Myotis_lucifugus Locus Mono:185:SNORA74
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:185:SNORA74
Myotis_lucifugus
Mono:185:SNORA74
scaffold_1179
SNORA74
522..724
1724
tgtggggtggcaggtgggggtggcatgtggggagtaggaggtagggttggtgggtgaca
ggtgggggagggagaagagggcatggggggggtaaatggtgatggaaggagacttgaagg
cagtgaacacacaatccaatatacagatgatgcattatagaattgcacacccgacctatg
caattttattaatgaatgtcacacaaataaggttgattaaaaataagtaaaaggtgggtc
ttttgaggttgattaggttatgagggtggaccccgcatgaataggatgaatacccttttc
aaagatagcccatgctaggcttatcaggagatgactttatatgttatataaatgtctaac
cactattttgtacacttgaaactaatattgaatgtcatcccgaattgaaaaaaaaattaa
agtagtaaaacaatttttaataaaaataaaaatacaaatcagagtgatctttaaaaaata
taaatcagatcatttcactctgtgcctaaaagccttaagcgctccagcaggggtcagctc
tccagacagaatcatgcctgtgagggtgttacactgctgggagaggaatgccctatcttc
ttcctccagttgctcccttcactgttctggtgacgtgtggcactggtacaaggcagtact
gtgcttccttgagagtgagctaagcatcactttggctgcttagttgtagtgtgggagtag
acgcagaaacaataaatttaagccttaaagattctaacagcatttcgacccaccaaatgg
acctctatcctcccttccctacactccagccagcctggctcatccagccttgaggaaaga
aggcagggacagtgctgctcaggaagacagtgagcatgcatgtgatcagaagtctggaga
gagctccagttctcttaggatagaaatcgagggatgaatctgctgaaatcagccacctga
tgagggcatcacacctgcatgatcctgccatgctctcgctcccctgtggcatcccagggg
acccatgaatcagccacaacaggaagcagctctctggcctttgagaatccacagaccctc
tgcaaagcccttaagctcacagggctgatctcagactacagatcccagacatcttaaatc
ctgggaagcagcctcttttgactttttcattttcctcctacaaacaatgccaggtctgtg
tcttctgtacactgctcaaagatgtgtgaggacccagcaggtggcagctggacctggtat
accctgggacatttgctgagtggcctcagacccaacactgacactgagcttgaacctgca
tcaatctggtgtacaccactcacctctacctgaggactccctgagcacctacctcatgca
acttgactgcctccagagactctttcattcactgagactaacaggcacccagcagatgga
ggcagacagggaggcagagcatggtgtgctctgggacttttgctgacctgtccccaggct
caatgctagtaaaagccagctttggtgccctgcttggaccctcctgtgctcactcagcct
cggcagaggctgtcacacattgtgaattgctttgtagatgcaaatagattgccctgggcc
agtcacataaagcatctgacattgttcagcaccagagtccctcccaggaagccccaggac
caacacgcccagtggcagcttccaagcacatcagagcaggataca
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved