Myotis_lucifugus Locus Mono:271:SNORA74
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:271:SNORA74
Myotis_lucifugus
Mono:271:SNORA74
scaffold_1051
SNORA74
54..254
1254
tttaaaaaatataaatcagatcattacactctgtgcctaaaagccttaagcgctccagc
aggggtcagctctccagacagaatcatgcctgtgagggtgttacactgctggggaggaat
gccctgtcttcttcctccagttgctcccttcactgctctggtgacatgtggcactggtgc
aggcagaactgtgcttccatgagagtgagctaagcatcactttggttgctttgttctagt
gaaggagcagacacagaaaaaaaaatttttaagaaatcttaatggttctaatagcatttc
aacccacccaagggaccttcaactgcccctcagccagcctggctcacccagccttgagga
aagaaggcagggttggtgctgctcaggctgccagtgaacatgcatctggtcagacatctg
aagagaactgcagttatctgaggatggaaatggagggtcgcatctgctgggatcaggcac
acaggaggggactaaactatgtgggaaatagtgaccggatcagagctgcatgaccccacc
atgctctcactctccagctgcatcccaggggaccatgaatagtccacaacaggaagcagc
tccatggcctctgacaacccacagaccctctgcaaagcccttgagctcacatggctgatg
tcagactatacatcccgacaccctaagtcctgccatcaggactgttgggaccttttaatt
ctactcttacaagaaagccaggtctgagtctcttgtccactgctcaaaggtgtgtgagga
cccagtagggggcagctagacctgctataccatggggcatttgctgagtggcctcagttc
ctgcacagtcaccaaggttaaatctgtatcaatctgatgaccactgctcgccccttcctg
gggactcactgagaaactacctcatgcaacttgagtccctccagaggctctttgagtgat
gagactaacaggcacccacatgtggaggtgggcagaggcagaacacagggggccttggga
cttttgctgaccttccctcatccagtgcaggtaaaaggcagccttggtgcactgcttgga
ccttcctgctctcactctgaaccagcagaggcagccacacactgtgaattgtttgcagct
ccaaatagagttctcaaggccagtcagaggaagcatctgacattggccagcaccagagtc
tctctcatttgcctctaggacaacccacacaggggccaactgcagatgacatcag
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved