Myotis_lucifugus Locus Mono:242:SNORA65
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:242:SNORA65
Myotis_lucifugus
Mono:242:SNORA65
scaffold_242
SNORA65
1001..1130
2130
ttattttaacttgtcctttaaagaaaagttagtccctatcttttatttcttgacatctt
ttatcacttgggagcctttgatgttaaattcaatcttggcatccattttaagaccgatct
cagtgcttttagtcaatttgaatcttatcagtatatcacttactgactgagggactttgg
ttttaaggatcctctgctatgaaatttgtccctaaatgtggtaagtgagaaatttgcatg
actgccttccagcaagaactctatgcttgaacacattttagtctactttattcttatgaa
aaatatcataatctcatgaataagacattatttgggctctacagctctctgtgtgaagtt
agcacccttattaagcataatagttgttcattttcttttttgctttatacagattcataa
agtaaaattttcaggttctgaaaattatctcagtgctagttaagatttgaactgctgcca
atagacaattttctactttgtaaataatccacagaagcatatttgcaaatttttagaaag
ccaattcagactggttaaagatgcattttggtgaataaatatgacaaaaatataattata
tgtaataagtataacaaaatttaatacaagcttattggaatacaggtatttaagctgctg
gtttattgtgctagagaaataactgaaatggaaagcatataaaatctgaaaaattaactg
ggcagtttctggttctgtgtgtaagaggcttagaagctgccacttcatcctaacaaaaag
taaaaagctaaacagactaaaaatcaacaactcttcttgaatccatagagaggtgaggat
ataagacaaaccagtgtcgcaaagattagagagagagagagaccgacaaccataggagtc
actgcttatctagcagaaactcatgagcagaaccaccataggaagcagcactggagaagg
acaagatgaaatgtgattgaagaattggcagaggttagccacccgccactgcacctgacc
acttctctgatggctggtgcaatgcagtggtgggctgaaactaaggcccagtttaaaaaa
cacattgttattcttcatatggatgactgtgctgaacgcatgggcacaaccaggaaatga
ctgagggaggacgttatgtggtctgctctggctttgggttgtgacaaaacttttgctgtg
ttgtgtgtgtttttctgcagttaatcacagtagaaatagcactttttatgagactgtcag
ctttgcctgacagatgtggcaccgatcgatctttagctagagagttctctggaaccatta
aagggatcctggggactgcccaggccgtgggctgcaatgttgatggccaccatcctcatg
acatcatagatgatatcatcagtggtgcagtggaatgtctggctagttaagaactgcaaa
ggaacatgtttcaattaaagattatttgacaaccaaaaaaaaaaaaagaattggtgaaga
ttcagtatggacagttctaagagttaccagtcatagagagatccctacactttttttttt
tacctccagggcccccagattatcatctataataataaaagggtaatatgctaattagac
cgaacatcttcctgacgtcattccagacgtctttcctgatgaagccagggccagagggaa
gcagcctgggtcccaggtgctggagggaagctggtgccagcaaccgggggaaggaaggcc
tactcttgcacgaattttcatgcatcaggcctctagtagtaaatataaaagaaaaatacc
ttcatctttctggcaggggaagaggaaaaaaaacatttttaaatatactagaatactctg
tttttctttacaaggcctagttgacatgattttaattaacctggggagggaaatagcaaa
ctccagggcactctagccatcgtcccgcctgagaagggagaaacaaacagaaacacttgt
aaagtttacaaattcccactaaaatactgagtcaacctaagcataggattctagaacatt
tcctttcccctcatacacacccctcaccaccacattgctaaagaccaatttatagcaatt
ccttatacctgatacattatgtgcacctttc
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved