Myotis_lucifugus Locus Mono:47:SNORA3
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:47:SNORA3
Myotis_lucifugus
Mono:47:SNORA3
scaffold_8
SNORA3
1001..1128
2128
tagaggaatgtcaggggctagcagaggttcatacatatgcttatttttttgttcctcta
ctgttctttgatttgatggacacttcagataaatctaacgttggcatgaagaggtacaag
ctctggttgtgtttcttcctgttcctatcaggcgttttggcagcaggtggaatggtcagt
gaacaaagaacccctgggcccggtgggctccagcctcacccagccctcaccaagcccccc
gccacataacacagctcggcctctgccaccccagcccagataatttcttcccacccctct
ctgctgcgatgctgtagcaatttcaggcagaacagaactttggagatgtgagcagctcat
ttcaaagggcaggaggtcaatcagcccgcatgccagtgtcacttacaataggaagtgaca
tggtgggaatggcaggagccatttatcttgctctgttctttatgcatatcccttgggatc
tctcctgctcccctgtcctctcaccttttgatactccttccctctgtatctttgccactg
atctttcccatcacgccctgcatttcttttacttattttctccaccagagttggatcttt
gttttctttcattccttcaactgtgtgcctccaactgtttggggcacagcagggacccaa
atagacacaatcaccactcgcatggaacttatgtatgggagggtggtgggagaccgagag
tagaaagtaaatatgtgacatgttagagagtgatcagtgctatagggaaagagcatggaa
ggagggcggccaggtagaggggcaggggggttgctgctgaaatagggccgtgcaggaaat
tgtcaccctagtaggagacctttgaggaaaggcctgaaggaggtgaggcgtgagccaggc
catgagctgggggatggagtgagtattccaggcagagggaacagcaaatacaactttgct
gaggcaggagtgtgcctggaaagttcaaggaagagcaaggacctgagactagagtcgcat
cttgacagctgtggtcctggtgtgctagagttctcgcagagaatctgctggtctcgttca
ctggcaagggcagtaagggcccccggtagtgcccagatcagaaacatagcaagaaagaaa
gaaaaggaaagaaagagcaaggaggccttggtgactgggcagagtaagccagggggagat
gggggatgtggcatcgaaggccgttggggctttctccttatcatcacgccttgccagctt
ctacttgacctgatgcgagatggctcctgcccccacctcccattcctttcctcccaaatg
aagagccctgggcagagggaggatgtgatggatcctgtaatttcccaggatcatatgtag
cccattgcactctctctcacttttaaaataattcctccttgtgtctagtgtcctttgaaa
aatttagtccgatgtcatcacggcccccatctgagaccctccctttcaagccaaatccat
ttcctcagccacgactccaattttgggatctaaaactgcttctttgttcacttcaaggat
tgagaatcataaaaagcccagaccgtattttcagtttaatttctagctcagggatttaat
ctcacaaattacccttggtctcatttatggcagctgagattccctcacttgctcacgaac
taaagggtaaggtaaaatatttctttggggagaaatgagaagttgtattagttcctgggg
tgtgattgttaactgcagacctaatgtagtcatctagcaacgccaagtatcaccccagca
ctggcagaagtttatcgataaatgcagcatatgtcctctttatgggataataagaaattg
ccggtttaataagaaaatattttagggttttctcaaggtgggaaggactcagagaatccc
tcttgatcacattcattcaagactagaaccatgaaacaaaaaccgataaaacaaagcacc
ccgctatcctttgttcctaagaagcagtgtcggagggcctaatttaatcatttagtgctg
ttaagcagtaattaggtttccatggaggcagtggctttagccttggcaggattctgctcc
ttatttgctagtctttttcctccatagaa
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved