Myotis_lucifugus Locus Mono:344:SNORA25
snOPY snoRNA Orthological Gene Database
Myotis_lucifugus Mono:344:SNORA25
Myotis_lucifugus
Mono:344:SNORA25
scaffold_10036
SNORA25
1001..1124
2124
cgggtgaggattaacataaataaataaatacataaagtggtatttacggacactgaagt
ttaaacttcatataatttgcacatcacaaaatattatttttaaattctttttcaacaatt
taaaaatgtgaaaatcatgcttcgttcgtgggccatgtgaaaacagacagtgggccacat
ttgacccgtgggctatagtttgcaaacccctgggatagaggaaacaagattcaccataaa
ttgatcactattgaaactgagaggcaggttcatgaacattcactacagtagcctgcccac
ttcaattatgttttaagttgtttcataatattaacaactaagagggaaaggcatctccct
ttccttgcttgcccccttcacctgatgggaaattggtccagcaccgcacgccctgagttt
tgttagcagcctttgtgagcccaccttcccgggggagtgttacctgcccgtagttccagg
gccaggaggtgatgaatcgttcatgacccttgtgcacaaagccatagtccatcatgatat
actctcgcagcagtatttcactgggcaggtagacgtcatcctctgaacacgtaagagtaa
tagagggggtaaaaccccgaaccaaccaaaaaaacagggtaataaaaatgaaaaatggta
atgaaagtatcttgctggaaaaaggagaagcaatgggttgatggcaatagaaatcaagag
tggacctcttaaaagtctagaatgtgtttttctagatgccagatatataaaatgtatact
tttaaaaaataataattatcttttcctgattgtaaaagcttgttgtagaaatttggaaaa
cactgatgctggaaagaagacaatgaaaatcgctctttcccactcctcagacacacatgt
tggtgtgttctgggcactctctctctttctctgcacatgtgtgtaatacaattacatatc
acattgtgttccatctcctaatctatttcactgaacatcacacatttcaaagagagctta
tgggaccaaaaccaagctcttgtaacactgtgacctaagattgaaattctccatagggtg
taacagatactcaatagtgctatgttttcctgaggaaatataagattttttttaaaaaaa
tcacaccatgaacattttcatcgtgcactaaaaattccttgtaaagatgatctttagtga
gcacaaggtaatgtatgcatagctatgcagtatgtttttttctgggctttctgggtagaa
ccttacagaacattcccaatggatcaggttagcattaccacctgtgagcaagctgtacct
gcactccaagggttaaaaagcaggatgaaagtccccactgggtgagtcgtgctgtaaccc
tggccttgagagatgtctatcttcagagtgtagggaccaatgactgcactggctggtgtg
aaaagggagacaaagagtgagttggagtcaatggtgaagtcagaagcactccagacattc
ccttgtcgagcctgggtgagtccaaaggtagctcgggttcctgacagcttcgtgggtgcg
ggtcctgtgtaggaaagaatgaccccaaggtgaggttcgaagtctatgtgaccttcacct
tctcctaccacttgctgctaatggcttttggtttaaggtttttactgccactggggaagc
cactgaagatctctgggcctcagtcttttatctgtaaaatgggatcataatagtaaccac
ctgaaagtttcgtcatgaggattaagtaagttaatgtgtgtgaagtttagtacagtgcct
gtagtgtatttaaaggttggtttttgttaatcacaacttcagtttgctgagctggccaca
tcttttcttaacaacacgaatagggtgctgagcagtaatggggtcctggggaatccccgg
aggagagaggaagggaggctcaggaaggagaggtaggtgcccgacaagtggacttgcctt
ggggagggtgaacccaccggtctcagccacgaaggtgatgtggtcggtcccgcagtggaa
aggtcggttgaaatgcagttggagcgtgaagggctggccccggcgcacgatgagccgcct
caggcccatctcctgcgtgtgatgc
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved