAGGACCCGG
GAGCAGCTGGCAGGAAACGGAAAGCGAGCACGACCCTCACTGATGACGAAGGTCTGTCCC
CATGAACTCACAAGCAGGGTGCCCATTTGTTGCAACCATGACCCAGAGCCACTGGGGTTG
TCGCCAGCCAGGTGCCTCGGTGGGCAGTGGGCTTTGTGGGGAAGACACGAGGCGCTGGCC
TGTGGAGCGGGGAGAGCCTAGGACTGAGGGCGAGTTCTGTTCGTAAGGGAGGAGATACGA
TCAGTGCTGATGGGAAGGAGCCGGCCAGGGGCAGAGGTGTGGTCTGTCTGGCAAGGCCGC
CCGGTGGTGAGGCTTGTGCCAGGGGAGACGGCTGCAGACGCTGCATTCTGCTGCGGCGCT
GGTCGACGCTTCTGCACCAGGGCCAGGGCTCTGTGGGAGGGAGGCACGGGGGCAGGGCCG
AGGTTGCTTTGAGGCAGTGGCTGCACAGCACAGGAGCCCGGTAGGTGAGCTGGTCTGCTG
GGCAGTGGCTGGGGTTGTGGACGTGGGCGATGGCTCATGGACTGGCTGCAGCGGGCTCAG
CAGTGGGTGGTTCCCTCCCTCGCTCTGGCCTGAGTGGGTTCGTCGTGTAGCAGCAGCCAG
GCTGCGTCCACTGAGGTGGGAGGCCAGTGTGGCCAGCCTCCAGCCTTCCCTGCGGCACGA
GAGGCTGCGTGTGGAGCCGGTGGAGCTGCGTCGTGCTTGGTGCGTGCTGCCCGTCTCGCT
GACATTCGCTCTGACGTCACCGTTGCAGTGGAAGACGAGGAGACGATTGCAGAGGAGGAG
GCGAACGAAGGGGCCGTGGACCACCAGTCAGAGCTGTCTAACCTCGCCAAGGAAGGTAGG
CTGGGCCTCCTGCCAGCGTGCCGTGAGCACCGAGTCAGGACAGGAAGCTAAAAGTCTGTG
CCAGGCAGAACAGCACCCGGCGTCGAGCTCCCTGGGATCAGCCACGCTGCTGAGCGTAGG
GTGCCGAGTGCCGCCCCCTCCCCGCGTCCGTCTCCCTCTCCCCGGGTCCCGCCGGGATGC
CTTCTGGGTCTTGGGTCTGTCACTCCTGCAGCTCTGTCCCCGCACCCGTGCCCTCCCTGA
GCACACTGCTCCCTTCCCAGCGTCGGAGCCTCACGTGAACGTCCTGCTGTAGGTTCGCCC
ACTTGCCTTTCCTCTCAGCTCTTCTGCTGCCAAGTTTCATTCACGTTGTCATTTGCTGTG
TAAACACTGGTTCTCACTGCGCAGTAGCCACGCGCACCTGTCTGCCCAGACGGTCTGCCG
GGCAGTGGGTGGGCCCCGGGTACCTGCGCTCCTAGTGGAGGAGCGGGCTGGGGGGCGTGT
GCGCCTGGCAGCCTGGTGAAGTTGTGCTGAGTTTGGGTAGAATGATGGCCGCCAGCTGCC
CATCTCGGGTGCACTGGTGTCTGACTGCAGCCTTTCTGCCCGTCGGGGTGAGAAACGGCG
TCTCTTCCTGGGCTCCTGCCTGTCTTCCTGACCTGGTTCTGGGTTTCCTTTTCCGTGTTG
ACTTGTAGGTGATCCTTGTGTGTCCTGGACATCAGTTCTTCGTCAGTTTTACGTGTTTTC
ATTCTCCTTGTGGTAACGTGATGCACAAGTGTTCTTGATGTTAGTGCAGTCGCATTGGCC
AACCTGGTTTATTTAAAAAACACACACAACACTCTCTGTAGCTCACAAGATGCCTCCTGT
GTCGGCGAACACTCCTTGTTCTTACGCTCATGTGCATGTCTCTGACGGGGAAGTAACCCC
CTTCTCCTGTGCCCTCCCAGCTGAGCTGCCCCTCATCGACCTGATGAAGCTGTATGAAGG
GGCCTTTCTGCCGAGCTTCCAGTGGCCCCAGCCTCAGCCCGGCGGCGAGGAGACGAGTGA
GGAAGAAGGTCTGTCCCGCGCCTGCAGGGGGTTCGGCTTTCAAACAGCGACTCGCAGAGC
AGGGGTCGGACAGAGCGGACACCCTTTGGAGTGACGTGTGATTCTGTATTGAGTAGCGTT
TCATTGAATTCTGTGCTGCTTTTTTGTTGTTTATAAACTTGGCACAGTCATGAGAGCACT
TAGTCAGGTTGTGAGCAGTTCATTTTCTCCAGGTTTAGGAAAGTCGTCATTTTATGGACC
TAGATTTTCATCGCATCTATTCAGGCTGTGCTGTTTAACACGCCTGCTTTAAGGAGTTCA
TTTTACTTTTATTAGACATTCCAAACATGCGCAGACGACACCAGGAACCCTGCTTTCCTG
CTGTCGCTCTGCTTGTTCTGATCATTAGACACAGTGCCTGGGAGTGGGAGAGGCCGCTGT
CAGGACCCTGTTGCAGCAGGACCAGGGAGGCCCTGGCGGCCCTCACTTGACTGGCCTTGG
AGATGCTGGTAGTCTTTCCCTTCTTGGTGGTGGAGGGAGTCAGGGACCCAGTAGGTGCCC
ATACAGCCACCTGTGGGGACAGCAGCTGCATTGCTGCGGAGGCCTCTCCAGGTTCACCTG
AGGGCTTTCCAGAGTGGGCCGAGGCTGATAGTTTCGTAAGAGTTTTCTCTGTTTAACCAG
AGCGCACTCTTAGGTATGTAAAGTGGATCAAAGTTCAAAAAATGGGTGCTTTCTTCTGTA
TTTGGATTCTGTCAGTTTTTTTAATGTTAAATAGGCTCATGAAACTATGAAGGCTGCTGC
AAACCCCACCTTTCCATTGCTCGCAGAGGTGGAAGACGGCCCCGGCGACCAGGAGGGCCG
CAGGGACGTGGTGCTCATAGACTCGCTGTTCATCATGGACCAGTTCAAAGCCGCCGAGAG
AATGGGTGTCGGGAAGCCTCACACAAAGGACATCGCGGAAGTGACCGCCATGGCTGAAGC
CATCCTGCCCAAGGGCAGCGCTCGATTCAGCACCACGGTGAGCGCCCGGCGGGAGGGACG
GAGAGGCTTCCTGCTCCCACGGAGCACTTGCCCCAGCTGCACACGTGACCGGGAAGGTGA
ACTCTGACCCTTGTCCTGTTGCCTGGAGGCTTTCTGTAGCTTCCCATGCGCAGCGTGAGG
TCAGTCTGGAGACAGGGCTCCGGTCACCTGAGGCAGCGCTCACGGTCTGTCCCTGCAGGT
GAAGCTGACTGCCCCGCCCCTGCTGCACGGCACGCTCAGGGAGTACCAGGCGATCGGCCT
GGACTGGCTGGCCAAGCTCTACCGGAAGAACCTCAATGGCATCCTGGCGGACGATGCCGG
GCTGGGGAAGACCGTGCAGATCATCGCCTTCTTTGCCCACCTCGCCTGCAACGAAGGTAG
GCGCGCGGGGACAGCAGGTGCCGCCGAGCCTGGCGTGTGGGCCAGGGTCTGGCTGAGCGA
GGGTCGGGAGTGCCTGTTTTCTCGGCTCCTCGTGTGGTGCTTTCTCGTGGGGGTGGGGGC
ACCTCGCGTCTGATCAGCCTTGGCCATCGGATGGGTGAGACATCTTTCCCAGCCTGTCCT
TTCCGCCTCTCGCTCTGTGTGGCTCCATTTCTAACAGTCTGGTGTGTGTGATTCTGATCA
TTTGAGGATGCTCATTTTTTTAGAGGAATGAGCTGAAACCACCTATTTGGGATGGTTTGG
GCGTGTGTGTTGGCGAGAGGTTGGGAGCCTCCACGTGAGTTGGTGTGGTGCTGTGGGAGT
ACCCACCGGGGAGGGGACAGGCCTTGGGCTCCGAGGGCTGCGGGCTGCTGACTGCTTTTC
CTGAGCGTTGTTCCTTGTCAGCGGGGGTTCCTTCCCGTGCTCATGGGGTTGGCCATGTTT
CTGAGTAAGCATTCCTTTTATTGGGTGATTGATTACTCATCCAGCCACTCCTGGCTGAGC
GCCTCCTGAGAGTCAGGCCTGCCCCTGCGGCTGCTGGGAGTGGGGACGGAGGCGCCGTCC
CAGTCCAGGAGCCGTGGTGGGAGGACGCCCCTGCACCCGCTGGACGGCTGCTTCAGTCCC
GCTCGGGGACGTCTCCACAGCGCGTGCTGGTGCCTGGGCCTGGCGAGGACAGTGTGGCTG
AGCGGACAGCTGTGTCCCCTCCCTCCGCAGGCAACTGGGGCCCTCACCTGGTCGTCGTGA
GGAGCTATAACATCCTCAAGTGGGAGCTCGAGCTGAAGCGCTGGTGTCCTGGGCTCAAGA
CCCTCGTATATGTTGGCAGCCACCGAGAACTCAAAGCAAAGAGACAGGTACTTCAGCTCC
ACTGAGAACTCAGAGCAGAGACAGGTATTTCAGTTCCACCGAGAACTCAAAGCAAAGAGA
CAGGTACTTCAGCTCCAGCGTGAAACAAAGCCAGACAAGAAACCATCTTAGTTAGTACAA
GACACGTCAAAGCAAAGAGACAGGTACTTCAGCTCCACTGAGAACTCAAAGCAAAGAGAC
AGGTACTTCAGCTCCAGCGTGAAACAAAGCCAGACAAGAAACCATCTTAGTTAGTACAAG
ACACGTTTCAAAATGTGCTTATTAGTGTAAGTACTGTGAGACAGACACCGCCTTCAGGTC
ATTTTAGACCTGCAGTTCCCCAAAAGCATCGACCACCCTGCACGGAGGGCCCGGGTGTAC
ACGCCTCACGGAGGGCCCGGGTGTACACGCCTCACGGAGGGCCCGAGTTTACACGCCTCG
AATCCCTTCCTGGAAAGGGAGGCATTTCCTTCCGGAACTGACGGCCCTGCAGTGAGAGCT
GTGGCCCTTGTTAGCTGCAGGCCGTGGGCTCTCAGAGGAGACGCGGTGCCTCCTGGTCCC
GGGTGCCTGTGTGTGCTTGAGGAGTGCGGAGCGCCGAGCAGGCTGCCGTGTTGAGGAGCA
TTTACTGAAAAAGTGACACCTCGAGATGCGTTTGGTTTCCACTGTCTGGTCACCAGTTGT
TGTAAAGCTCCCAAGGCAGCCGGTGGCAGCGCAGAGCCCACGCTGCCTGCGGCCTCGGAG
AGCGTCCCGCCTTGCCCAGTCCTCCCAGGGCAGTCTGTCTCCACAGCAGCTGTTGGGGCC
CCAGCACCGCCTGAGTGTGTCCACACAGGTGCTGGAGGCTCCTGGGGGAAGGGTCATAAA
AATACACACGTGGGGGTCTTTTTTGTGCAGAAGTAGCGAGTTATCAAAACAGTGAGGAGA
CGCCTGTGTTCTGTGTCGCAGGGATGGACCGAGCCCAACAGCTTCCACGTCTGCATCACG
TCCTACAAGCAGTTCTTCCGGGGCTACGCGGCCTTCACGCGGGTGCGCTGGCGGTGCCTG
GTCATCCACGAGATGCAGCGCGGTCAATGGGCCTGAGCGAGCGGCACTGGGAGGCGGTGT
TCACCCTGCAGAGGTCGGCCTGGCCTCCCGGGCTGTGGGGGGCTGAGGGTTCAGTGACAC
AGACGGCCTGTGTCCTTGGCACAGTCCCTCCTGTGAGGACACCAGAGTGTTGGTTTAGCA
CAGCCATGTCGTCCAGGCACCTGGGGGACGCATAGTTACCCCGTAGACTTGCCTTGTCCT
TGAACGTCTCAGACGCAGCAGTCCTAGCGGGGCTTTCAGACGTGGTCTCTGGTCTCGTGT
GCAGCCAGCAGCGCCTGCTCCTGATCGACGCGCCGCTGCACAACACCTTCCTGGAGCTGT
GGACCATGGTGCACTTCCTCATCCCGGGCCTCTCGCGGCCCTACCTGCACGTCCCCCTGC
AGGCCCCCACCGAGGAGAACCAGGACTACTACCACAAGGTGTTCATCCGCCTGCACAGAG
TACGTGCGCCCCCCCCCCCCCCCCACATCATGGTGGTGTGCGGTGATGTCATTCCCAGAG
GGAACCACGGCGTCTCCTTCCCCAGGTGACCCAGCCGTTCATTCTGAGGAGAACCAAGAG
GGACACGGAGAAGCAGCTGACCAAGCGGTATGAGCACGTGTTGAAGTGTCGCCTGTCCAG
TCGACAGAAAGCCTTGTACGAGGACGTCATCCTGCAGCCTGGGTGAGTGCACCGCCTATG
CTCGGTCCCCTCCGCCTCCTCACCCCCCACCCACGCCCAGGGCCAACCCGGGCGTGGCCG
GCGCTCCGTGTCCATTCGTGCAGGAGACACGTCCTGACGGGACCTCGGACGTCAGGTTTC
AGGCCAGTGTGGCCCCAGGACGGCTGCACAGTTGTCCCCCCTTGTCCACAGGGGAGCTGT
GCCAGGGCCGCCTGGAACTGCATGACCCTCAGGGCTGGACTGTCCATAGCAAACCTCTTC
ACAGTCACGGCCGGACGTTCATGCTGACTGGAGGTCTCAGGACCCTCCCCATGCAGTCCC
TTCTCTTTCCTTATTGGAGTTGGAGAGCGTTCGCCTTTCCCCTTAAAGGAGCACCTTCCG
GGGTCTGGGATTCCCACTGTGCCAGGATCACTGCTCTTGCTCGTTGGGGCATTTTAAGTA
AAATAAGGGCGAGTTGAACACGTGTGCTGATGCCAGGACAGTCAGTCTGCTTAAAGTGAC
TAACAGCTGGAGTGTCTACAGCGTGGGACGCCTGGGCAAAGGGGTGACTGACACCCCAGC
AGGAGAGATTTCAGCACGCTGTCCAGAGCAGCACACAACTTCAACCTAGACGTTGCTTAT
TTCTAGAACTTTGCATTGGATGGCTTTGGATTGTGGGTAGCTGACACCACGGGTCCATGG
AGCCACGTGTCAGGGGCTGCTGCGTGCTGCCTGACCCTCCCCGGCTCTCTGACTCCCGTC
CTGTCGTGGGGACGGAGGGAGCCTCAGGGTGACAAGACGGGAGTCGGGCCTCAGGTGTGG
TGACGTAGCCGAGCGCGTCGGGGGCGGACGTGCGTCCCTGTCGGAACCGGCGGGGCCGAC
GCTGAGTGCTCGTGTCTCCGTCAGGACCCAGGAGGTGCTGAAGGGCGGGCACTTTGTGGA
CGTGCTGAGCATCCTGCTGAGGCTGCAGCACATCTGTAACCACCCGGGGCTGGTGGAGCC
CCGGCTCCCGCGGTCCTCGTTTTCGGCCCGGCCGCTGCAGCTCCGCTTGGCCTCCCTCGT
GCTGAAGGCGCTCGACAGGGATGCCTGGACGGTAAGGAGGGACCTAGGAAGGTGGGTGTG
TCTGGGTCCTGCGGTCCTGACACGGCAGCACCGAGCAGCCTTTGTGCCGTGCCTTCCCCT
TGAGAAGCGTCCGTGTGGCGCTGACCGCGGGGCAGGCTCCTTAGCGTGGCGTGTGCTGTT
GGACTCTGAGAAGGGGTACAGGGTGGACGTGACGGGGAGCTGGCTGCAGCGAGGCGACAC
CCCCTGGGGACACAGGCAGTGCTTGGGGCACAGGCCCAGAGGCCCAGGACCTGGGCACCT
GCCTTGTGTGTTGGGGGAGCTGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTTGGGGT
CAGGCCAGGGACCTGGTGGCTTCGGGTCCCCCTCCCTCGAGTAGGGAGGTTCAAGGTGTG
ACTAGTGAGTGTGTGACAGTCTGAGGACCCTGAGCGAGCGGTGTGCTGTGAGCGGGTCAG
CTGCTGCTGCTGCAGTTGACCCGTGTCAGAGGGGCCCGGTCCATCGGGGCTGCTTCCTGT
GTTGTGCTTCTGAGATGCCATGGAGACACTTTGTCACCTGGACACACCTCTGCAGTGTGC
AGCGTGTGGGCTTGCATGTGCACGGCCTGTGCCGCCATCGCCCACGTCCTGGCCTCTCAG
TGTCCAGAGCGAGTGCACCGTGGACTCACTCCCTGCCGCCCAGCCTCAGGCAGCTCCTCT
GTCACTCTTTGTGAACCCATGCGCTACACACACGTGGGGCCAGACCATGCGTGGACTTAG
GTGCCTGGCTTCTGCCCTCAGGGGGCTGTTGGCCGTTTGCCATGTGGCAGCAGGATTTCC
TTCCTTTGAAGATTGAAGGGCTCCCCCGCAGGCACACCGTTTTGCTTGTCCGCTCATCAG
GTGGACGTGGGTGGTTCCCACGTGTGGCCCTCGTCACACTGCCGTGGGCCCTCGGGCACA
GTTTCGTGTGGGCGTGGTCATGGTTCCCTTGGGCGCAAGGCTAGGCCTGGAGGTGCAGGT
CAGGTGTGACTGGTGAACTGCTGACTGCTTTCCCCGGCAGCTGCACTCCTCTCCCGTCAG
TGTGTACAGGTGGGAGGTGCCCCTTTCTCCAGTCCCCGCCCACCCGCTTCCACCTTCCTG
GGTTCTCACTCAGCAGTGAACATCCCAGGGCTCTGCTGTTGGACGGCGGCATCCACACAG
CCACCGCCACTGGCACCAGCTCTTGGGTCTCCCGGGGTCTCTCCCACGCCACAGACTTCC
CTCTCCTCTGCCGCGTCTAGTCCGTCCCTGGGTGCTGCCTTCTCCATCCCACAGCCACTC
AGGTGACCATTCCCGTCTCAGCTGGGGAGAGGGAGGCACGCTGAGCCCCAGCGCGCGGCA
CAGCTTGGTCTTCAGGAGACCTCGCGGCACGGCCTGGCCTTCCTGTCTGCGCACCTGCTT
GGATTCTTAGTCGAGGCCTTTCTACCGTCCCACACAGCTCGTTTTTCCTTCTGCTTAGGA
AACGGATCTTTCTATATTTGACCTTATTGGCTTAGAAAATAAAATGACTCGCCACGAGGC
TGAGCTGCTGTGCAAGAAGAGGGTGTCACGGAAACTCATGGAGGAGCTCTTCACCGCCCC
GCCCCCGCCCGGCCGGCCCCCCGCGGTCCGACTGAAGCCCAGCAGGTGTGTGCGGCCCCT
GGCTGTGGGTGGGAGTGACACTGGGAGGCTTGGCTCCAGGCTGGTGTTTCCACGAGACCC
TGGCTCCAGGCTGTGAGAAGAGGCCAGTCGCCTGTTGGGTTGTCTGCTCTGGACACGGCC
CAGGTGTCCTCTGCTCTGAGTCGCTCAGTGTCAGTGGGAAGTGTGGGCTTGGCTCTCACC
CGCCTGAGGAGTGGCCCTTCACCGTCTTTACAAAGTGTTAGGATTGGGGCTGGGACCCGT
CATCGGGCTGAACCCGACCTGGTGGGTGGTGTGGGGGTAGCTGTCCTGGCCGATGTTGGG
GAGCGAGGGCAGAGGGGCGCTGGAGGGTGGTGTGGGCCTGCGGCGAGCAGAGGGCTCCTG
ACTAAGCGAAGGGACCCCTGGGAGGATGACCATGGTGCAGGCGCCTGGAGGCTGGGACGG
GGCAGAACCCGTCTGAGCGTGACGAAGGCAGAGCCCGCGTGGCTCAGGAGGGGCTGACCC
GGAGCGGGAAACAGATGAAGTCCTGGGCACGAGCTAAAACGAGGGGCGGGGCAGCCAGCA
TTTGAGACAAAGGGTCAAATCTGCAAACCGGCAGCCATTCTTGTCGCCTCGTCTGTGTGT
GTCTTCCCGGGCACCTAGGCCCTCGGACCTGCCCGGCGGTGACGACGCTGCCTCTGCTGG
TGTCGCACGGGGTTCACAGGGCGTCCTGCTCCGCAGTTCCCGGGAGAGCTGGCTGCTGTG
AAGCCCGGGGGCACCCGCGGGCCCCGCGTGGTCGCGCTCTGTGGCCGAGGAGGCTGTTCC
GTCTGCCCTTCCTGTCCCTGTGCTCCATCCCCTGAGGCTGCCATTGACCTTTCACCTCAC
TGCTTCCTCTAAGCCAGTGGTTCTCAACCTCCTGATGCCGCGACCCTTTAACACAGTTCC
TCATGCTGTGGTGACCCCCAATGTCATTGTGACAAATTGAACATAATTAATAAAGCACAG
TGATTAATCACAAAAACAATACGTAATTATAGATGTGTTTTCCGATAGTCTTAGGCGACC
CCTGTGAAAGGGTCGTTTGACCCCCAAAGAGGTCGCGACCCACAGGTTGAGAACCACTGC
TCTAAACCGTCATCTGGACTTGGTGTGCCAGATGCCTTTCCTTGTCCACTCTGATAGGAA
CCGAATTGAAGTAAAATCACACCCCATCACGCAGGCTCGGGGGCCACTGTCGTGTGCTGA
GTGTTGCCAGCACCGCCCGGCCCCCCTGCTGTAACCAGCAGCCTGAGTGGGAGCCTGCTG
CTCGGGCAGGCACCCCCGGCCTGCTGCAGCGACGCTGTCTTCCCGTCCACACGCGTCTAG
GTTGTTCCAGCCTGTGCAGTACGGCCAGAAGCCCGAGGGCCGCACGGTGGCTTTCCCCAG
CACACACCCGCCCCGGACGGCCACCTCCACGGCGGCCACGGCCACGCCCCAGGGCCACGT
GCGAGGACGGCCGCCCATCGCCACGTTCTCTGCTAACCCGGATGCCAAAGGTATGTCTTG
TGTGGTGGTGTGTTTGCCACGGAGGGTGCTGCCTGGCCCCTCTGACGAGGGACCTCCATT
CTGCCGAAGAGACCTGTGCAGCCCTCGCACGAGTTGGAGGCTTTTTTATGTCTTTAAACT
GGATTTTACAAGGCGCTGCACGCTTCGTGGAGGCGTGTGTGGCGTGGGATGAGGATGCTC
CTGGAGGGAACTCGGCTCTCAGGCTTCCGAGGAGGTGGCTGCTGTTTCCTGCCCTGCTTT
GCCGTCACCTGATTCACAGCAGAGAAGGATGGGGCAGGGGCAGGCAGGTGACGCGGGCCG
TGCCGGGCCGTCAGCGGGTCCTGGGCCATGTGCACGGCGGCTTTGAGTGGCCAGAGCTGC
TGCGTGCAAGCGCCCCTGGTGCAGCTGGAGGTGCAGCCTCTGTGTGCGCCTTTGTGGGGG
TCAGGATTCCCTCCGGTGGACACGGGTTTACATGGCTGACTTCTAACACTGTTCGCTGCA
GGAATGTACTGCCGTGTAGGCTGCTGGTTCGCGCCAAGTGGAAATAGTTAACAGCGGATA
AAAAGTCATACCCTCTGTCTAGACCACATTGGCCTTCACCCCCTTTTTAGAGAGAACTTC
TCATTTGAGAGACAGTATGAAATGTTTGTTTTATTTCTTTAAAATTCGGGTTAAAGTACT
GCGTTGCATTGAGAACCTCTAACAGCTCTGCACAAACCACCCTTGTCGATTGCAGCGGCA
GCGGCCCCCCAGGCTCCCACCGGTGCTCCGAGACCCCAGGCCGCCTCGACCTGCAGCACA
GCTCCTAGCCCAGCCCATCCTGCGAAACTGCGGGCTCAGACCGCGCCCCAGGCCTCCGCC
CTGGGCCCATCCCAGCCCCAGCCCCAGGCCCCCTCGCACCCGGCCGGGCAGAGCACGCTG
CCTCAGGGGCTGCTGCTCACCTCCCAGGCCCAGGCGCGCCTGCCTAGTAAGTGGCCTTGC
CTTCCCGGGGCTCTGCCCCTGCTCCCAGGAAGCTGTGCTCAGACCAGCAGTGTGAAGAGC
CTCTCTGTCCACTCCTGTCCCCCCAAGCCGGCGCTGCCTTTGCCGAGCTGTGGCCCTGCT
GTCCTTTCCGGCCCTAAATCTCAGGGCCGGTGCCCAGGGCCTGTCCTTTCTCTGCCTTTT
CTCCTGACCCCGTCCCGTCCGTCCGTCAGCTCTGCTTTCCTCCCGCACTCGCTCTGAGCT
TCATGCTGATGACTGTGCCTCCCTCACTGTGAGCCGGGCTTTGGCCCAGGGCCGAGATCA
GCTGGGGAGCAAAGGGGTAAAATGAAATCGGCCGCTTCCTGGACAGCCATGGCCTAGTGT
TCGGTTTCTAAAACCAGGACTTCCTTTTCATCTCTCGCTGTTACCAGATTTAAACCTGGG
ATAAATTATTGCTCAACGGAGACATTTAGTAATAATTCAATGACTAAGATCTCAATTTTA
TTAAATACTAGAGGCCTGGGGCACAAAATTCATGCAAGGGGCTCTGCCCTCGCAGCCCCG
GCTTCGTCCGGAAGGATGTCCGGTCTAATTAGCATATTATGCTTTTATTATTATAGATTT
TAATAGGATTTTTCATTGTGACCAGTGAGATTAGCATATTTCCAAATTTCACCTGGACCC
TGTCCATTCTGCTGTGGAAGGTGCCCTTCCTGGCACGGCCGCCTGGTCTCTCAGGTGCTG
CTCGAACACTCGCTGTGGGATGACGGACTGTGGAGGGGAGAGGAGAGGAGCGTGGTGTCC
TGAGGACCCGCGTTCAGGCTGGGTCCGCAGTCCTCTCGTCTGCTGCCTGCAGAGTCACCA
CTGGGCCCCACTGCCGGTGGGACGTGTTTCTTGGCCTGGGACGGGGCTTCTGTGCTGTGC
TTGGGGCATCGTCCACCAGGTCGCCTTCGTCTGGTGGCCTTCACCTCTGTGTGGACCTCG
AGGGCTAACGGGACTCACTCTCTGCCTCTCCTTTCTCACTTTCCTGTCCTTAATCACGGT
TCTGTGCGCAAGATTCCTGGGTGTTTTTCTTGTCTTTTGCTAATTGTTTTTATCACTAAT
GATTCTTGAATGGGTTTTCGTAGGAGGAACATTTAGACTCAAATATCAACCATTGGGTAA
AAAAACCTTTAATCCTGTGTAATGACAGCCTTTTTGAATGAAGTGCATGTGACTCCATCT
GAATTCGTTTTCCACAGAAAGGTTATAAGCAGCGTGACGCCTCGCGCTTCTTGACAGTAA
ACACTGCAGATCAGCCCCACGTCCCTGCGACGGGAGCTTTTGTCTCGAAGCTCCAGCCGG
GACGTGTTTCTGTACTGACTGCGGGGGAAGCGCGGCTCATGCCTCCCTCTGAGCTCAGCT
GCGCGAGGCTTCTCCGCTGGGGAGGGTCTGGCGCGGAGGCTGCCCCGAGGCTCAGGGTGG
GCTCTGCTCTGTGACGGTGGCTGCGTGCTCACTGGTTGGGGAGGGAAGGAGCGTGTCCCC
CGCAGGGTGGTTACTGTCTAACGTCTCAGGTCCCACCAGTTACGATGGCAGGAGTTAACC
ATTAAAATCTGATGTCAACTTGGTCTTCTCTTTCCTATTAAAATCGTTCTTTCCTAAAAG
TGTCATCACTGTTTTTCTGATACTTCTGTTTACTACCCGAGGTCGTTCTATATGACAGTG
TCACATTCGAAAACTTTGCACAGAAGTTTCATTCCCCTTTCCTCTGTGTTCCCTTAGGCG
GGGAGGTGGTCAAAATAGCACAGCTGGCGTCACTCGCAGGACCGCCCAGTCGCGTGGCCC
AGCCAGAGACCCCGGTGACGCTGCAGTTCCAAGGGAACAAGTTCACCTTGTCTCACAGCC
AGCTGCGGCAGCTCACCGCCGGCCAGCCCCTGCAGCTGCAAGGTGAGTCCGCGCACAGTG
CCTCCCTGACGCCACAGCGAGCCTGGCCCGAGGGGCTGGGAGGACCAGTGGGTAATGTGT
GTGTACCTGGCTGCCCAGTCCTTCACACGGGCTCAGTAGATGGTAGTCATTGAAAAAACC
TACCCTTTGCCCAGCTGACAGGGCTCAGTGATTGAGCATCGACCTATGAACCAGGAGGTC
ATGATTGATTACCGGTCAGGGCACAGGCCCGGGTTGCGGGCTCCATCCCCAGTGTGGGGC
GTGCAGGAGGCAGCCGGTCCATGATTCTCTGTCATCATTGATGTTTCTCTCTCTCTCCCT
TTCCCTTCCTCTCTGAAATCTATAAAAAATCTACCCTTTGATAACAAAGTTTCCTATTTT
TAAAATCAGAATAGAAACACTTGCTGCTTCTGATTTAAAAGGCCAAGGACTGCAGCTGTG
CTCACAGGTTGCAGGTAGCTCCAGGCCAGAGCTCCCCGCCTGTGGCCGAGGGCGATGTGT
CCGTGGAGTGGCTGCTGTTTGAGGGAAGGAGGGTGCGTGCTCCCGCTAGTCCTGAGTGAC
CACAGGGCAGCAGCTCAGTCACGTGTGTCCCCCTCAGTTGTGGGTTTGCGTTCAGGGGTG
GTGTCCTCAGCAGCCCTGCCCGCACGTGTCCGGGACGTGGTGAGCATGGCTCCCGGTTGT
GAAGGTCACTCACTGGAGAGGCACAGTTGGCAGAGCGGAGGCCCCTAGGAACCCTGCAGC
AAAGAAACGTTCAATTGGTCTAATTTCCTGCTTCTCCAGGTTTTGGTCAAAGGGGCGAGG
CCATCTGGTGCTGTAGTTTCTGTGGGACGTGGGAGGTTCCTGCAGAGCAGAAGGGGAGAC
TCGGTCACACCGAGGTGGAGTGCCGGCTCCTTAAGCAGAGCCACAGCATTTGCACTTAAC
AAACACGTCAGCCTTTTCTTCATCAGCTGGCGGGTCGGCAAGCACCAGCCTGTGATCAGG
CAGCTGGGACCTTCCCTGGGACTCAGGCCTCACGCCGACGTGACCGACCCTGAGCAAGTG
CCCCTTGCACTGCCCCGAATTCCTAGGAATTTCTAGGAATCGATGAGCTTCCTTTTGACA
TTAAGAAAAACGACATTGTTTCTTTTTTCTTTCTTTTTTGCTATTTATTGATTTCAGAGA
GGAAGGGGGAGAGAGAGAAACATGCATGATGAGAGAGAATCACTGATTGGCTGCCTCCTG
CACATCCCTACTAGGCATCGAGCCTGCAACCGGGCATGTGCCCTGACCTGGAATCAAACT
GTGACCTCCTGGTTCACAGGTCCACGCTCAACCACTGAGCCTCACCAGCTGGGCTGTTTC
TTAGAGTTACATTCATTGTGAATAAAGTGTTTTCCTTTTGCTACAAGTAACTGAACTTTG
CATTGCCATGTGGGAGCAAGTGTGGTTTTGGAAATTGGGTTTGTGGCCTGTGTCTGCACC
TTGGAGAGGGCGTGACTGATGGCCCTGGCACACGTGTGATTACAGGCAGCGTCCTTCAGA
TTGTGTCCGCCCCCGGGCAGTCCTACCTGCGACCGCCAGGCCCCATGGTGATGCAGACCG
TGTCTCAGGCGGGTGCCCTGAGCGCCCTGGGAAGCAAGCCCCCGACCAGCGGCCCCGGCC
CCGCTCCCGTGGCCCCACCAGGTAGAGTGCTCTGAGCAGGGGGAAGACTGGCTGTGCGGC
CTCTGGCTCCCTCCCTCGCAGGTACCGGGAGGCCTTGAGGATTCTGGCTGCGGGGCCTCA
GAACCTGCAGGTCCCGCCGTGGCCATGTCTGATTTCCACGGACACCAGTGTCCACTGGGT
CTCCTTTGTTGTTGGCTCTCAGAGTTTCTGGTTGACACTCACCAGCCTCCACTCACTGTA
GATGTTTGTCTGGTGCTAGGATTTCCCCTGGGACAGACAACGAGGCGGGGTCCTCGGTGT
GAGACAGAGGATGCTGCCTCTTGCCTGGTCCACAGCCTGCTTCCCCCAGGGTCCTCCTGC
TCCCTGGACCCGCTCCTGCCGAATCACCGCGACTCTCCCCGGTGCCCCCAACCAGGCCCC
TGGAGCCGTCCCCGCGCACACGTGTCAGGGCCACAGCAGCCCTGACCATTTGGGGGTGGC
TTTGTGCCGGTCTGGAGGGCAGCTGACTCCTGGCCTGAGGGCCGCCAGGTTGATGCTGAG
GAAGGGCCAGGGCCCTGGTGGCTGGTGTGCCGGCGTGAGGGCCGTGAGGACGGCGCATAG
GCATTCGCCACGGGAGGAGACAGGCTGGCGCTCGCTCAGAACGTGGCCAGAGGGCAGGGG
TGCCCCACGGGTTCTGACCAGCACAGGCGTGAACGTGCAGAGAGAGGGAGCACTGACCTG
AGGGCGCCTGGGGGCAGGTGTGCGCAGCGTCCGGAGCTGTTTCCAACCTTGGTTTTGGTT
TGCAGTTGGTGTGCCTGGTCGAGTGGCGGTCAACCCCCTGACTGTGGGCGAACCCGGCAT
GGCCCCCAAACCAGCGTCTCCCATCGGGGGGCCCACCCAGGTACTGAGCACCTCCGAGGA
CGTGGCTGGGTTACGTACATTTCATTTTAAAACGCTTTCCTAACAGAAGGAATGAAACTG
GCTCTATGATGGCAAACGTCTCCTTTCACGTAGTTTATATTCTTGTGACGTGGGAAATGC
TGTCTCGAGAAACTGCTTTTCTCCTCTGGGGTGCTCTGGGGGCAGGCCCCGCCCAGGGCC
CCGCTGGCCTGTGGTTTCTCACGGGCCGTTCCCATCACTTTCTGATGCAGGAGGACAAGG
CCCGGCTTCTGAGAGAGCGGCTGGACCAGGTCCACTCTGTCAATGAGCGGCGCTGCTCCC
GCGCCCCCATCTACGGGGCAGACCTGCTGGCGGCTTGTTCCCTGGCCTGTGGAGAACGGG
GCTCGGGGCTCGGAGCTCTGGGGAGCAGGCATGGGAAGGGGGCCAGGCCAGCGAGTGTCT
GCACGTCACCTTCAAACCGTCACAGGGACCTGATTTTGACGCTGACTCAACGTCAAGAGT
CCCTCCAAGATCTTATCGACAGGTGAGGTGGTTTCCCTGCGTGAAGGGCCTGGTGCTCAC
CTCGCCCTCCCCACCCCCCACCCACCCCCGTGCCCTTCTGTTTCCATGGGGTTCTTCCAG
GTGTGAGTGTGCGTTGAAGGTTCCTCCCTGTCTTGTCTTGGCTGATAGCTCATTTCTTGT
CAGCGGACGCGTCCTCCGTTGCCCGGATGGACCAGTGTTCTTGATCCATTCCCGGCTGAG
GACATCTAGGTTGTTTCCAAGTTCAGGAACTGACAGCGCAGTCACCGTCTGTGTGCAGGT
TTCCATGTGGATATGGGTTTTCAGCTCTTTCGGGCAAAAAGCTAGGAGCGTGATGGCTGG
ACCGTGTGGTGAGACTGTGCCTAGTTCTGTAAGAAACAGTCTTCCTCAGTGGCGCCCCCC
CCCCGCTCCCCCGCTCCCCAGCAGGGAGTGCGGGTCCTGGGGCGCAGGAAGTGGAGCGTC
TCTCGGTGGCTCATTTGCATGTGTCTTCTTTGGTGAGTGTCTGTTCAGGCCTTTGGTGCG
TTTTTAATCAGGTCGCCTTCGTTCTGTTGAGTGTTGAGAGCTCGTTGTACCTGTGGACAA
TAGTCCTTTAGCAGGTGTGTCCTTTGCACACGTGTCCCAGTCCGTGGCTTCCCTTCGTGC
TCTCTGGACAGCGTCCTTGGCAGAAGAGGAGTTTTTAGTTTCAGCGGAGTCAGCTGGTCA
GTCTTCTCTCTCATGGGTCGTGTCTTTGGTGTTGTGTCTAGAAAAGTCGTCACCACCGGG
TCACCCAGGTCCCTGTGAGCTGTCTTCCCGGGGTTTGTCCTTGTGCAGCTCACACTCAGC
TCTGTGACCCCGAGTCAGTGTGTGTGAGGGTGAGCTGGGCGTCCGGTCCTTCCCTGCACG
TGTGTCTGTGGTGTGGTCGTCCTGTGCCCGAGTCAGGGAGTGTGAGGGTGAGCTGGGCGT
CCGGTCCTTCCCTGCATGTGTGTCTGTGGTGTGGTCGTCCTGTGCCTGAGTCAGTGTGTG
TGAGGGTGAGCTGGGCGTCCGGCCCTTCCCTGCACGTGGTGTCTGTGGTGTGGTCGTCCT
GTGCCCGAGTCAGTGTGTGTGAGGGTGAGCTGGGCGTCCGGTCCTTCCCTGCACGCCCTT
CCCTGCACGTGTGTCTGTGGTGTGGTCGTCCTGTGCCTGTCGGGGCCAGGTGACTAGAAC
GAGGAGGTCTGCTCCTGCGCTCTCTACGCCGCCCCAGGGCCTGCTGTCTCGTCTCTCGTC
AGCACCGCTGTCTGGGTGGCTGCCACTTCATCGTCTGCCTTGGGAGTCGTGTGGCCGTCC
TCAGACTCGGTTCTCTCCCTGTCGTGTGGCTGTGATGGTCTTTTGCCTCCAGATAAACTT
TAAAATCAGCTGGTCGGTAGCCACGAAACGACTTGCTGGGGTTCTGACTGGGCTGGTGGG
GAGCCTCTGATCAAGCTGGGAGGGCTGCGCCCGGCGCAGGGAGTCTGTCTGTCCAGGAAG
GTGGGACGTCCCTCCGTCTCCTTAGTTACTTGGTCTTCCTGGTCGGTGTTGGATGGTGGG
TGGCTCTGGTTTGCTGCAGTGGCAGCAAGTAATGGACTCCAGACGCTGAGCTGACCGCCC
GAGGAAGGGCTTTCTGGTGCAGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCTT
TTCCCCCCACCCCAACCCCAGTCCGGGAGACAGAGCCCCGTGTCCCAAAGTTCCCATCAG
AAGACTTGCCCTTCGCAGGGGATGGGCTGAGTGTGTCCGTGATGGGGGCCTGGGGGGCCC
TACCCTGCTGTTTCTCCCTGGGTGGCACTCATCGGCCAGGCTGTCGGGCCTGTGCCCATG
GTTGCTGGGACAGTGTGGGCAGCAGGCTTGTCTCCATGGTGACCGAGGTCAGAGCTGCTG
GCTGGTGGAGATGCCAAGTGCTGCCTGTGATGACGTGCTTCCTGCTCCTCAGGGTGGCCT
GTGTGATCCCGCCAGTGGTGGCCTCACCCCCGTCCTTGTGGGTGCCGCGGCCGCCCTCCC
TCTACAGCCACAGGATGAGGATCTTCAGGCACCGCCTGCAGGAGCACACGGCGCCCTACG
CCCGGCAGCTGCAGCGGGTGACCGCCCCGCGCTCGCTGCAGTTCCCCGAGCTGAGGCTGG
TCCAGCTGGACTCAGGTAGGAGAGGGCACGCTCACGCGTCGCACCCGTGCTCTGGGGGCG
GACACTCAGTGTTGCTCCCCCGTAGGAAAGCTGGAGGCCCTGGCGATGCTGCTGAAGAAG
CTGAGATTAGAACGACGCCGGGTGCTGATCATGTCACAGATGGTCCTCATGCTGGACATC
TTGGAGATGTTCCTGAACTTCCACTTCGTCACCTACATCCGCATCGACGAGAACGCCAAC
AACGAGCAGCAGCAGGTCAGGCGGACGCTCAGGGCTGTGCACATTCGGTGCTGCCCCCCT
TCAGAGGGAGGCGCCACATCTCCGGGTCTTGGAACTCGAGAGTCTTTCAGCCCCATCTCG
CGATACTTTTCCACTCGGGACTCACACCGGCGTCCCAGTGCCGCAGTCAGGTCTGTGACG
TGTGCTCCCTGCAGGACAGGACTGTGTCCTTCAGGAGGCAGCCCTGGTGGGAACAGGAAA
CCGCCCGACAGCTTTACCTTAAAGAAGTGCCTGGGCAGCCACCTGCCATGGTCACTTGTC
AGAGCAGTGCTGCTGGGCGTGAGTGCTGCAGCTTCCCGGCCAGTCACGGTGCGTGTGACC
CTCGACGTGGTCGCTCCCTCCCAGCACCCCCTCCTGACGGCTGGAGTGCGCAGCTGTTTC
CTGTAGAAGTGCTTAAACCCCCCCTTCCCGGGCTGCCGCGTCCCGAGCCGTCCCCAGGCC
CTGGGAGCAGGTCAGCGTGCGCCGATGTTCCCGAGAGCAGAGGCAGCTGCTGGCCCGTGC
GTCCGCTGCCGCGTCATGTTCTGTAGCATCAGCCCCTCGTGCTGCACACCTGGAGCGGGC
CTGCGAGGAGGCCATTGCTCACTGACAAGTTTCCTTGGTAGTGGAGCAACTCATTGTATG
GAGAATCCCTTTTTAAAAAATATATATTTTTATTGGTTTTTAGAGAAAGGAAGGGAGAGA
GAGAGATAGAAACATCGATGAGAGAAACATCATGGACCGGCTGCCTCCCACCCTCCCATC
CTGGGGATCGAGCCTGCAAGCTGGGCATGTGCCCTGACCGGGATGGAGCCAGTGATCGCT
TGGTTCCTGGTGGACACTCAGCCCCTGAGCCGTGCCGGCTGGGCTGGGCTTTCCCGAAGG
AGGAGGGTTGTTGCCGGCTGTGGTCTGATCTGGCGCTGCACTGACTGCAGAGGAGCTGTG
TCCAGGGAAGCCGTCCGGTGCCGGCCCGCGTGGTGGAGGCGCCTCTCAGGCTGTTCCCAC
TCCCTCAGCCTTACTCCAGGGGCCTTTGCTGTAAGGTGCCCTGGCATTGCCTGGGGGCAC
ACGAAAAAGCGCACATCCCTCCCCAGGAAGGCTCCGTTCTCCTGTGGGGCCTACTGATTG
CGCTGACAGCACTTGTCGCCTGGAGCCTGGCGGTCTCCTGTGACGACCTGTGCGATCTAA
ACCGTGTGTGGAGGCTGGTGAGCCAGGACGCACGTGTGCAAAGAGCCAGAACCAAAGGCC
AGAGTCCGGTGGAGAGAGGGCAGCAGCGTTCCCCTGTGCCGGAGTCCTGAGAGGTTTGTT
CCGTCGCAGGAGCTGGTGAAGAGCTTCAACAGAGACAGGCGCATCTTCTGTGTCATCCTC
TCCACGCGCAGCCGCTCGTCAGGGGTGAGCCTGGTGGAGCCCGACGCCGTGGTGTTCTAC
GACCACGACCTGAACCCGGTGCTGGACGCCCAGGCCCAGAACTGGTGCGACAGGATCGGG
AGGCGCAAGGACGTGCATGTGTACAGGTGAGGCCGGGGCGGGAGCGCGGCGGGTGCCTGC
AGGTCACGGAGCAGCTCCTGCGCGTCCTCTCTCCCTCGGGCAGCGGGAATGGCGCCTGGT
GGGGTGGAGTGTGTGCGTGGCGTGGTGACCGCGTGGCGTGGTGACCGACGTTGCGCACGG
AGCTTGCTGACTCCCTGTGTGTTGTGCCTCTTCCGGAGCCGGCACCTTCGGAGGAGGGAG
GCCTCAGGGTGTTTCCGCTGTCACCAAGTGTGTGTTGTCTGGGCGAATCGGATGTTCAGA
GAACTTCCCTCTCCCTGACAAACCGGTGCGATGAGGAAGTGGGGAACTCTGCTCCGTCTG
CGTTCTGTGCTGTTCGTGCCGTGTGCGCTAAGCACTTGCTGTGCCACTTGGTGCGAAATC
CTGCCACTTCCGGCCCATGGTCCCGGTGCTGGCCCCGGACAGAGCGCAGGCTGCCTCGCC
TTCTGGGTTGTTGCACTGAAGACAGGCACTCACCACACGTCGGAACGGGGCGGCTCCCGG
TGGAGGCTGGCGGGTGGGGGCGTGGCCGGACTGAGATGGGGGTCACAGTGGGGCCTGAGG
CCTTTGACCGCCACGTGAGGGCAGGTCGCACGGAGCCCGTGGAGCGCTGATGCGTGCGCT
TCCGAAGCCTGCGGCGTGCTCTTCAGGTGGCCTCTGTGCCGGCCGCTCATGGGGCGCGTG
CTTCAGGACTGAGCTGCCTCTGTGTGGGTCTTGTTTGTTTGTAGGCTTGTGAGTGCCAAT
TCCATTGAAGAGAAACTTTTGAAGAATGGAACCAAGGATCTGATCCGAGAAGTGGCTGCT
CAGGGAAACGACTACTCCATGGCGTTCCTGACGCAGGTACCCTGTTCGTGGGGCCACAGA
AAGGCTTCCACGTGGCACAGGGGTGCGTGGCTCTGGGGACTCCAGTGAGGCGTGCTCTGC
GGTTCCCCGGCAGCACGCCCGTGCTCGGGGGGCGGGAGCCAGCCTCTCGCGGGGGTAACG
TGCGTGTCTGTGCTCAGCGCACCATCCCAGGAGCTGTTTGAGGTGAGCGTTCCCGTGGAG
GAGCCGGTCTTCCTCGTGACGGCCGAGGAGTTTGTGGTCCTTCCCCAGGAGCCGACCGTC
ACGGAGACCATCGCGCCCAAGATCGCAGGGCCTTTCATCGAGGTGAGGACAGAGCCGCCT
GTGTTCTCCGCCTCCGGGGCCGCTCCTGCCCGGTTTTCCCGGGTCCTGGCTGTGCAGGGC
CCTCTGCTGGGAAGCACCCAACCCCCGCTTCCTTGGTGAGGAGATTCGCTGCTACCTCAT
CATTTTTAAAAATTTACTTATGGTTGAGGAATTACATATGTCTCCTTTTCCCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCCCGCCACTCGC
ACCCCCCAGCTCATGCTCTCACCCCCGTACTGTCTGTGTCCACTAGTTATGCTTACATAC
CTCATCCATTTTAAAAATATTAACCGTTCGGCCCTGGCCAGTTTGGCTCAGTGGATAGAG
TGTTGGCCTGTAGACCAAAAAGTCCCGGGTTCGATTCTGGTCAAGGGCACGTACCTTGGT
TTCAGGCTCCTCCCCGGCCCGGGCCCTGGTCAGGGTGCGTGCAGGAGGCAACCAATCGAT
GTGTCTCTCACATCGATGTTTCTCTCAGTCTCTCCCTCTCCCTCCCACTCTCTCTAATCG
GGTGAGGATTAACAAAAACAAAAGCTTGCTCTGTCAGCACCATCTGACCCAGCATGCACT
TCCCCAGGCCCTGAAGAGCATCGAGTGCCTGGAGGGAGACGCACAGGAGCCCGCAGGGGA
GGCCGTGCCTGGGTCACCGGACCCTGACGGCCTGCGGGACCAGGAGCCCTCGCAGCTGGA
GGAGTTGGCCGACTTCATGGAACAGGTTTGGACATTTCCTCCTTTTGCTTTCACTTCGTG
TTTTTCTGTACAAGTCGTTGTCTTAAAAATGTATTCCTTTCATAAATATTTCTTGTTCAC
TTTGGCCAAGAACAGTCACTTTTTTGTTGTTAATCCTCACCCGAGGATATTTTTTTATTG
ATAGAGTGAGATATATAGAGATACAAACATTGACACATTGATTGGTTGCCTCCCACATGC
CCCTACCAGGGCTGGGGATTAAACTTCCAACTGAGGTATGTGCCCTCCACCGGAATTGAA
CCTGCAGCCGTTCAGTCCTCGGGCCAGTGCTCTACCCACTGAGCGAACTGGCCAGGGCAC
AACCACTTTTTTGATTGAAGTGCTGGTGGGGGCTTGTAAGGAACTTAATCCTATTGGCCT
GCAATGAACTATCCAAAAAATATATTTTGAAACAGCTCACCCCAATTGAAAAATATGCTT
TGAATTACCTGGAACTATTCCATTCTTCCATCGATCATGAAAAAGAGAGGAACGGTGAGG
TAAGGACCATCTTCACACGCGAGCAGCTCAGGTCTGTGGGGTTAAGTTTGGTTTGGAGGG
AAGTGAGTTGCCAGGAATCACAGGAATGAACCCAAACCCACCAGTGCAGACACCAGCTGC
CATGCAGGTCCAGGAGGCCCCGTGCAGGCGGTTCCAATGGGGGAGCAGTGGTGCCTGACA
GGTTCCATGCTGGGAAATGGCCACCACAGCGTGGAGGGGCCGCGGCCGGGAAGAGAGGTC
CTTGGTCTGAGTGTGAGACCAGGTGGGGGGGGGCAGGTGTGTTCCCCGTGGGGACGGTGC
TGGACGCCGTGTCCGAGCCTGTGGTCTCCCAGCAGGACGCCGTGCTGACTGCAGTGAGCG
CCTGGGAGGCCCAGAACCTGCGGGCGCTGCAGGAGCAGGAGGCCCGGGCGCTGCAGGAGC
AGGAGCAGGAGCAGCTGCTCACCTACACCCGGGAGGACGCCTACAACGCGGTGCGCACCC
CATCCTCGCGTCACCACACAGACGCGTGCTCTCAGCCCACTGCATGGCTTCCGGTTCCAT
GTTGCTTTTCCCTCGGGGTGTAGTGAGGTCCCTGAAGTTACGAAGGTGCTGGCAGCCTGA
AGCAGACTCACACTGAAAGCTCCCCTCTGTCTCCCGCAGGAATACATCTACGAAGGAGCG
GACGGGCAGACCGAAGTCATGCCGGTGCGTGCCCCGGCCCCGGCCCCTGTGGGTGGCTGC
CTTCCTCGAGCCGCCAGCTCATGCCTCTCCCTTCTCCGTGCAGCTCTGGACCCCACCCAC
GCCGCCCCAAGACGACAACGACATCTACATCGACTCGGTCATGTGTCTCATGTACGAGAC
CACGCCCATCCCCGAGTCCAAGCTGCCCCCGGTGTACGTGAGGAAGGAGCGCCGGCGGCA
CCGGACGGACCCCTCAGGTGTGCGCCGCGGGCCTGCTCCCCTCGCGCCGCGTTGTTCCCG
AGCGGAGGAGCCTTGCGTGCAGGCCAGTGGGCAGGGAGGCAGGATGGGTCGTCCTGGCCC
AGGGCTCCTGGGTGCCGGGCCTCCTGCTCAGCCCCTGGCCCCTCCTTGGCTGGCTGTGGG
CGGAGGCTCTGGCTCCGCAGTCCTGAGCGGCCTCTCTGTCCAGCTGCAGGCAGGAAGAAG
AAGCAGCGGCACGGGGAGGCGGTCGTGCCCCCGCGGTCGCTCTTCGACCGTGCCACGCCG
GGCCTGCTGAAGATGCGGCGGGAGGGGAAGGAGCAGAAGAAGAACCTCCTGCTGAAGCAG
CAGACGCAGTTCGCCAAGCCTCTGCCCACCTTCGCCAAGCCCGCTGCCGAGTCGGGTCCC
GACAACCCCGAGTGGCTCATCAGCGAGGACTGGGCGCTGCTGCAGGTGAGCCCGGACCCG
GGCCCTTCCCCACGTGTCCGTCCGCGCCCTGCCCACGGCGGGGGAAGCGGGAAGCCGCCT
CCGCGTGCTGACCGGGTGCCTCCCCTGGTCCTCTAGGCCGTGAAGCAGCTGCTGGAGCTG
CCTCTGAACCTCACCATCGTGTCCCCGGCCCACACGCCCAACTGGGACCTCGTCAGCGAC
GTCGTCAACTCCTGCAGCCGCATCTACCGCTCCTCCAAGCAGTGCCGCAGCCGCTATGAG
AGCGTGCTCATCCCCAGGGAGGAGGGCAAGGTGAGACCCGGGGCCATTGGCACAGGGCGC
AGGGGCTCCGCAAGGGGATGGGGCCTGGCGGTACGGGCACCGTGCTGCTTGGTCCTTGGA
AGGTGCTGTGTGGCTCCGGGCGCCAGGTCCTGCCGCCTCAGGTCAGCAAGCAGAGCGTCG
CCGTGCACGGTAGCTCGTGTGAAGCCTGGTCTGTGCTTTCCCTGACTTGGCTGCTGGGCT
GGTTTGATGACTCTAGGCCCTCAGGTCCACACGGACCGAGCATCACGCTGCTGCGGTCGT
CGGGCAGCTGGGTCCTTGGCGTCCGTCGCCAGGAACCGGGGAGTCCGCGCTGTGGGGGCG
CAGGTGACTTGGGAGCCGGCAGGCACTTGGTGTCGCTGTGGGACTCAGGAAGGCGGCGTT
ACCAGGCACAAGCAGTGCCAAGCCCCCGAGAAATGCCTGGGGGCAGGAATGTCCGCCCCT
TCACAGCTCGCTATGGGCAGAGGCCCCAGGGAAGGTCAGGTTGCTGGGGAAGGTGCTGGC
TTCATCCCTTGTCTGTGGCCTCACGCGCTGGGCCAGCTGCTCTCTGTCTGCAGCTGCTGA
TGGGCGGCTCGCTCAGGGACGTGCGGAAAGGCCTGGCACAGCCCGAGGAGTTGTGGGCGG
GTGGCAGCTGCCGGCCGCTGTGCCCTTGCTGTCGTGTGTGTGCTGTCCCAGGAAGAAGGG
GTTAATCACGGCCTCACCTGAGGCCTCCCCGTCAGTGAGCCCGTCCCGGGGTTGAGGTCT
GACCGACCATTTTGTTTCAGAGCAAGAACAACCGTCCTCTGCGCACGGGCCAGATTTACG
CCCAGGACGAGAACGCCACGCACACCCAGCTGTACACGAGCCACTTCGACCTGATGAAGA
TGACCGCCGGCAAGAGGAGCCCCCCCATCAAGCCCCTGTAGGCCCACGCTCCCTGCACTC
GGGGGCCGGGCTGGGCCGGGGCGGGGAGGGAGGCTCGTCCCGTCGTTTGTCGTGCGCGTC
TCCTTTTTCCTTCACGCGGTGACTTTTGTCTCCGTCTCTGCTGTAGGCTTGGCATGAACC
CCTTCCAGAAAAACCCCAAGCACGCGTCCGTGCTGGCAGAAAGGTACTGTTGTTGACACG
CTTTCCCTCTCAGGTGGTTCCCTCCCATCTTCTCTTATATGCCATCAGTTTAGTGAGCTG
TTGAGCACATGGCCTGTCCTGGCGTCGCTGGGGGTGGTGGTGTGGCCGGGCAGGCCCAGC
AGGGGCTCGTCCAGGGAGATCCTTGTTTGCACAGGAGGGTGTGGAGGCGGCGTCCTGCCT
GCCGGCCTGGCGGAGGGCACAGCAGCGGGACAGGGCACTCTCCTCTCCGCCTCACCCCTG
ACCTGCAAACATTGTGTTGGCTCTTCTGTAAATACATGCCCAGTTGTGGGGTGCACATAC
TTGCTTTGGATCAAGGAGGTCTTTAGGTGACAAAGTGGGGGAGGACGCAGGGGTCCATGA
GGGGGTGAGGAGACCTGTGGGACCTGTAGCCCTGGGGCTTGCTGGCCGGGTGGCGGGGGT
GGAGGCGCAGTGCTCATTCAGCTGGGGGCTGGGACATCTGTTCTCAGGCCTGGAAGGGAA
CGGACCATGGGCGGGGTGACGGGCAGCCTTTCTCCTTCCCAGCCTGGTCCGCCCCACACC
CCTCCTCTGGGCTGGGTGGGAGCTGCCTCCAGCACCCGGCAGCTTTAAGAATGGGCTGTG
GGTTTCAGGAATATTTGTGCTTTTGTGCTTCAGAACTTGCGGCTTATTTTTATTTCTTCT
CCTGTCTTTAGTGGCATCAACTACGACAAGCCCCTGCCTCCTATCCAGGTTGCATCTCTC
CGTGCCGAGCGAATCGCCAAGGAGAAGAAGGTGCGGGGCCTGGGCGTACGGGCGGCTGCC
ATTAGCAGTGGAAGCCCCAGGTGCTCCATCTCCTTTCTTCCTGCCCTGCAGGCCTTGGCC
GACCAGCAGAAGGCACAGCAGCCGCCTGTGACGCAGCCTCCTCCACCCCCGCCGCAGCCA
CAGCCCCCACCGCCCCAGCAGCCACCACCGCCTCTGCCCCAGCCCCCAGCGGCCGCCGGC
AGCCAGCAGCCCTCGGGGCCGCCCGCCGTGCAGCCCCCTGCCCAGGCGCAGCCTCCAGCA
CAGCCTGTGCAGCCCCCACAGAAGGCGCCCCCTGCGATCACTACGGTGGGCAGTGCCGCC
GTGCTGGTGAGCAGGCCCTCCCCGCCCTCAAGTGCCTGAGGTTCCTGCAGCCCCCAGAGC
AGCAGGCCTCCTTCCTGTCGGGGAGACGGGGTGTCTGTCTCCTGCAGGGCTCCTGTGCTG
GGAGAGCTCAGCGGTGCAGGAGCCTCGGAGTCAGGAGGATGTGTGAGCCTAACTGAGGAA
GTCGCCCTTCCTCCCCATGAACTTGCAGAGCAGACAGTTTGCCAGTTTGCAAGCTTCTCT
TCTGACTTGGTAGTTTTCCTCAAAGCACATGCATGTGTGCTCATGCGCACACGTGAGCCC
TCCGTGCCTGTCAGAGAAAAGGGGTAAAATGCACAAAAGAAGGAAAGAAAAGTGGGCTGG
TGATCTCACAGGCCCTATGCTGGCACCGTCACGCCCTGGCATGTGCCCTCGCTCTGGTGC
CCACGTGGCCACGCTGAGCTCACAGTGGGAAGAGACCGGGAGTGGATGGAGGCTCAGCTG
CTCTGCACTGTCAGCCAGGCCTGGGGCGTCTGCAGAACCAACCCCTTTGCTTTGATTTCC
TTTGCTGGGGGCGGGCGGCGGGGGCGGTGTTCGTATGTGCCTGGGCAGCCTCACTCCTCA
TTCATTCAGAAAATGCACTCCGGAGCACCTGCGCCCAGGGACTCTGTGGGCAGGCGTCCG
GCCAGGCAGGACCCGGAGAGCCCTGGTGGGTGCTCAGGAGGGGCTGTGCCTGAGCGACAG
GAGTCAGAAAGGAGTGGAGACCGGCAGGCACAGGCCCGAGCCTGGCAGCTGTGGGGCCAG
CAGGACAGCATGGCTGGAGCACCACTCACGGAGGGGTGGACACAGCAGTGTGGGAGGGGC
TGGGACAGCGCTGGAGTCGGCCGTGTGGCCAAGAGTTTGGGTTTGATGCTGACAGAATGG
GAGCTCTGGGAGGGTGTGCCGTGTGCGTGTGCAAGTCACGTGTCTCTCCAGCAGGCCGGA
GCCATCAAGACCTCTGTGACGGGGACAAGCATGCCAGCAGGTAAGGGGCCAGCGATGTCC
GTGGGAACTCACTTGTCTCGCGTGCTCTTGCCCCACAGACCCCTCTCTCTGCAGGCACAG
TGAGCGGAAACGTGATCGTGAACACCATCGCGGGTGTCCCTGCTGCCACCTTCCAGTCCA
TTAACAAGCGCCTGGCCTCGCCCGTGGCGCCTGGAGCCCTGACGGTGAGCTGCCTGCTCC
TGGGGGGTCAGCAGTCGAGACGCTGTGCAAGTCATTTGCTTGTTGGGAAAAGTACTGACC
TGGTTGAGTTTCATAAAGTAACATGGACTTGAGATGCTTTAGTTTAGTTTTTAATAATAA
TAATAATATATATATATGTATTTAGCAATATTTATTTTTTTTATTATTGTCTAAAGATTT
ACATACGTCTCTTTTTCCCCCTATTAACTGCCCCCCCCAGCCATTCCCACCCTGGGCAAG
CCCCCACCGCCCCAGTGTCTGTGTCCATTGGATATGCTAATTAATAATATTTTTACTGAT
TTCAGAGAGGAAGGGAGAGGGAGAGAGAGAGAGAAACGTCAGTGATGAGAGAGAATCATT
GATCAGTTGCCTCCTGCACGCCCCCTACTAGGGATCCATCCCACAGCTTGGGCATGTGCC
CTTGACTGGAACTGAACCCGGGCGGGACCTTCAGTCCATAGGCCTATGCTCTATCCACTG
AGCCACACTGGCGAGGGCGGACCTGTGGTATTTTAAAAGATAAAGTAATTCATCCACGAT
GCATTTTTGAGCACCGCTTCCTGTGATGTGGGGATCGAACATGGCTGAAGCCCACAGTGC
TTGCACGGGGCTCTGCTGGCCGAGGCTGGGGCGCAGGTGCCGGCAGCAGGAGGGGCAGCA
GCAGGCAGTGGGCAGGCCCTTCAGACTCGGGATAGAGGGCTCTCCGGGTGTAGATGATGA
AAGTTACACTTCCTGTTTTAAAGAAAGAAAAAGCTGGAGAACGCCTGTACAAACCTGGAA
ACTTTTAAAAGAACGTAGAGAACTTTGGGAAATGAAAACTGGCTACCAGAATTGTAGAAA
GAAAACCTAGTAATTGGGCTTACTGACCGTTCCCCAGTAGGAGAGAGAATTAGTGAACTG
GAAGACAATCTGAGGAAGTTATCCCAAACGCAGGGTGGGGACCAGTGGTGAACGGAGAGA
AGTTAAAGCCAGGAGAGGTGGACAGGGAGGATGGGAGGTCAGGCAGAGAGAGGGAAGGCG
TGTTTCTGTAACAATAGCCCAGGCCCAGGACAGGAGGGATCCCGCCTGTGCACAGTGCAG
GCAGCGGCGGGCGGGGTCTCTGGAGGCCAGCAGCTCACCTCTCCCTATTGTGGGGAAGCC
AGGAGCCGAGGGGACCACCAGCAGCCCCGGCTCTCTCTCCGTTGGAAATACGGCGAGGGA
TTTGCAAACCACTGAGGGAAGTGCAGGGCGACCTGCTCTAGCTCAGGGCAGCGCTTCGAG
TGTGCAAGGGCGCCTCCTGGAGGCTCAGCACCTCCAGGATGGCCGTGGGTTTAGTTGGTG
CCCTTTCCACCCAGTGATGGAGAGAGCAGTCCCCTGATGGGCCCTCGTGTTGCCTTTCCA
GAGCTCCGGAGGCTCGACGCCGGCCCAGGTGGTCCACACCCAGCCCCGAGCGGTGGGCTC
CCCGGCCACGTCTGACCTGGTGTCCCTGGCGCCGACGCAGGGCGTTCGTGCGGTCACCTC
CGTGACAGCCTCGGCCGTGGTCACCACCAGCCTGGCTGCCGTGCAGGCCCCAGCCCGGTC
TTTGGTGACGCAGGTGTCCCAAGGTAAAGGTGGTGGGTTTCCTGTGCCCGTCCACCCTGA
GAGGCAGGACTCGGCTCCCGTGTTGTGGGGAAGGGAGCAGCGTCCGCTAATGAAACAACC
TCTCCAGCCACAGGCGTGCAGCTCCCAGGGAAGACCCTCACGCCCGCACACTTCCAGCTC
CTCCGGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCGCCGCCGCCTCCACCGCCC
TCCCAGGCGCAGGTCCCGCAGCTCCAGGGCCAGGCCCAGTCGCCCGCACAGATCAAAGCT
GTCAGCAAGCTGACCCCGGTGAGCACCTCCTGGGAAACCACGGGCCCAGTGGGTGGCGCT
GTGACATGGCGTAGCTCAGGTGTATTGTGCATAAACGCACCCTAGTCTGCAGGCGGGAGG
TGAGTGTTGTCTTTAGAAGTAGCTTGTTGGCAGCCTCTGGAGGCGCCTCCCACCTGCTCT
GTGCTCTGTGCTCTGTGCTGTGTGCTGTGTGCTCTGTGCTCTGTGCTGTGTGCTCTGTGC
TCTGTGCTCTGTGCTGTGTGCTCTGTGCTGTGTGCTGTGTGCTCTGCTGTGTGCTGTGTG
CTCTGTGCTGTGTGCTGTGTGCTCTGTGATGTGTGCTCTGTGCTCTGTGCTGTGTGCTGT
GTGCTCTGTGCTCTGTGCTGTGTGCTCTGTGCTCTGTGATGTGTGCTCTGTGCTCTGTGC
TGTGTGCTGTGTGCTCTGTGCTCTGTGCTGTGTGCTGTGTGCTCTGTGCTGTGTGCTCTG
TGCTGTGTGCTGTGTGCTGTGTGCTGTGTGCTGTGTGCTCTGTGCTCTGTGCTCTGTTCT
CAGCTGTGTGCTGTGATCTATGCTGTGTACTGTGTGCAAAGTGCTGTGTGCTCTGTGCAG
TGTGCTGTGTATCTGCTGTGTGCTCTGTGCTCTGTGCTGTGTACTCTGTGCTCTGTGCTC
AGAGCTGTGTGCTGAGTGCTCTGTGCTGTGAGCTCTGTGCTGTGTGCTGTGTGCTCAGTG
CTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCCCGCCTTGGCCCCCCGCCGCCCACCGCACAGGTGCAGGTGCAG
CCTCCACCGCCGGCACAGCAGCCGAGCCCCCAGCTCACCACCGTCACCGCCTCGGGGCCG
GAGCCCTGCTCACGGGCACCACCGTGGCCAACCTCCAGGTGGCCCGGCTCGTAAGTTCCC
CTTGAGGCGCTGGTTTTTCCCACGCTCCTGCACGGCTCCTGCTGCGTGGACGCAGGTGCT
GTGGCGGACTTGCGAGTCAAGTAGGTGTGCTTCCCCCCAGGACCCTGTTCTCCTTGGAGA
GGATGAAACCCCCTGGGGAGCGTTTAAGTGACTGTATTTCCTGGAACTGAAGTGTCACAG
CTCATGGCTGAGCGCTCGGGGAAAGGAGGAGGGCAGAAGCTCGACCATGGAGGGAGGGCA
GGGTCTACGTCGGGGACAGCACACGGGCATGCGGGAGGGGTCACCGTGCTGCAGGGCCTG
CAGAGAGGAGACGGGGAGGAGCCAGGTGAGGCTGCTCTAAGGACGGCTCACAGCACCTGG
GAAGCCCCGAGAGACGAAGGGGAGTCGGAAGGTCCTTCACGTTCCGCTGTGTCGATGCAG
GCACTCCGGTCAGGCCAGGTGGCCGGCTTAGGAGACCCCATCCTGGCACGGGTGCAGCTG
GCATCACCTGCCACCTGATGGGTGCTCAGGCAGGAGGGGGTGTTTTAATGTTTCCCCACT
TCGCACGGGCAGAACCTGAAGCCGGCAGGTGAGGTCACCTGCCCAAATCCTAGAGAGTCA
CCCGCTCGCTGGCTCGGCTCTGCCAGGCGGGACAGAGCGGGTAAAGCCCGAGAGCACGTT
CAGTTCCACCCGTGTTCACGTGACAAGAAAGGGCTTGGACACAGTGTGATAAGAAGTTGG
TGGCCTTCACGGGAGTCTCGGGCGAGCTCCAGGCTGATGGTCAGGGAGGTCTGTGGGGAA
CAGCGCGGTTGGGCGGCTCGAAGGACAGGAGGTGCGGATGCCGTGTGACTGATGAGCTTT
AGGTCCCGCGTGCTGGTGATGGTTGGACAGCGGGGGTCAGCCTCCGGGGAGATGCTAGCC
TTTCGCTGCTGCCACTTCCCACCCTGCGACCCGTCCACGTCTCGCCACGTGGCCTCCGTG
GGCGATGTTTGCAGACACACAGGTGGCTGAACCTCTGGGCCCTTCTTTCTGTTCAGACGC
GGGTCCCCACGTCACAGCTGCAGGCGCAAGGCCAGATGCAGGCACAGGCGCCCCCGCCGG
CGCAGGTGGCCCTGGCGAAGCCTCCGGTGGTGTCCGTGCCCGCGGCCGTGGTCTCCTCGC
CAGGCGTCACGACCCTGCCCATGAACGTTGCTGGGATCAGTGTGGCCATCGGGCAGCCGC
AGAAAGCCACAGGTGCCTGCCCACGTCCGCGGGGCCGGGAGGGGCTGGCTCCCTCGCCAC
ACGGCCGTGCCGAGGGCCGTGGTGCACTCGAGGGGAAGCCTCGCCGCGTTGCCCGAGTAC
AAGTTCTGACCCTCGATTTAACCATTAACATTGGGAACTTCCCATCCCTTTATCTCAGCG
ACTGTCAGCTGCTGTGCCCCAGAGATGTTTCAACAGGCAGTAACTGGCCATGTAATGGGG
CACTGACCCCTTCCCTGAGAGCAGGGGTGGGGAGCCTGGTCTGCCCAGGGCCATTGGGCA
CTTGCAGCATCGTTCACAGGCCAGACTGTATCAACTTAAACGTGAGCCTGCGACATCTGG
TCAGACATTTCATTAACTCACCCCTAATGCCTTGGCAGGGCCAGACCAATGATTTCACGG
CCTTATTTGGTCTGTGGGCTGGACATTCCCCACCCCTGCCTTAGATTGTCAAGTAAAAAA
CTGACAACCAGCAGTAATAGCCATCGCTGTGAAAGAATCAAAACTACCTATTTTTCTGTC
AGTTTGGTGAGCAGTACTGTTGGTGTGCCAGGAGGGAAAGGTGACAGTCGGTGCTCTGAG
TGTCCTGGTGGCCGAAGAGCATCTCGGGTGTGTGCAGGAGGTGCCTGTCTGTCTTGCAGG
GTCAGGGTGCCGTTCTCTGTAGCAGGCAGTGACTTAGGGGAGCGCGGGGAACGCAGGGTG
AGCCTGCCTCCGCGCCTGACTCACCCACTCGATGGTGTTCGCAGGACAGACCGTGGTGGC
CCAGCCCGTGCACGTGCAGCAGCTGCTGAAGCTCAAGCAGCAGGCTGTGCAGCAGCAGAA
GGCCATCCAGCCGCAGGCCGCCCCGGGCCCGGCCGCTGTCCAGCAGAAGGTACTGGCTCC
TGCGGGCTCTGGGGTCACCCTGTCTGTGCTGAGCCGGGCCCTGCCACTAGGCACAGGGTG
CAGAGGACGGGGTCCGAATGGGCCCTGCCTCGCTGCCTGACACCCACACAGGGGACCCCA
AGGGCGTGCATTTGGGCTGCACAGAGGGTGGCCTGGATGTTGGTGCTGCTCCAAGGCCCC
GGGGGGGGGGGGGGGTATGAAAAGGGGAGCTGTGTTCACTGCGGGCTTTTGGGGAACAGT
GAGGACTCAGGCTGTGGGCTGCATGGCTGGTAAGGGCCACAGGGTTTGGGGAAGTGTGTG
ACCCGCCTGGGCGCTAGTGCACAGAACCGAGGACCCAGGCGGGGACCTGGTCCTGTGTGT
GCTCGAGGGGGGAGGGGGAGACGGCCTAACGTGAAGGAGGCCTGTCAGCGTCTCTCTGAC
TCGGAAGTTTGGGGGAGGCAGCACTGAACTGATTGAGGCCCCAAAGCAAACTCCTGCTCA
GGAGGCTGACCTCCGGGCGAGGGGACTCAGGAGAGGCTAGTGGCCGGGGCTGCAGGTGAG
AGGGGACAGCCTTGTGGCTCTAACCCTGGGCGTCTTTCTTCAGATCACCGCACAGCAGAT
GGCTGCGCAGGGCCAGCCACAGAAGGTCACCTATGCCACCCAGCCAGCCCTGAAAACCCA
GTTTCTCACCACACCCATCTCCCAGGCGCAGAAGCTGGCCGGGGCGCAGCAGGTGCAGAC
CCAGATCCAGGTGAGCAGGAGCCCAGGACAGGGCGGGGCCGCACAGCTTCCTTGGCCTGA
GTCACTTCACCTGTGGGCCCCCCTCCCAACCTGGAGTGTCCCCCAGACTTGAAGAAGGGG
CTCTGAGACCCGTGAACGGCTCGTCCTCATAGAAAGTGTGAGACCAGGTTACATGGGCTG
CAGACCAGGAGGGGTCAGCACGCAGCATGAGGTCTTCTCTCGGGCCAGGAGAGCCCACTC
GGGGAAGGCTCTTTCCTGTCACCTGGTTTTTTGAAATTAATAACCGAGAAGGGAAGAAAG
GGCGTCTTTCTGTGCGAACGCTCTGAACTCTGCACCTGGCTCTTCTCGTTCTGTCCAAGG
TTGCCAAGCTCCCTCAGGTTGTGCAGCAGCAGAGCCCGGTGGCCGGCATCCCACAGGTGG
CCTCCGCCTCCCAGCAGGTAGGTGCGGAGATGGCAGCCGCCTGGGAAGGTCCCCCGGGGG
CTTCTCAGCAGCCTCTGTGTTTCCAAATTGAAAGAGTTCTTGGTTTTCCTCCTGAGGAAG
CAGAATTCTGATGATTAGAGAATCACTTTGATTTTCATAATACAAGACACCAGCAGACTC
AGGGCCAAAGGTCCCAGAGGATCAGAGCTTCAGCCAGCAATGCCAGGTGTCCTTTGCGGC
AGGGAAGCTAAAGGCGTCAACACCATGACTGGGGACAGCCATGACTCCCTCCTGACTGCC
TGACGGGCGGCTGTGACATTGATTTCCACTCAAACACCTTTGTTTTCTGAATCACACTGG
AGTGTGCATTTCAAGGAATCAAAGACGTTGACCCTTGAAGAACGTGGGTGTAGGGCTCGC
ACCAGCCGAGCAGCTGAGAGTGTCTGACTTAGTCTGCCCTCCACATACCCCCCCCCCGCC
CCAGCCTCGACTGCTGCCCACTTAGCAGATTCCACGTGCACATTCAAGCCGCGTGGCTCA
AGGGACAGCCTGGCAGTAAAGGCTGAATGTCACCACCACCACCAGTCCCGGCCCTCAGCC
CTCGCCTCCCAGGGCATCGCTCTAGCCCGAGAGGTTTCGTTTTCTACTCGTTGGGTTAAA
GGCCAGAGGCCCTGCTTCCACATGCTGGGCAGTCCTCACATTCTCCAAAGAATTCGTGCT
CATTAAGTTCCTGCCCCCTCCCGGCCCGGAGCCTGGGGTCTGTCCTGCGCTCGGTCTGCA
GGCCTCGGTGACGTGTCTCTGTTTTGGCTCAGGCTTCCCCGCAGACGGTGACGCTCACCC
AGGCGGCGGCAGCGGGGCCGCAGGTCCAGGTGATCCCCGCAGTGACCGCGGCCGCCCAGG
CCGTCCAGCAGAAGCTCCTGCAGCAGCAGGTGGTGACCACGGCGGCGGCCCAGCTGCAGA
CCCCGGGCGTCCCCACCCCCACGCAGGTGCCGGCCAGCGCTGACAGCCCCAACCAGCAGC
CCAAGCTACAAATGCGCGTGCCTGCCGTCCGGTTAAAGACGCCCACCAAGCCCCCCTGCC
CCTAGTCCGGAAAGCGGGCGCCGTCCTGTGGAACTGGGGGCCGTGTCCTGTGACGTCCAG
CCCTGACGCTGCGGCGAGGGGAGCCGCCCATGCAGTGCTCTCGGGCCGCAGCTTCTGTGC
GACAGCAGGAGGCGCCTCGGCAGCTTCTCCGGGTCCTTCCACCTCCCAGCGCCTCCAGCG
CCGCACATCACGGGGCGACTCGGACCGTGAGTCGTAAACACGGTCTGGGCAGCACAGCGT
CGGCCTCTGTGGTTCTTTAGACCCAACGCAAAGCGCATCCTGGTCCTGGGAGGAGAGGCC
ACCTGAGGTCGGTCAGCTCAGATCCGGGACGGCCAGGGTGGCTGCTTCCTTCTCTACGTG
TGACTCTGGGACCTTCAAAGGAGCATCTGGTCCCCGTGCCATCGAAGCAGGTCCGCGTAC
CAGCTCTCGTGGAGGGACGACGCTGGGGTTGAACTTTCATTCCAAAGAGCAGCCAGTGTG
ACTCGTTTCCATGCAGGTGGCGCCTTCCGGCCGCTCCCCATCCCCACGCACCTCCGTCCT
TCCCAGCTGTCGGACTTGGCGCTGAGGCAGCTCCAGGAGCTGAGCCCTGGTCTCCATTGG
TCGGGCCCAGGCAGGTGTCACAGCCGCGTGGGGCTCAGGGAGAGGTGCCTGTCACCGCTC
GCCCGGCTCAGGCCCAGCCCGGCCCGGCCTGTCTGCAGAGCTGGGCACCTGCTCACACAG
TGGTCGCTGTGGCTCTTTCCGTAGATGAGACCTCAGGTTTCTGGGCCAGGGCCTCCCCCA
CAAGCAGGCACGTGCCATCGTGGTTGTGTGAGGGTGAACCCTGGCTGAGGGCAGAGGCCC
CGTGTTTGCGCTTGCGTCTGTGTCTTCTCTGGCGAGATGGCAGCAGCGGCTGCAGTGCTC
GCCACGCACACTGCACTCCAAGGACGCCTCTCTGCTGGGGGCGTCCGACTCGGTCCCGGT
CGGCTCTGTTAGGTCTGTGTGTGCGGAGATGAGCTGCAGCGCCTGGGAGACGCGGGACCA
TCTCTGCTCCCCTCCCCACTGAACCGCTCACTGGCAGGGGCGGCTTCTGTCCGGTGTTGG
TTTCCCTCCGTTTGTGTGGACAGCAGGGCGGCGACACTTGGGGAGCCAGTGAGTGAAACT
CTTGTGCGACATTTGGAGGAAAGTAAAAAATCAAGTGTTGAAAAGGGAAGGTATTTATTT
AACATTTCAGTGAGCTGAACGTATGGAAACAGGACCGTCAGCCAGGCCTGTGGGTTGTGT
TCGCTACCAGCCGGCAGGCAGGACGGCGCCGAGGGCTCTGCCTTGTCACTGGGAGACGGC
CTGCTCTTCACCCTCATCCTTGCGTGCAGGGTCACAGCACAGAGGTCGTGTTTTCGGCTT
ATTTGTTGTGCAGTTTGCGTTCTCGTCCTCCCGAGGGTGCTGGCCGTCCCTCAGGGGCAA
TGGTGACGCACTTCGGCTGCCTGGACAGAGCTGGGCAGGAGCTCCTGGGCAGAGCCAGCA
GGGAAGGCGGCTGCCGGCCGGGTGGAGAGCAGCTGCTCTGCGGAGGGCCTCGCTCAGGTG
CTTCCTTCAGCCACTCCGAGGCGAGATGTGGGGCAGAAGATTGTCCTGTTCTGCTGGGTT
CGTCACAGCACAGGTCACCTGACCTCGTCAGTGGTCACGGAGGTAAAAACCCTCCTTCCA
AAGTCCACACTGAAGAGTTAGAATGGGTTTCGCAGGCCGTTCCGGGGCCTCCCCCATCGT
GCTGCCTGGGACCAGGCTTCTGCAGACACTAACGAGGGAGCTCTCGGATGCAGACCCAGC
AGGACTGACCACTCGAGCTGCCCCCCAGGGGCAGGCTTCCCTAGGAGACGGGTCCGACGG
GAAGCAGGAGCTGGTCCGCGCGCAGATGCGTTCCTTTTGCGACCGTTAGGGTTTTTTGTT
AAGTGTTGTAACCAAATAGTTGTTGTGTTTAGGATTAAAAGACTGAGGATGTAAATACTT
TGTAAACAATCGTTTGTACTTGAACAGTAGGGTTTTGAAGAGCACTGATCCCCCCCCCCC
CAGGCATAATAAAAGTCTTTTTCATATGTTTTTCGTCTTGTCTCGTAGAAAAGTAGTGAA
AGATGCTGGTGGTTTCTTTCAAGCACTTGGCAAAGGGCTTGGTGAGGCTCCCCAGCAGGG
GGTGGGTGCAGGCTGAGGGGGGACAGGAAACAAGCCTGGGCTGCAACCCCCTTTGCGCAG
CGGACTCCAGAGCAGCCACAGGTCTCACACGCGTTGCACTTTTTAAAAAATATATTTTTT
TTATTGATTTGTGAGAAAGGGGGAGGGAGGGATAGAAACATCCAAGATGAGAATCATTGA
TCGGCTGCCTCCTGCACGCCCCCTACTGGGGATTGAGCCCAGGACCCTTCAGTCCACAGG
CCGACACTCTATCCACTGAGCCAAACCGGCCAGGGCTCCCGGCACTTCTTAACTTTGTAT
CAGGGCGCATTTTTTTTGTCGGGGAAATCACTTTAATAGGCCTTTGGTTACAAGGCAAAG
CCAAAGCTCTGTTCACGAATAAGAATGTTCAGGAAATCAGAGGGAAGCCTTCCTCAGACC
TGGAGAGCAGCGTCGTCCTGCAAGAGGGCCCCCCACCTTCAGGCTCAGGTGCTTCCCGCG
GCCGCACAGAAGGCAGCGCACACACTGGGTTCCGGGCTGGCCCAGGCCCCGAGCCAGCAG
CCTCAATTCAGACGCAGGCCCCCACCAGGCTCAAGGCCCCCGCTGAGGGAGGCGGCGTGA
TGGCTGCAGGGGCCTGCATGCCAGATGCCAGAGCACGAGCGAGCCGGCTCCACGCTTGGC
GGCTCCATCCGTCGGCCCTGTGCCCCGGGCCTGCGTGCCAGGGGTGGTGGGCGGGACTGC
GAGGCCAGTGAGCTGGCTCAGTACAAGCGCCGGGACGCGGACGGTCTCTGCTGAGGGCCC
AGTGCCTCTGCCTCCTGACCCGTCCCTGCCGTGTCCACCCGAGAGCCTGGGACCAGCTGT
TCTGCTCGAGTGAACCATGACCTTCGGCGCAGAGGTAGACACCAGCGCGTCCCTTCTTGA
GTCCGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2470, 11556..11646, 13097..13204, 13708..14090, 14683..14976, 15594..15779, 16167..16307, 16786..16864, 17590..17639, 17993..18050, 18748..18834, 19760..19867, 20666..20856, 21058..21235, 21990..22126, 23061..23232, 23464..23638, 23725..23861, 24744..24930, 26398..26564, 27900..28069, 28795..29025, 30777..30941, 32445..32600, 33365..33459, 33710..33981, 36172..36374, 36445..36614, 37929..38125, 38864..38975, 39137..39281, 40087..40224, 40655..40738, 41075..41209, 41379..41423, 41503..41656, 41863..42104, 42216..42389, 43160..43296, 43426..43482, 44171..44249, 44331..44585, 45534..45579, 45654..45763, 47161..47362, 47467..47687, 49041..49189, 50216..50411, 51164..51288, 51883..52029, 52379..52456, 53252..55585
1157..2470, 11556..11646, 13097..13204, 13708..14090, 14683..14976, 15594..15779, 16167..16307, 16786..16864, 17590..17639, 17993..18050, 18748..18834, 19760..19867, 20666..20856, 21058..21235, 21990..22126, 23061..23232, 23464..23638, 23725..23861, 24744..24930, 26398..26564, 27900..28069, 28795..29025, 30777..30941, 32445..32600, 33365..33459, 33710..33981, 36172..36374, 36445..36614, 37929..38125, 38864..38975, 39137..39281, 40087..40224, 40655..40738, 41075..41209, 41379..41423, 41503..41656, 41863..42104, 42216..42389, 43160..43296, 43426..43482, 44171..44249, 44331..44585, 45534..45579, 45654..45763, 47161..47362, 47467..47687, 49041..49189, 50216..50411, 51164..51288, 51883..52029, 52379..52456, 53252..53524
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved