Myotis_lucifugus Locus EIF4A1
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus EIF4A1
Myotis_lucifugus
EIF4A1
scaffold_690
SNORA48, SNORD10, SNORA67
3826..3970, 4818..4956, 5941..6082
7649
gttttctgatgtcagggggtggccgtggaaaagcccctttttccctcgtctgcagggga
ctattgtggcctgggtgggacagtgatcctccttccatgtgtatgggtgggcccaggaaa
atctgctggggtggcgggcgggcaaagggattactgcctgccagatcttcaaactttttt
tacatagatatataaatgccacggtcctgctctggtcaataaaggatcctttggagatac
atagtggtggtcttccttcagggatatgctctacctcaggctttcctccattcggtgccg
tcagctacccttttgtgggtcttgagactgaagtggccagtttgccatccctggctcaga
cagtgccaacaccacgtcttagtcaccaaaaagaacccccacccagaggagcaaaggacg
ggagaaggagcgtaggtaatcctcaaaaataggggagcctgagagcccctaaagttgggg
aacaggtcacttaagggaagggagccagccaggattcgagacagcaaccccaatgctctt
aagcccggaagtcagttatcccatccctccccctccagccaggggagccctcccagcccc
tagggtacggctcctgatcccatcctccctgcacacttggacacatccggtttgcccagt
ctctctgctggagaacaaaatgtgggtccagagaacacctggggcagaaggcaaagggac
gtggtagtcccgggagcccggaagtccctggaggctgaaacctcgcccccttttcatgat
agggtctacgaggccacatgacaggcactatcacctccgcacgtgtagaggtgcagggcc
ccaagatggctgcctggcctcgaggccagagtcctgtatgtcacttccgtaccggtgaga
agggcgggcccagcagccaatgaggctgtggggcgggtcaccaacttgataggcgctcaa
attacccaatggtggctacgtgccagagcgcctacaaactaacgtcacgccgagttgctg
agcgccggcaggcggggcccaggcggccaagccaatgcgatggctggggcggggtcgggc
gctctataagttgtcgataggcgggcactccgccctagtttctaaggatcatgtctgcga
gtcaagatccccggtaaggaaggcgtttgctcgagctgggggctacttaccctgccgttc
ccttccgaggcccccgcggcggggtggggagagccgaggcccacagggtgcggggaaccg
agccaggaagaccggccctggggggcgcggggcagatccacggcggagggcgaacaccgc
ctggctttcggggcctggagtgcgaggtttgttaggcctcgacccgagacggtgcccgga
gccctggcgctgagtggcggggcgaggtcgcgacccagcgtgagaaagggaggcggtcgc
cgccgcgcgtggcccggagccgggcggccgggtggcctccgccggaggacggtctggcgc
gcgctggattccgcaggattctggcggaaccactggccaaggcgggggggcctgggtcct
cacgtccagtcgtggcgtcgcgttgagacacgggtcgtgggggaagcagccggccgttca
gtgctggtttcttggcggcccggattgagcctcagcccggggagcagccgcgtgaggcgc
caggagcccacccggcacccggcgggcgggtccattttgccgcacaagccgggcaattgg
caaactgcggatgggcaggtccactttccttcgggggtgagcgccctgaggtatggggag
ggcgacgccatttcgcgacgggggcgggcagggtgtgggtggttccatggtgggggggtt
acgccgccgggtggtcgagggagcgagcacatggcggcctgatgtcctcccctcccccag
cccgcttcgcctttaagtgttgtgcaatctccccattagctagctcggctggggctcatt
gtgcgcgaggccgccaccgcccgcggcctcccacatccgggcaccgcgagggagggggga
gatgggctgcagggggtgggggagggcgccaacgcagtgacgtggggggaaggggatgtc
ctacacaacagggaggtgaagggcgggacttccggatcgctggggcggtgatgggaggtg
caccagctcggcctcggagcggcccggcccgaagcacgtgggcctggcggcaaccaccac
ctccaggcctgcgggtttttctaggcgagttaccccatcatgtcggaatgggatgacctg
agccgctcctgggaaggggcaaaggcctgattcagttacagatgtaactgctgtgtctgt
aggaactggtaggggttgggttagggagcgaagatggcatcgtgcaaggtggggttgctg
gtaggaagagccggctaccaagatttgtctcgtgcctcagtatactcatattttaaacca
acagatccagagacaatggccccgatggaatggagcctgaaggcgtcatcgaggtgagaa
tagagccctatcaccattatccttcgttttggagaggggcagtgtcccctggtttctgga
ccataccctgggattcttctttattgcatagcctaaccctgagtaagctcttctcactgg
gagtcttaacttttatatataatttgtttaaaatatttgtgttcctgagattatgtgtga
aacgtcattcaaattggtcctgttaatcccttctacaagcaccagcctcacagttttcaa
gtggactggtccctagagtgatttcctaggcaatgtagaatcatctggcttccctggagc
gggtgggaggaggttgttgactctgaagctttgagggcacaaggtcctatttgctccagt
gtagagccctgtttatactactttaatccctttgcatcctacagagtaactggaatgaga
tcgttgacagctttgatgacatgaacctctcagagtccctcctccgtggcatctacgcct
atggttttgagaagccctctgccatccagcagcgagccattcttccttgtatcaagggta
agacctctgctccaaaacatgttctgaactgtccctgggtagagttgcatgtgttcggtg
gtgcttgtctcattagccagggacaaaataactcctttatttacactagcttggcttggc
ttttggtctgtgctttgagaggggtagtattttagccagctcataacttcctctttgcag
ctatatttctagcttatttcatgcagtactaaatgagttaataaccagatctgttcccat
taaagtactggttgtggtagaataaagtctgaagtgctttgtgcttggcacatagctctc
ttcggtgcttattgagtgttttgtaaggccttgaatgtctcatgatcccagagtgtatgc
tctctaccatagcgagtctttctcctgattttaggttatgatgtgatcgctcaagcccaa
tctgggacaggaaaaacagccacttttgccatatcgattctgcaacagattgaattggat
ctaaaggccactcaggccttggtcctggcacctactagagaattggcacagcaggtgaga
ttgtagtttatttctcctcccctgaaagactgatttagaaataattagcacaatccaaaa
atctgagtatgctccccaaccactaccaccaccaccttgggagaactgaggtatctaccc
caacacaataaacatcatttcctcctcccatttcctgagtcaaatgggaaggcttctggg
tggagcctggctggctgagcaagtctggcagctgttttatggacaaaccccctggcaatg
ggcaaggagacacctgattggtggtgttgctcttatatcagtcaggggcaaagcagatgt
acagtccttagttcatcctagcttgatgcctgtgtcggtggccagagctgtttcatgcct
gaggcacataaaatgataattgctaggtcttggaggggaaaagatcagaaacactggtct
cataagtaaattactaatattaacaggcttaggggtgtagttctaaagtttgtggagctg
tgattgctctagtaacttgtagattaacagtaagcaggtagttctagtacaactccatta
agagtgaacatgccacctaacagttctagtggcagggatatatgttattctgcacatgaa
actgggtgctatgagaataataagtgggtcgctgtttgctttcagaaaattgggtgggga
tctagtatggtaatattggaattatttcagagggcagttactgtgaatcatgtattctca
ggagccagaatgttcaaatcctgagtctctgccatttaactgtcagtgtgatcttagatg
catttaacctgcctgtttctcgcctgaaaagtgagttttaataatagtgcatataagttg
gaaaaaaataaaacatgagaagcacttaaaatggagcctggcacagttgtagctaataat
aatatatgagcatctgtctttttctgggttcagatacagaaggtagtcatggctttagga
gattacatgggtgcctcctgccatgcctgcattggtggtaccaacgtgcgtgcagaggtg
cagaagctgcagatggaagctccccatatcatcgtgggcaccccaggacgtgtgtttgac
atgcttaatcgcagatacctgtgtgagtatcttaattttctggtcctctaggtcacttgc
ctcttctgcatgctttcccagtctttccactggccacaatcttgttgccaatgaagctcg
ttttcccctgaaagagttgctctatgatgaaccccatgcgtgtcatctgagcctggcttc
cctgtctcagcccaggtagtgttctacttcccagggctattgtctggcctggcaaggggg
gtccctggcaaaggatcaaaatttgaattctgagagcagatcacctatccatttctggtt
cttcattgggaaagttaagcatatatcacgtttccctcattaccacttgtctttctcccc
cctccccccgttctgtagctcccaaatacatcaagatgtttgtactggatgaagctgacg
aaatgttaagccgtgggttcaaggaccagatctatgacatattccaaaagctcaacagca
acacccaggtgagagacatttagtcttgcctttatggctgatccttcatagattggggtt
ggggtggtagaacaagaatgaggtgccagagaattctagcctcgagcctttttatgcact
agcttgttttaggcggcttggagtagctcctgtcctagacttgctgtatttttccccctt
aggtggtattgctgtcagctacaatgccttccgatgtgcttgaggtgaccaagaagttca
tgagggaccccattcggattctcgtcaagaaggaagagttgactctggagggtatccgtc
aattctacatcaatgtggaaagagaggtggggcccagtgcaggaggcggacctggtagta
agtagtcggggtatagccccctgactgatttttcttccccaacttcacccccaggagtgg
aagctggacacattgtgtgacttatatgaaaccctcaccatcacccaggcagtcatcttc
atcaacacgcgaagaaaggttgattggctcactgagaagatgcacgcccgagacttcacc
gtctctgccatggtgagatttcccctcttactaaccagcagtgtgtacgagtcagtagcc
cacttaagccagttttcagaacccatgtgcctacactcttctttcccatcctagcatgga
gacatggaccaaaaggaacgagatgtaatcatgagggagttccgctctggctctagcaga
gtattgattaccactgacctgctggtaagtaaggggggatttagacaaaacagaagggag
aaaccaaggtgattccctctccaaggggactaatagtgcccctcttccggaaagtagcaa
cttggaatagaatctggcatgcctcaggttttcaggggaggtgatacaccatttccttgg
cctgcctttggctgcctacatgtatactaaagtcccaagttccttctgggtggcctctgc
cctcttctcactcacgtgctgaagctgtcttattttcttgccataggccagaggcattga
tgtgcagcaggtttctttagtcatcaactatgaccttcccaccaacagggaaaactatat
ccacaggtgagtgtgtttacccagcccctcatgcccagtcctcgctgggctgaagcttgt
tttctctttattgtgtccccatgcatcctaaggtgtccttcttttccagaatcggtcggg
gtggacgttttggccgtaagggtgtggctattaatatggtgacagaagaagacaagagga
ctcttcgggacattgagaccttctacaacacctccatcgaggagatgcccctcaatgttg
ctgacctcatctgagaggggctggcctgctgcctcggcccagccaggctgaggaggagca
ggaggggggagggaagggagccaagggatggacatcttgtcaattttttttctttttttt
tccctttgaataaatgtcactttttgaggcaaagaaggaaccgtgaacaatttagatacc
cttttctttggggtaggctcatgccccaggcgccgtctcttctcccaaaaacactaatcc
acttccctaacctagtcaacctccaaaccccagagactccctgctccagccaaattcctc
tgaaaatgattcttcaagggggctatgtcactcaacctcatttactggaccaaatctgga
gggagaacccttgagttaggtggcccaggggattgtccccatgtggggggagcaggggag
aaaaaatagtagccatttttacattgttttgtatagtatttattgattcaggaaacaaaa
ttctgaataaaattacttggaaactgcctgtttgggcttctcatttcttccccttcccac
ctgctatggggtatatatcccctcccccaagctgatattttaccccagtagttctcaacc
ttctggccctttaaatacagttcctcatgttgtgacccaaccataaaattattttcgttg
ctacttcataactgtaatgttgctactgttatgaatcataatgtaaatatctgatatgca
ggatggtcttaggcccatgtgatcaccaaaggggtcgcgacccaccggttgagaaccgct
gctttaccttctgtgataagtcatttaacagtgacccttctgtagggttgggcaatcccc
gtcacaagtgcctcacatgtctcagtcacgaggaagtgatggatggagggggaaatggga
ctggtaacttgatttttacattgttttctttggagatcagagaggggctgcatttcaact
ggttcagtaatcatttgccagaaccgttgggttttgttgaggtacacaaatgggtcccca
aggatcaacacttaactcattctccccacatgatggtcttgattctgacagctcccactt
gggtgaagccagggccaatcatgtagtgacaaaaacttaatgactaagtggtgtttgggg
ctgaggtgcctgagtcaggttgtggggcag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1152, 2464..2512, 2924..3056, 3454..3593, 4533..4701, 5058..5167, 5342..5485, 5574..5711, 5814..5903, 6166..6245, 6349..6649
1130..1152, 2464..2512, 2924..3056, 3454..3593, 4533..4701, 5058..5167, 5342..5485, 5574..5711, 5814..5903, 6166..6245, 6349..6493
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved