Myotis_lucifugus Locus Mono:26:SNORA50
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:26:SNORA50
Myotis_lucifugus
Mono:26:SNORA50
scaffold_380
SNORA50
1001..1131
2131
actgttgttgactgtttcctttatcctaccctaaagatgttaacagttaggttttttcc
tcactgggcaaggtcagacctcgtttatgattctctgcaattgactataaattggtctag
aaatgtccaaacatacattgaatgtctttgtactgtactgtgtatgctaagtaactggca
gaaaaagaattggaaattaaatttccaatctgacaatgttattgtacttaaggaaatcct
tgtttttaatatgcggtaccatgtaaaattacttgtgttaggaatacagtccactgttga
agttgaatgtcactaagcttattatgttacaagagccagtatgattaaaacctcccagaa
gccagatacagcgtggtatgtgccacatttcatgcatattttgactttgtgttgttcatt
gaaagttgtgcttgtaaaaatgtataaaatttcagagtttttatgtatttgtttttcttg
ctgataaatagctttttaaaaatctaatgtgaaagaaaccatgtttatattttgttagtg
atcagtgactttgtttatatggaaatttgtatattgttggcacacattttttttagattt
atcatgcatgaaggctgcaataattagcacaatgaaaattgctttttttttttttaacat
gttaattcatttgaaagattgtggtgcaaagggttactctgagtaacctgggttatggaa
tataaatgaacggcactctgagtgttaataaagctaatatttatttccactgtgattggt
ttgtccaaatctgttcttggacgcagtgtgttcccacttgtcccttctttgcctgagttg
atcactttctaggagaccaagcacagactaacctagaaacattgcaactaaatcttgcca
gggtatacatctgtgaagtcctacccaccaggctctggcatatctttttctggacacttt
gattacccaagtcagaaattaacagtgatgaagcatagcataaacactgcctttgaaact
cacaggtcttgggcatagcttcacagccaagcaacagtgtagagtccaagggcttgttat
aagggctcttcagcactcagctgaactgctcttttaaaaacaaggtacactttttaaaaa
tagcatgaacaaagcctacttagtcaaagtgtaaggaatgggtgttcccacagtattgga
gaaatttaaattattctttttatgtttatttactaaattgatggggtgacattggtcaac
ataaacatttaggttttaggtgtgggtttctatgttacaagatctgtatattacaccgtg
tgctcaccacccaaaattaaatcttctgttaccaagagatcatttaaattaatactttca
tatagagggcaacttagcaatgcaagataaaagcctcagaatcttgtatattttctgacc
cagcaattctgtatctatgaattctgtggcaatgattgcaactgtgcttaagatatagct
aatatatataaaagcctaagcgactggctggccggtagctatgacatgcactgaccacca
gggggcagatgctcaacgcaggagcagaaaccacaggcatggaaacatggaacagactga
tggatctcagagggaagagggtaaaggggagggcgggaagagattaaccaaagatcttat
atgcatactagaggaccagtgcattgattcatgcactggtggggtccctcggcctggcct
gcaccctctcacaatctgggactccttgggggatgttggagagctggttttggcccgatc
cccgcaagccaggccaaggggccccaccagtgcacaagtccatgcactgggcctctagta
tagctatacaagccccaaattgaggctatgttcaacaatgggggttatgtaacgaagtac
cacaatcgggctagtcgcttataacatcagaaatttgtcaactggaggctagaagttcaa
aatcaaggtgtcggcagggccatgttcctgtggaagtgcagggaagtctctgctccttcc
agctctcggtggccccaggttctctgtggctcgtgctgacagctgcattctctgccttct
gtcttcacatggtgtcctccctctttgtgtct
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved