Myotis_lucifugus Locus Mono:135:SNORA74
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:135:SNORA74
Myotis_lucifugus
Mono:135:SNORA74
scaffold_880
SNORA74
1001..1203
2203
aaggagccccaactccctgatcagccctgctctgtgcctgataggggggagctccccaa
tcccctgatcgcccttcggctctgtgtttgacagggtgcggtgcaccacccccctgatcg
gccctgctctgtgtatgacaggtagagcctctaacccccccattgcccctgctctgtgcg
tgacaggggggagatccccaatcccctgatcaccctttggctctgtgtttgacagggtgc
ggtgcaccaaccccctgatcggccctgctctgtgcatgacaggggggagctcctcaaccc
cctgatgggccctgctctgtgcgtgacaggggagagctccccaaccccctgatcgaccct
gctctgtgtgtgacagggtatggagccccaactcccctgatgggccctgctctgtgagtg
acagggggcagcgccccaaacccctgatcggccctgctctgtgtgtgacaggggtggcgc
cgcaacctccccatcgatcctgccttgagtgtgacagggggcggtgccccaaccccccaa
tcggccctaccctgagcgtgactgagggtggcatcgcaacctcccgatccgccctgctct
gtgcatgacggggcggcaccccaactccccaatcggccctgctctgagcctgaccagggg
ctgcacctaggaattgggcctgccctctgccaccctggagcaggcctaagccagcaggtc
cttatctcctgaggggtcccagactgcgagagggcacaggccgggctgagggacctccct
cccccccgagtgcacaaatttttgtgcaccgggcctctagtatgttatataaatgtctaa
ccactattttgttcacttaaaactgataatgaatgtcatccctaattgaaaaaaattaaa
ttagtaaaacaatttttaataaaaataaaaatgcaaatcagagtgatctttaaaaaatat
aaatcagatcatttcactctgtgcctaaaagccttaagcgctccagcagtggtcagctct
ccagacagaatcatgcctgtgagggtgttacactgctgggagaggaacgccttgtcttct
tcctccagttgctcccttcactgctctggtgacgtgtggcactggtgcaaggcagtactg
tgcttccttgagagtgagctaagcagcactttggctgcttagttgtagtgtgggagcaga
cacagaaaaaataaatttaagccttaaaggttctaacagcatttcaacccaccaaacgga
cctctttcctcccttccctacactccagccagcctggctcatccagccttgaggaaagaa
ggcagggacagtgctgctcaggaagcccgtgaacgtgcatgtggtcagaagtctggagag
agctccagttctcttaggatagaaatgaagggatgaatctgctgaaatcagccacccatg
aggggactctagttttcactacatgaggagggcatcacacttgcatgatccgccatgctc
ttgctcccctgtggcatcccaggggatccatgaatcatcgacaacaggaagcagttctct
gacctttgagaatccacagaccctctgcaaagcccttcagctcacacggctgatctcaga
ctacagatcccagacatcttcaatcctgggaagcagcctcttttgactttttcattctcc
tcctacaaacaatgccaggtctgtgtcttctgtacactgctcaaagatgtgtgaggaccc
agcgggtggcagctggacctgatatacaatgggaaatttgctgagtggcctcacacacaa
cactgatacctagcttgaacctgcatcaatctggtgaacaccactcacctctacctgggg
actccctgagaacctaccttatgcaacttgagtgcttccagagactctttcattaactga
gactaacgagcacccagaagatggagtcagtcagagaggcagaatgtggtgtgctctggg
acttttgctgacctgtccccaggctcaatgctagtaaaagccagctttggtgcactgctt
ggaccttcctgtgctcactcagcctcagcagaggctgtcacaatttgtgaattgctttgc
agatgcaaatagattgccctgggccagtcacataaagcatctgacattgttcaacaccag
agtccctcccaggaagcccgaggaccaacacgcccagtggccag
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved