Myotis_lucifugus Locus Mono:206:SNORA25
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:206:SNORA25
Myotis_lucifugus
Mono:206:SNORA25
scaffold_144614
SNORA25
1001..1122
2122
TGTAATTTTGCTACTGTTATGAATCGTAATGTAAATATCTGATATGCAGGATGTATTTT
CATTGTTACAAATTGAACACAATTAAAGCATAGTGATTAATCACAAAAACAATATGTAAT
ATATATGTGTTTTCCGATGGTCTTAGGCGACCCCTGTGAAAGGGTCTTTCGACCCCCAAA
AGGGCCGCGACCCACAGGTTGAGAACCACTGTTTTAGAGCATCAATATATAGGCTTTTAA
GGTTTGTTTTCTGAGCCTCACATAATCAGATGAGTTATGCCTAATCAGCCAGAGATGCAG
TCTTCTTTGGAGGGTAACAGCTTTAGATTTTGAAAATACATGGCCTTGACTGCATTTATT
CTCAGTGCATCACTAAAATGACAAGTTTCATTCCTCACAACGTATCAGGAATTCTGTTTC
TTAGCAACACCCCTCCCACAAGCAATAAAAGACAGAACATGATTCCCTTTGGGCATTAGG
AGTCTGCTCATAATACTAAAAATGTGGCAAATTTTCCCTTAGATGCAGAATTAGTAATCA
TTCTCTACTTCTGAAAGACAAAACATTTGAGACTCTTCAAAGTAAAGCATTTGATAAGTT
TGGAACATTTTTCGTTCCAATACTTGCTATTTCAGGGCTTGTTTTTAAAGATATTACAAA
ATTTTAATGTAATAGGTCTTACATGATCCAAAATTGAGAATTAAGCTTTTCTAATTTGTA
GCTGTTTCCTCCTACCACCTTCCAAGTTCACTGTTCAAGAAAGTATAACAGCTTTCTAGT
TTTGAACACCAGCTGCACTCTTTAGTTATATATTCAAGAATTCAGAAAATAAAAAATTTA
CATTTTTGGTCAAGTAGAAAGTAAGCTCATTGTACATGTAAAGTTTATTTAAAGGTTAAA
ATCCAAATAAATCCAGTATTTATCTTATTTTATTATCAATTTTGTCACCAAATAATAATA
GTTACTACATTTACTAAGAGATTATGTGCCAGTTGTTCTATTGAGCACTTCAAATGCTTT
ATTTTCTCTTCATAAAAACCTTATGTGGTGACCTAAGATTGAAGTTCTCCATAGGATGTA
ATGGATGCTCGATAGTGCTATGTTCTCCTGAGGAGATATAAGATTTATCAATGATTGGTG
ATGTGGGAAAGTAAATAAATGTTTCCCAAGTTTAAAAAAACAAAACAACCTCATGTGATA
GGTATTATTAATTCTCATTAACTGTGGAACTAAGACTTAGAAACATTAAGGAACCAGCTC
ATGGTCACACAGCTAGTAATAGAGACCCATGCATGTAAGTAATATATTAATCTTTATACT
TGAATAATGACCTATTCTGTTGAATCTAATTAAATGAATAAATAAAACCACCTGTAATTT
CCTATTTCTAGGAAAGGTAGTCTTCAGTATTACCGAAGGAACTTGAACACATTCATAATT
AATACTTAATCCTTTAACTCCGTAATTGTTTGTTACAAAGAAGGCATGTTGAATGATTTG
AATGCAATAAAAAGGCCCCAATGAGCTTTGATGGCTTTTGGAACAGATAAGTTTCTCATC
ACCAGAGCCAGACTATTTTTTTCAGCTGTTTGACAATCAGAGTAACTTACCACATCTTCT
CTGCAATTCTGTCCTGTCCTGTGGGTAACTAGGAGACCAGCAAGCACAACAAATGTAGTC
ACAATTATTTAAAGTGTGTTCCCATCTGATGGATCTAATTTTTTCTTAGACACCTGACAT
TTGAATGGCTATCATTTTCTATGACTAAAAAAAATTCTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGAGGGATTGCTCTCTCTCTCATATATATATACATACATACAT
ATATGTATAATGTAAACTTAAATATATTCTATATAAATATATATAACATGTATGTATTTC
CTATATAGATGTATATATTAAATGAAGTATCTTGGGGATCAATATGTAATACATAGTAAA
AGGGGTGCTTGTAATGAAAAGATATATTAAATAAACATTTCTTCTTTCAGCTACCTTGTG
ATGTTAGTCCATTGCTAGAGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved