Myotis_lucifugus Locus Mono:303:SNORA3
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:303:SNORA3
Myotis_lucifugus
Mono:303:SNORA3
scaffold_1
SNORA3
1001..1127
2127
acctgggttggccttgcgtgctggaggcaaaccatcaatgtgtatctctcacactgatg
tttctttctgtctctctcccctcctcccttccactctctctaaaaaaatcaatggaaaaa
atatccttgggtaaggattaacaacaacaaaaaagctgctttactatgaaataaatttgc
ataaattatggcatactattttcaatccttcattagttcttattagcctatcttttattt
ctgaaccaatagcatgctcggttgatcatgctgcaactttacaataaccactgatatatt
actaaaacagacttatcaatcttcctgttccggtattcctgatctgattgtactctcatg
gttcttccaaaaattattttaggagccttttatggacctaagttctaaattgaatgtttt
aatcaggattgtactgcatttttttaaaaaaggtaagaaaacctaacgtggataaggtga
aatttttaaatcaagaagtctttacattttattcatctttttgcctgcaaatatagtttt
aaagtttttttcgcatgtatttttgaaaaacaaactatttgataaagaagatagtacaaa
ctaatgtgaaggaaataataattcaataaatagtgttagggtaattgggaatttggtaag
ataaaaaccaattttagagccaaacataatattggtttaaaaattaagcaagctacaact
caacaataagatgaatagcccaattaaaaacaggcagtctctagagcagtgatggtgaac
cttttgagctcagcgtgttagcattttgaaaaaccctaacttaactctggtgccatgtca
catatagaaattttttgatatttgcaaccatagtaaaacaaagatttatatttttgatat
ttattttatatatttaaatgccatttaacaaagaaaaatcaaccaaaaaaatgagttcgt
gtgtcacctctgacacgcgtgtcataggttcgccatcactgctctagagtcatgcttggg
tattagctattgccttattgtgctagagtcctccaagagcaactcttgaccttataaact
gactgtggccctactatggaatagtcagtcaccaggctagtgacatgcaaaaaacaaaac
aaaaaggcaagtatttcataaatatttctccaaagaagacactcaaatggccaataagca
catacaaatgctcaacatcatagtcattagggaaaggcatatcaaaatcatcaacaaatc
agcaaaggacaagtgttggctaggttgtagagaaaagggaaccctactacactgctggtg
ggaatgtagactggtgcagccactatggaaaacagtatggagtttcctcaaaaaattaaa
aatggaactgccatttgacccagtgatcccatttctgggaatttaccctaagaaatccta
aacaccaatcagaaagaatacatgcacccctatcatagtagcacaatttacaatagctaa
gatctggaaacagcccaagtgcctatcagtagaagagtgggtaaaaaagctgtagtacat
tcacaccatggaatactatgcagctataaaaatgaaggatctcttaccctttgagacagc
ctggagggacctagagagtattatgtaaagcaaaataaaccagtcagagaaagataagta
tcacattatctcactcatatgtgaatttaataaacaaaataaattgatgaacaagataga
tccagagacatggaaacatggaacagaagtatgaatctcagagaggaggcgggggtgggt
gggagattaaaaaaattaaatgaaaaacctatactgtgtactcatgttctagtgtttact
gttatactcttaacattcaacctattcttttaaaaaatttatctttagtgttgaaagtat
tacagatgtcttttttccccccaatgacctcctccattctgcccctgccgtcctttgcca
caggttatgcatataagctcttaggtgaatctcttccagctcctgcccctccacctattc
ctgtcacatatttatgttaaaacagaatttctataattacatttatttcattttactacc
ttatcgatgtatactggataatcacttg
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved