Myotis_lucifugus Locus Mono:452:SNORA7
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:452:SNORA7
Myotis_lucifugus
Mono:452:SNORA7
scaffold_300
SNORA7
1001..1140
2140
ctcgatccccagtagggggcatgcaggaagcagctgatcaatgattctctctcatcatt
gatgtttctatcgctctctccctctcccttcctctctgaaatcaataaagatatattttt
aaaaaaatactcaaggtagtctgctgaatgaaaagaacttgcgctttactcacagtgtgt
ccaacattattttggcaatttcattgcttcacaactgtgattcttggaaacttgtcacta
agattcttcagaattcttaaataactttttctgacttcatttatttaaatatcccagaat
agcctcttgagctataagtttgatgatccaggaaactatttatagcaggatgagtactcc
ctgtgaccgatgttaacgttttattttgagaagaacaaattcttaaaaagattgataggg
ttgatggtattttaaattgaaaccagtgccaaggcaaatagatatgaacttggaacataa
agagagatgggtgtgcctttttgccagtttagctaaaggctggggaggcctcccacagga
aggaaggcagagacacagtgtaagccagaggtagtaatcttttaggtggattagacactt
cagcctagggcctggcctctgtttgctcagtgcttaataacccagaatagattagtggag
acagactgtcataattaaggccaatattgtctttgaggtgattgatatgcccttaggtag
gagaaaaataggagaggaaggaaagtcaaggtcaacctaagttaaaaaacatacacaaaa
ctctgtgtgttaggggcccttaaaaaatagaatcacaaaagttactggagacttggagat
taagcttccccttcttttgaatctcatcaatttatcagacatgcttattgctgatcgcac
gctggcttcccctccacacctggaacactccttaactctcagcaagtcattgctctccca
ggtacccctgcaagtgaggcccttaaattaagattagtttccacctcgcaggatcatgtc
tggagagtggctaatattctgccagcttcggagacaggagggaaagcaagcctggcagag
gtacccattacattccctgcttgcttagtagctggtgactggaagacactctgcaacaat
gtcaaaaaaaaacacacaaaaaatagaaaaaaaaatcatgccctagccggtttggttcag
tcgccctgcagtcagggtctgggatttgattctggtcaagggctagatccccagtagggg
gcgtgcaggaggcagccaatcaatgattctcatcattgaagattttatctctccctctcc
cttcctctctgaaatcaataaaaatatatttaaaaaaactattcattaccttatgtaatc
ctaccactttacaggctggtctgaacggacccaggtagttcatcatctctgtcccttgca
tccagctcaggactggtgcttggagtatgttgggaataaaagtcctgtaggtccctcggc
ctgatttaaggacaggagtgcagtagagaacggtgcgacaatgcgtaatacaaacaaaac
aagaaaccaaggcggtgggatcgagagtggattccttcctgatgccggagcggagagggc
gctgtctttgactttgacatacctcggcttatttggagccatgttccaacagctgccctc
cccactacgggccaacctacccctaggggagtaggagagccttcggaactggagcgcaga
aggtcccaccaccggaagtttctttggatataaagaaaaaggcggaagtaggccaaagat
actccctcagcactccgcctccagcccgctctcctttcttttggaggggaagtgctcccc
agttctttgcctcggtggagagcagctgcggcggattctgtgcgcagcttcagttggcta
actccgccccccgatctttttttttttttttttttttttttttttttttaccttcccagg
ttcttcacgcctggacctgacgtacgcttgtgcgtgactgggggcgggatctctaaagga
agagctggagtcgagatctcgcgagaacatttttttcctccgcagttctcgctctgcacc
ttcactctcgtcgcaacgagatctttcgagatcttctccgc
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved