Myotis_lucifugus Locus Mono:202:SNORA54
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:202:SNORA54
Myotis_lucifugus
Mono:202:SNORA54
scaffold_2007
SNORA54
1001..1125
2125
tgaccgggaatggaaccctgacctcctggttcctaggtcgatgctcatcccatcatgtg
atgggttagatccgcctggaacctgtcctccagggaggtgacccggctctgcattcgctg
tgcttcctggcggatcttctttccctggagcggacttgtctcgctctcctttatgttttc
cctcctcgttgctccctctcactcctgcgcgctccgtctctctctctctcttcgttccgt
ttttcctggagccccttagagattaattattgaacagctggctctgttcctagctcctag
ggacgcacacagatgtgctgcccaagtgtctacttctgctgctgacaccagtacagacgc
cccggttccccgcctctgccacctccccccgccccctccctctggccgccaccacaggcg
tctgctcacatttgtcagatttgaaaggtgatcagtgttgcctctaccctcccagacagt
gcagggccctgagccatttcagccccacacgccagctcgctgtgtgtgtaatgcgctgtt
taaagccatcggtgctgtgggtggagaagctgttatggccgggatgggagggtgcagaag
ctccagtgcattcaccagcttgttccctggaagcgcatcgggctccggagcgggaaggac
ggcagcaggatggtcctcgctcccaggcatcaccgtgcgcagcggctcaggggggggtct
gctctccctccacagggcgacctggacccgcgggcgtcgctcaagtcgctgacctccctg
aggtaggagacgccctgtgacagtgagtccttcacagtaacccctgcccggcctggacct
taacacccagtgaggacagaggaatgctgcatgggaacgaactggaaaaggtttacaatt
taaaaaatacctatgttgtttttaaaactcataaacctaattctgttttacccactatgg
agaagaaaagaaaaaggcaccttttaaacacaaatcctgcaaagcactgttcgtgacctg
tgggccgtgctgtggctaacgggttccattccagtgcgacagcagccccactgccagcac
actgaccgcctgatggtgctctcagtgtcaggtcttggacacaagcatgggggtggggtg
ggggaggcaggaaaaaaatttttcagccctggctggtgttgctcaatggttagagcgtcg
acctctgaaccagtgggtcccgggtcagttcctggtcaggtgcgatgagaactgcctgag
ctgcgaggcgggcctcaggcgttgccaaacacacctgcagccactgtgagccaggcctgt
gaccagtaactgcagggcagggagccccacaccccccaatctgactgggcccccctttat
tctccccagcagaggagacctgtgagatggtgaagtccaactggctgtgtgagtgcaagc
tcttcattcagctctgctgccggcccctgggtggcggcccctggaactcagcccgccggc
cgcatacctgtggggatgggaccccaatgtgcacccctaggccctgcctgggaaccccca
catttaccgaatcttgcaaccaaagtggaacgtcaagcatgtggccttgcccgtcccttc
tcactgggcttccagcatctccaaggtcaacctcagcctcctgcgggacgggccgtcccc
acctgtgacagggcccagccgccggtgtcctccgcccagactgtaagccagaccgccggg
cgggacctcctgctgccaaaccagtgtgggcgtgtggatcagctgcctcttccggttctc
accgaggggagtcctgtgaacagagagccccaatatttccctggaaatgcacatatcggc
tcccgggaccaggagtaacctttgccttaaactttctcttgagcttggatgtttccattc
agttgggctccaccctcagtcctcacaaagcccacgtgtccctgggagctgggcccccac
ctcaaagaggtggatcgaacccatgacgccaagaaagatgccctcagagcaaacacagtg
ctaaccctaagttaataaagagtaaacagcccacagtgaaggcgtctgtttctttcgtgg
gcacagcgattacacttgggcgctgt
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved