Myotis_lucifugus Locus RPL27A
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus RPL27A
Myotis_lucifugus
RPL27A
scaffold_61
SNORA3, SNORA3
2395..2525, 3653..3781
5059
tgatggacaaaaatagatacagagcagcatggaacagactgtcaaactacagcaggaag
gcccgggagggtttcggggcaggaggggggaggtaagagatcaacagaaggacttgtatg
catgcatataagcataaccaatggacataagacactggggggtaggggaggccaggggat
tgtcaagggcaggaaaaaaaggagacatatgtaatactctttgtaatactttaagcaata
aaacaaaattttaaaaaaagaatatggtgacagtgaaggtaagtgtattcattctcttaa
ccatttgttgaacatgtactacctgccaggaactgggagggcatggataaaaaataatcc
tcgaggctttaaggaatttggcctagtagggaagacaaaggtggacccacaattacgtta
gagctatgtgctaagttttgtggtggcacaagtggagtttagtgagcaactatgaatggg
gtcaaagaagtttcccaagacgcctgttttgggtacaagttacaagttgagcaggggttc
tctggcagggaggtaggggcatgtgtgtgtgtatggggggggggggggggggggggtcac
cggcgtgtccagttcgggtgaaaatttacatgtggtggtaagaagacttacaaggcctgg
ataaagaaggctgtaaagcaaccaggcatacaggtccctggagtacagcaggttcacact
gagagagccttagattacagcacagaggcaaagggaaaaggaagacccagcgcgcactca
ctgaggggggaggggagcagctcccatgggtggtagagacatttagggaaagactgttcc
agggcagcagagcgagacattgggtggacacgctgagggtccaataaatatagtgcctca
ggctcctccccgcggccggggcgaggagcgtggtggcgctcgcggatggcgggtgtgacg
aggagctgagctacggtggcctagcacgtccctgggccatggcgtcaggaaacgggcccg
gcccacagcgccccaagtctcagatttcgggacaactaccggcctccgagcctgtccaca
gggcgggctgcatggagcacggttcccggcggccataccggcaagacagccagggacagc
ggcgaccgcctacaggaagaggaagcggtgctgcccgcagccgcgcggcagcctaaacgc
gccctaggtccgccctccccgggcggaagtgaggccattgggcccgccccgcgtcccata
cctcgcgagacttcgcaagagccttcctcttgcaactcggccgccgacatggtaggttat
tcttatctcgcctccctttcaatgcgggcaccagaccgcgatctctgctcgctctgcacc
ccggccacctaccctcgaccttagccggctctcccaggtcgcacatggcgggccgcaggg
tagggggccggcctgggcccggatgcccgggccgcgtgttcggcccggggttgggatctc
ggagaccggcggtcccgggcgccgcccggaggaggccgcgtggcgccgggccagtccgcc
cccggtgcttttctgagatcgcggcaccagaccgatcctcgatcttcaggcccgcgggcc
gctcgcagtccggcaagcttcgcccctgccccacctttcttgggccttatcccacgcacc
tttctccacacagccatccagactgaggaagacccgcaaacttcggggccacgtgagcca
cggccacggccgcatcggtacgtacccgcatcccgtcctgctcggccctgggctctgcct
gcctggtgctcagctagtcaggaggcagatggcttagaagtgggttagtaagaactttgt
gcagccgggtcggattgagtctgacctacttctttgggatcctctagtatttcacttgca
gagaatagcacatgggcggggggcaggtggtagtgaaaatcgagcattggttgaaggcat
gagtgctgtggtggtgctgcagagagatgcttaaatcggagtcttaaaggagtcgcagtg
ctgacagtactgcggactaggagcggcagaggctgggggagactggccaggagtgtcgga
cggggagggctctgctctgttagccacagaactctcctcctccaggcaagcacaggaagc
acccggggggccgcgggaatgctggcggcctgcatcatcacaggatcaacttcgacaaat
agtgagtgtttctcgggctgtattttaatgacagtttgggggtgggagtgggctgggggc
tggggaggccggctccaagcatcttaaatgggaagcacgcctcctaaccaccacaaacct
tgcctgttgttggcttttaccgagcgaacacttgatgtgagctgagaaatttgtcatcga
ggctagagtcacgcttgggtatttgctgttgccttagtgtgctagagtcctcgaagagca
actgctacccttattcactgactgtgggcccctgtggcacagtcagtcaccaggctagtg
acaccatcagactgacctatacctctgtaggatccacttaggccctcaaattaggggtgg
tattttaactatttgtttattatttggtgaaagatctgttttattcaaaaaatggctgga
gtggagtatctgttgtcagggttctacacccattgacaatttacactgtaatgggggaga
tagattataaagatgataaatatcacttaactggagtgaagttttgaaactggttgcctt
ctctcagtcacccaggttactttgggaaagttggtatgaggcattaccacttgaagagga
accagagcttctgcccaactgtcaaccttgacaaactgtggaccctggtcagtgagcaga
cacgggtgaatgctgccaaaagcaagactggagttgctcccatcattgatgtggtgcgat
cggtgagtgaattgtttgccttacatgggcccttgcctctcctcaaagctctgagtaacc
taatctacttgatctcccacctgagccctatgcccgattcctaactagacagttctgcct
ttgggcagaatttccagaggtaattctctgaccagaactgaattccagttcatttgtgat
tcaacaaaatatttgaagagtaatttcttctactcttcattctttcaagtactttatttt
cacttgaatgtttttcccatcagtaatttcatttttgttattttcctggtttgtacaagt
ttgcaattctcacctaaaattactggcagtttcttagctcaactggctctggtctgtttt
acacaggtctacattaggcaccgctactgacctttcatgttccctacagaataaaatcct
agtatgttttaattgtgatttcaaggccctacattatctgaagagctgccccctttcttc
cccccaaaaaatgccacccaagcttttttgtatctctctatgagtcttaacctcccatgg
gtacaggagtagtctaaatctttcagttaagtgttacattccccttcccagcctgtttac
catctcttgagcaattctggtggtcaagacttctggaacattgctgggaatgtggttttc
cttttttgcttattagatggtaattgaatgggaaaggggggtgttgggctttgcccgaga
ctagagtcacatcttgacagctattgtcctggtgtgctacagttctcggagagaatctgc
tggtcttgattcactggcgtgggcagtaagtgcccccggtagtgcccagatcagaaacat
aggcttcccagctcctaggtggaatgggttgtctgtcatctgtcctcatacccattaagg
agtgggtacctgccatcgtgtgttataacccttttctctattctagggctactacaaagt
tctggggaagggaaagctcccaaagcagcctgtcattgtgaaggccaagttcttcagcag
aagagccgaggagaagattaagggtgttggtggggcctgtgtcctggtagcttgaagcta
catggaggggagttcattaaaatatccaagtacttttgtcttctggtctgagtgtaggtc
ctttggcatctctgcttccctacctgtacttccaaaacctccctaacaggttctaggagt
tagggtatcgaggcctggggtcctctgcaaacttccctgaggaagaaagaagcctttgga
ccgatcctgacttgaacttttcatttataaagtgagaatgatacctgttgctaatgtgtg
tgtagataggtattaaatagttgaaaggtctgtttgcattgtatactcacaattcacaat
gagtggaagaatgtgtccttgactgttccatgtggctcaaaaggactgttttgatgggac
acggtctacagaagggaaaaaggagtgataggaccgaggccattcctagggagatcattc
ctgagcccaagattttcccaccgggctccctcatcttagactttggactattctagtcat
aaccaaaatcttgagatgggctccaacaatctgaatttaaacatgccaggggttttacat
atcaaactggcttgtattatagaaagcagttgtaaggatttatgggtccctgtgcatagg
aggtttcatgttcaaagaaatgtatcatgaaaattttaacaatttctcttatagactgct
gtatatctagtagaaatgtgggttatcctaaaggccagaaactgggttttgtatgtcttg
caaaacactgatcccagggtaaattataatttgctcttgtgctcagagttgtttcaaaga
tttttaaataatgacccaaaataaagcttgcagtctagaatcctggccagattaagttaa
gatagcactcaagcctactaatgaccattttgttttgggttttttgtttttaacgaccac
ttggacttgcattgtgcatgatggtgtttaaggagaaaggtgaagtgatgggttttgctt
tagtgtcttcctgagaaactatggaagctaaggccatgaatctaaaacaggtggtggtca
ggtcagtagattgagaactg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1310, 1693..1756, 2145..2220, 2767..2941, 3886..4059
1308..1310, 1693..1756, 2145..2220, 2767..2941, 3886..4014
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved