Myotis_lucifugus Locus TAF1D
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus TAF1D
Myotis_lucifugus
TAF1D
scaffold_104
SNORA40, SNORA18, SNORD5, SNORA8, SNORA1, snoZ40, SNORA32, SNORA25
7119..7243, 8169..8299, 8443..8514, 9449..9586, 9843..9981, 10341..10413, 10809..10934, 11198..11325
12555
aagtgacactgcattttcattttgtaatgagcctcacaaatgacatgcccagtgctccc
aggcagtggacgggacatccatacctgtcctggcgctcacagtatttcatagactggaca
tgctcacaggaccagactttttatgcctggaattgttcattatttggagcaaaactgagt
gaagagaccggattaccttctaggtctgccctaacctgagatgacactaactgtaagact
agacaggttcactgcttatatgacccaagaggtctgaacatgcacaaatcagaccagctt
attccgttttgtgaccgctttggggaagccccaccaaaactaagctagtttttaaactgg
tttatgttaatactcgggaactaaggggggggggggctgaggaaaggaatttatctccag
tgatatgttaaccaactcctgggaggctgaccccactcgagttaaagagagaacaaaagt
ccaaaggtggagagaactgggtgccctacgcagtagcacgggtgccagtacaaaggttcc
atattttgtgtgacagtcaaagcaagatccacagaagagatttttgaaggcaaaaggaga
cctaatccgacaacaaagcacactaggcaccacgcacacccactcacccacacccgggac
gccaaatgtgcaaacgcgagaccaccggaaacaaagccggctgtttccttgcagttcaca
cccgttctgcccactggtccgcacaatttcttcccgtcgtttgcctacgctcttggctat
aacacttacctaacgggttagttacggaagcctgcgcctaagccctgcctcaggcaaccc
cgcctcctctgggttaggagttcaggccccgcccacttgccatcgctcctccctccgtgg
ccacctgagcggctctccccatactcccgcctctcgcgttctttccggagccaaactgtt
atcgcgagaatttggccccactcttaacgaggtctcgcggtgggttcagtcttttcctcc
gcgcgcttgcggaggtcggcggttgtttcgtgctgcgccgctgaggctggcggttcctgg
ctgcgggcttcccaggcctgggctgcgggtggcgcggacgcagctgaggcccttaccgag
ccggcgcttggtggtgcccgccgtctgcctacctacacgggtaagaagaggacagtgcca
tccgggcctgctgggcgggggagggggtgcgcctctagccttcccctgaccttccccacc
ccccgcgacgatcgcgcggttcgagccgaagaagtcgggcctgagggcggaggcacacac
accacgattacagtggtgtgatcccgagtgtaggtcctacactgttggagttgtaggcga
catagacaagtgcaggggttctgggctaataccaccaggtaacgcttaggccgccttctg
tgccggaggctaggcgcttcctgagaggcaccaaggtcaggtagtggctggagaggctgt
gggcgccggcagggtgcagggcgggccacgtggcctcgtccagtttcggaataagggaca
ctcagaaatgctgtctagataagtttcagaaactgatttttgagctaactacacttcatt
ctgagaatgtcctaataacgttttaaaaaattcaacctcaggtgtagcaccagcgccatt
ggacccaatgttgttgaatttaatttttgagcattttttgacatagtctgattttgaatt
taaactacaacaaaaccatgaaactactgtgtgagtccattggacattttggaaaatcta
agatatatgtgatcttattgattgcccattatttgaaatgtttttctgttaattttaaga
aaactttcatctttactcattggtcattgtcaagtatgttaaacactgaaaaatgcaaac
gtggaagaatgatgacatcctctgtaagggcgaaccagtattgatttctcatctttattt
tactttttaaaaaaaaaatattttattgatttttttacagagaggaagggagagggatag
agagttataaacatcgatgagagagaaacatcgatcagccgcctcctgcacgctccccac
tggtgatgtgcccgcaaccaaggtacatgcccttgaccagaattgaacctgggacccttc
agtccacagaccaacgctccatcactgagccaaaccggttagggcatctttattttactt
tttaaaaaattgtattttgttgatttcagagagaaagggagagggagagagggatggaaa
catcaatgttgagaatcattgattggctgcctcctacacgcccggtactggggatcgagc
ctgcaacccagggggtgtgccctgactgggaatggaaccgggacctcctggttcataggt
caatgctcaaccactgagtcaccccggctgggctttatttttaattttaaattattttcc
caaactattgtaaaatcttccaggaatttttttgaaaaggaagataaaggacatcaatgt
taatagtccaatatcctcattggagtttgagagagaattcagaacttttaaattaataac
catagtaacaaaaaggtatgccaaaaagaggtttcatagtgattttgttgatcagtatga
atgggaaaacgccataaatgaaaatcccaggccaggagtttaaaaatggtgtgatggact
gagatagtaaattatttttcctggtatactgaggcttgctttgtgaaacttttctaggag
ttcccatctgcttttggaaaatggcttttgggccattaattgcacattactaaatgacta
atgataaaattgcattttttcctgttattggaaagatgtttgatattttttggggggaat
gacattttctagaatcttgttccaccggatagctttagaggcacaactgaaagatacaac
acattaataaaatttctagattttagaattttttatttgaaatggatggttcctacatga
aaatatgaatggccttgtaaatgtttgtgccttaatttacatataatggcataatctgca
tcaaatttgcattgtttgaatactagctgtttttgctggcacttgttccgggaaactaga
catcatatgtagtgtattttatgttgtcagaaatttggtgaaagcaaagaacaagtgaga
ataacaattttgagacagactggaagaagatatcaggaatggattctccggactacataa
cagtatctgattcagctatggaaattgaaaatcagaagtaagtgcattttttttatatca
acggcaactgccagattttcactagaaaacagtagatttgatgataatgtttacttgaat
taccaggaaagcagaggtggtaaaggtaattttcaaggattaggaaagaagagaaaaacc
tgagcaggttttcctgcttctgtccttgaagaaacatacattactggtaataagcattca
gtcatataaagaggatacattaattttcccccttttttcccctagtgatagctcttcctc
tgatagcagcttatttaaaactcaatgtgttccttcctcacctaaacggaggcaaagaaa
tcccattaggaaatgtgttcattcacttgaaagtgttcaagaaagagattcatccagtga
ctcatctatagaaccaagaccattgactttaaaagctatttttgaaagattcaagaaaaa
gaagccaaagaaacgtaaaaagaggaaatataagccaacaggaagaccaatgggaagacc
aaaaggaaggaaaaacagtaggtcacaaataagtaagaaacaacttaaagttaaaagacc
tcagttcccatttatagagtcagagaatggaagaaaaccaataccttggagaaaaatttt
aacctttgaggtgagttagtgtatgtgggtacccatagctaaagtgcctgaaatggtgtg
ttggtcacttagaatttagatggcttcacttggctactaggtgaaatttttacgggtgta
tttagtgaatatacctgtatataaagtgctccaaggctgttcattttctcattgatactg
agcagttaatttctgacacaattgcctgataaatgccctgtaattagcagtatacactcc
tgtatttgatttaatgtttgcatagtaaatttttaattgcttgatttaaattctgattta
tttgagggaattaatactgaactttttttaaaaaaaatgttgatttcagagaggaaagga
ggaaagagaaacctcagtgatgtgagggaatcattgattggctgcctcctgcacacctcc
cactggagcatgcaacccaggcatgtgccctgaccaggaattgaaactgggacctcttgg
ttcataggtcgaggcctggcagttaacctatgttttaaggtgattataataaagcctcaa
aaatttgcttatgtgcgccctggacgtcttgtcttaagtggttagagtagcagttctcaa
cctgtgggttgcgacccctttgggggtcgaactaccctttcacaggggtcgcctaagacc
atcggaaaacacatacataattacatattgtattgtgattaatcactatgctttatttat
gttcaatttgtaacaatgaaaatacatcctgcatatcagatatttacattacgattcata
acagtagcaaaattacagttatgaagtaacaacgaaaataattttatggttggggtcacc
acaacatgaggaactgtattaaagggtcgaggtgttaggaagtttgagaaccactggatt
taaattctgatttatttgagagaattaatactaaacttttttagtggttagagcattggc
tggctggtacactgaaggttgcaggtttgattcctgggcaaggtcatgtacctcagttgc
aggctcaatcctggcgagggttcgtgctggaggctaccaatcgatgtgttcctcacattg
atgtgtaccccccttccccccccacacacccttatttaaaagcaatagaaaaataacacc
aggtgggggttaaaagattgtttatctgcatttaagtctagtaattcccaaacaacataa
gatttgttcttggttgtaccaacttcggtaagtttgatagttttctaggtagcagtgagt
tttacaatcagcatttgttgtattacatgagttgcatatggcagagtagttaaatcaaga
tcactgagagctcttggtaagggggtccttgctgttttggaacacacctcttgttgggtg
gaggagagtgttattttgtaaggctgtgacttttttgatttgtagcaagcagtggcaaga
ggatttttcaactaccttgaaaaactgaagtatgaataccatctcaaggaatccttaaat
cagatgaatgttggtgaagatctagaaaaagaagaccttgatagtcgtagatataaatac
ttggatgatgatggatcgatctctcctattgaagagtcagcgtaagtttaatcatgtcaa
attgtttattaatgctcattcatccttatgcttttaatttgttcatactttagtaatgat
gggagcaaagatacaataggccatctgggttattacagttgagctatgagcttggcacat
gagagccaattttgggtgttatacatgacagtgtaattttcctccttgactagtacagct
attttgtgtgtaataactacataatatactattgggttatagaggatttagtcatctgat
attttgaatattgcagagaagaagatgaggttgctacaaatcttggacgtgatgatgaat
gtgatatcaaattggtggtaagtgacatttttatcctgtttccttttgggagggtgcctc
agatggtacaggaagaattttatccaatagttacatcttacagtccctgtttaattttgg
aaaggctataatacatttggtgcaggaagtgcaagaataaaaatgctttttgggtagttg
agtgtgacatggacttttcagtactattaggtttgctactgggctatcaagtgagaataa
aagcgaaagttaattggatttttaacatcttagatgtctccaggttgaaatcatctagaa
ctcagttatgtgtaattactaaagcaataaagttttagttattgcttaatattggtattt
tttatgcaggagaataattatttcataataagttctgaattaccaaagaagatgaacgta
tatttagagcaagaatacactgaagacgttgctttgtctaaaaagagagtatcaaagtcc
aaaaacattggacagaagacagaatgacctgaaaaggagatatgaacatgaatgtcaagg
taaagagactagagaaaaagaaactacagaaagtaaagatgatatgaatatatatgccag
tccagtgataaagctgccacgatgaaaataaaaagaacctctgaacaaatttgtgaaaga
aactgctaaagaagtaattaagaaaaattgaagtgaaattgtgcatgtacaaaaaatttg
aggctttcatagcagaaataatcttttgcacaataataaagtcctactgcctggccagtg
gctcagttggttgtcatcctgtgcactgaagggttgctggtttggttcctggaaagggca
cataacctgggttgtgggcttgatccccagttggcgtattccaaagaggcagccaaacga
tgtttctctcctttctcttcagtatgtcctcgggagaggattaaataaaaataaaatttt
taaaagggtcccactgtttttgcctatacttgtttatgtccgcgtaagagcgtaaaggta
ttatttgagcactgaatcaaagtatagagattgtaatcctaaaaataaaatcttgccact
aatgaatgacaacaagtcacccttcttaggatatctgaaacccttgctgtatttttatcc
agttttattcagacaaaaatgacctttattatcaaatgttcagtgctgataagaattgaa
taatttccccttcttaacagcctggaatattaactatcattgtcttttgtcgccataaat
attactaattatattgctaaatatactgcatttcacaatagcacttgtgtttgtttttgt
aatttgtggacaaaaactacatacgggtgctaaaaataaagcctcttttgcaacccagaa
ctcattgctcagtatgagttttgatacatataagaaggaacatgatacctaaaacactgg
ttccaggactgtaggattaataatttagaaagcatagaatataagggaaatatcaaccat
actgctttagtatttttattttgctgttgataacactaacgaagttgactttttttttat
tagggttttatcttgagaacactggatttatgtcaactctttaggtgagtttttggatca
gatttgtttaaatgtagcacattgtcagataatataaatctccacaagtttcattattaa
atgactttttgccaatttttaacttctgattaggacacgatttcagaaaatgaatcttgg
gaatcaccgttatatagggatactgtgccagcttcacttcacttgcaggaaagggtccca
aaactggcagttgggctatagaagtagatttaatactataatactagaaatgactacaca
ggacacgacttcataagtttagatggtataaagttttcaaatggtaagaacataaataca
gccacattaaaacttttcctgtatttttatatttgataacaagtagctaaggggaagatt
attttatatagatcttcatttctgaggcaaaaattctgttaactttgctgtgtaatctgg
gaatttcataggcgaaagatggcagtaccaaaattcatagaaatcaatttatatgtggat
atttcacctttgggttatctagagtagctacttgccattttgtatgtttttttgggcagg
gtcagaatgtactttctgtgcagcattgttagaatcctttgtgattaattttatgggata
attttattgcaaatttgaagatgtttgactatttttatagttttgagtttaaatggttgg
agcagatcagttctcattgtcttcctatggagacttaggtttgcttatgccttttaaaat
gtgtaaatgattgaggtctatcccgatgggtctttttctgtagacttacatcgttggaaa
cgcctcatagaataaatatgttgtttcctttattcacagaactgcgtgttagatctgtgg
gaaggaattacaagacagctgctaaaactgtgacagaattaataatctaattttttttaa
tcttaggtatttttgtatatcctgaagatctgtacgattctagggagtgatagcttaggt
aagttttaattggtgactgtgacaactttagggtaccactgcagttcagatgatgaattt
aactgttcaactgctgaatgatacagacatgaactaaaacataattctgacagctgaata
tagctctgtataagttttagtttttaatcacattcatcaatcttttatttggtgttttat
ttgtaggagtgaagattttaacttactcatgtgtagaggtaagtagaacatttaatttct
ttttattaaggattcaaagttgtgaaaaaatgcaatttgtgagtagagtaagtcctccct
taacactattgataggttctgaaactataagtgaagtgatataaaaggaagccagtttga
ctacaggctaaatgatgagagaagttgctgtggcatctcaacttgataaggacaccttga
acaaaaggatgttaattcgaggactgctgtactccattccattactgttgtgactaatac
attaggtataaagcagaattgtcaatatcttggtgaagatatttgccctaattgtattta
tatacaaaatcggtgtgtgtttggggggggggaatgaagagactgcatgtctaggggcac
aaaatgaaaatgtaccctttttgcacccttttattaaatggaccgttccatatggttcat
cctagtaatgcagacttggataaaatagcaaaggaattccacctaataacagtttgaaca
atggtaacctttatttctagtgcaaagagagaagataaagataatagtgacttaggttta
tagtttattgcattaatatggttgcctcattgacaactggaaagtcgctttttaaaaaaa
atttcttccccccccattgaccctccccaccaacctaggtcttcactctgtgtccatggg
ttaatgcatataagttcttgggttaatctccctcccccccaccccaattcctcttgagtt
ttgtcagctggtaacatgcttctggatttgcaacaatgatatttaatcctcagatactta
aaacagaagtgtttatagttcagtcataatgcactgcatggtatctgcattcagtagttt
attcctgctgggtgttcaaaggacagtgcaatataaattcagtatctggcatcgttggtt
ttcttcgctttgtgcatgttaaacctggtatttttattgagacattattcttacagttct
tagtgttcagttagacataagtaatcttcagtaggaactaatacttgtctctttctaggg
tgtctgatattagaaaaccaggcagatccatctactcagaccctaaccacgtaagccttt
ctatttctgttgcttctaggggtttgtttcctttattgatagcaagtgtcagcaggaact
acttctacagatgtcaaagccttttgcatagtgtatacataagcttgagagaaactttta
taaagcctcattctatatgaaaatgggcactgtttttgtgtacggtgtccagaaatttgt
taatgtggctacattgagacacaggttatgcttccatcacagtaatcttattacagtgat
gacaatgagacctgtaacatttttgttaggctcaatgagcggagtataagacttgaattt
cagaaacaattaaggaatagtataccttacatcacctgctaaaataacaataacaatgtt
tttcttaatattcaatttatagagtcctaaagtaaattgcttgaagaaattagttcccaa
cgattataggtaagattttaattttttccttcaaactccctcctagcttacaggagactt
aagctcctttataaaacttcagtattaatgtccttgcatttattcacttattacagtagc
ccatcctggtggcttattactaccacaaaaaaaattggacattaaaaaggccgaccgcta
tgtttgtacagttcaccagcatgatgttatgatgatgggcaaaatgttcaactgctctga
atgagctgaatgaaaaattgccatctgaacatccatctacataataaatatgaaagctac
gataagcattccctgaaacacatttccaaatagtgcatttcctatgagttttatgaatgg
aaatggattaagtcttattttaacattagatttgttcccaatatttatttgattgaaaag
atgcttattccaattttcagtttcaagcctggaactttcattgtatgctagttgggaact
ggttgtcagggtactttggaccctaattaaatgtattttgaaaaatttagtccaatatga
acattaaaatcttttttcataggtgcagagtttttgaagtatgtccatattcaagtgtag
atcaaagaagctcaactaaaaggattgtggcaagttattgtctttatcttaccccacacc
aaagtataagggtcattaccaaggcttttagaatgcagtttctcatttgccgtggacatg
accacaaaacatttccccaataggttttttttctgctatgttggtagcatagcattcagc
ctactgggaacattttactaacctagatttacattgctagatcacagttcactacagata
taacacaagctgtaggagatttctgtaatagtccttgggaatcagatttgatggacagcc
attttagatgtctggggcttgatgtccttgaaagtcctcagttatcatacagtttgtgat
catgataatctctattcctattatataggactgacttgagatgacatcaggattgagcaa
aaaaggtatgtaaacattagaaaaaggtattaatttatgggtcatttcaaagagagctta
tgggactaaaaccaggagctcttaacgctgtgaccgaaaattgaagttctccataggatg
taataaacactcaatagtgtctattttgtcctgaagagatatatgatttagctacttaca
tcagtgattggtgaggtgggaaagtaaattttctaagtttaaccactgcgtactcttctt
ttttagggaataagatgattaagactcaaactcaggaggaactaaggcagtggaagaact
cagaacatgtgaaattccttaaataaaagtttattaactttaaataattgtgcctatgtt
acaaataataaaagtcctttatactttttgtagaaagtcagcatgtatttttggctcgaa
gtttctctagtgttttctgtggagggaataaaagtaaattttagtttttttagtttcagt
tgtgtacttttgacatgaaaaatcactttgtacctaactcgccttatgaaattcttttgc
tctagctctgttttgggcataagcttcttgctttgctttctcttccttttgccgttttac
ttcaggtaactgattgtgtaacctgtaagaaatttaagtggaaatcaaaggcagatactt
aagaaatgtgaacaaaagcacacccacacacacacataaaatatataccttagagtcctt
tggtgcttgagggcctgtgcagcctttctgtcttcgggaagtgacactctaactttactt
tttaggccactcacatgtgaacctgagcagagaacaagtaatttggttagccagattccc
tttctcaaatgaatgcaaatgttttggggaacttacctatagaaagtgttgtcttaatca
cttggttttcaggatttctaaaaacatgtgttttgttccttatttctttctgtctctggc
aggatctctctataaatgatttttttctctttgcaaatgcttcttgtaagcttcctggtg
caggtgtaaactttgagagggtttctggtagaaaagaaaagttgaagctattttcacctc
attgagcaacatgcaaactttgaacttcaacttgtgtagggaactcccactagcctttgg
attcactgacccatttcagatgctcaaggcatacctgcagacactgcagctggcttctcc
tcagaatggtctggtgctgctggatactgtgagttttctgtttctggtacaagaggcaga
aattcactctcctaattgcaagaaagtcatagatgaactcaaagtatagcaaagtttagc
taaaaaccctgtcagctttaggactgaatttctctggctagggaaaaatcttgatttgcc
cagctgtactagagaa
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1179, 3150..3276, 3525..3909, 5325..5500, 5776..5836, 7383..7423, 8586..8617, 9658..9709, 11128..11164, 11406..11555
3218..3276, 3525..3909, 5325..5500, 5776..5836, 7383..7423, 8586..8617, 9658..9709, 11128..11143
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved