Mus_musculus Locus 1500012F01Rik
snOPY snoRNA Orthological Gene Database
Mus_musculus 1500012F01Rik
Mus_musculus
1500012F01Rik
2
SNORD12, SNORD12, SNORD12
1252..1344, 2777..2865, 3055..3144
4634
GGACTATAGGGGGGGCTGAGAGAAAGAGAACAGGGACTCCGGAGGCTACAGGATAATTG
AGGGAAGAGGACAGGGACTCCGGAGGCTACAGGATAATTGAGGGAAGGGGACAGGGACTC
CGGGGGTATAGGGAAACTGAGGGAAAGGGACAGGGACTCTGGAGGCTATAGGAAAACTAA
GGGAAGGGGACATGGACTCTGGGGACTATAGGAGAACTGAGGGAAGGGGACAGGGACTCC
GGGGGTGGTGGGGGCGCTGAGTGGGGCAGATAGGGACTCCAAGGCTAACCTGACACCCGG
CCGGAGGCAGAGCGGGACGCCGGCGGTCGCAGCGCCGCAGAAGCAGGTGCGTGATAGGGC
GGAGGCCACTCACCGGCTCGGGCGCGTCCTCCGCAGGGCTAGAGCTCAGCCCCGGCCCTG
GCAGGTCGCGGCCCCGCCCGGCACCGCGAACTTTCGGTTTCCAGTCCCTGCAGCCCCTGG
GCGGGGCGAGTAGCCTAGTGGGCGGCCCGGAGGAAGAGGAGGCCGCGCAGGACGAGGAGG
CGGTGCCGCGGGCTCCAGCGAGAGGCCGGGCTCGCCTGCGCCCCCGCCCTCGGGGCGGGC
GGAAGGGCGGCGTCGCCTCAGCGCCCGCGGTAGCGGCGGCGGCTGGACTGGCGGCTCCCC
GCGGGCGCGGCGGAGGGGAGGGCGCGGCGGGGGGCGGGTTGACTGCGCCCCGGGCGGCCG
CAGGTCTCGGCTGGCCCCGGAGCCAGGGGGACGCGGCGGGCGGCTCGTGCGTGCCAAGCG
CGACATGGCGCGGAAGCCGAGAAGCCCCGGAGGCCCAGTGAGCACGGGGAGGGGCTAGAC
ACTGGCTGGACAACCATTAGCTAGCTGGGGCCGGGCGGCTCGGGGACTACATTTCCCAGG
ACGCCAAGCGGTCGCGCCCGGAAGCGACGCGCCATGGGCACAGTGCGCAGGCGCACGCGC
CGCCAAGGTCTATATAAGGAAGGTTCGCCGCCGCTCTCGTCCTTTCGTTCCGGCGGCTCC
TAGAGCGTTTGCTTTGTTCCCGATATGTCTCGTCCCTCCGGGGTTAACTTGCAGATGGTG
AGTTGAGTCCACACAGCACAAGTTTTTTTTTTGTTAACCTCTTATCAAGTTTAGTCGCTG
TAACCGCTCCTAGTCTCCAAGTGTTGCTTATGGAGCGCGATCCCCAGGTTGACCTTCGAA
GACGTGATTCAAGTGGAAAAGACGCCTTCTGCTTTGGCCTGGGAAGCTTTTTGCTGGTGT
AAATGATGAACTCACTTTTTTCCCCGTCATATCGACAGTGCTGATGTTTTAAAACATTTG
CCAGTTTGTCCTGATAAACACCAGCCTTCGAGGACCCTGGTCTTCTTTGTTCCTGGTCGA
GGATATAGGTGGTGATGGACGCTTTTGTTTTGTAGGTTGACCTGACCAAGCAGGACAGCA
TGGAGGTTGGAGGGAGAGAAGGGCATCGAGGGAGATGAGAACTCACCTACCATCTGAAAG
TCTTAAGGTATGCATTCGTCTAGTGGCCTAAAGTGGCAATCACGTGCTTTGAAGAGCCTT
TAAGTGGGCAGTGATAGGGAATTTGATGCAAGAGTTACTGCTGAGGTTCGTTGTTTTAAA
AGCCCCGAGGATTGAGCCTTATTATCAAAGTATACTAAAGTCTTTTAATTGTGTATCTGT
ACATACTGACACAGGAGATGCAGAGCCCTGTTGTTATTTAAAGTGTCCTGGTAGAACTGC
CTGAGAAAAGGACTGATTAAGAAAATGGTCCCATTGAGATTAGTCTGTAACACATTTTCT
TGGCTGTTGATATGGGAGCATTCAGCAGTTTGTGGGTGCAGTGTCTGAGCCGGGTTGAGA
TTTCTTTTGTATATGCGTGGTATTTAGAAAGGCAATGAAACATGTCTGCTAAAGTATTTG
CAGGCTAGTGCTTTTCAAGATGTGACAATGGCTATCCTCCATTACTGTATTCTGATATCC
ACCCTGACCCACTCAGATAAAAATGTGAATATGCCCTAAATCAAGTAGGCCCGAGAAATG
GCTTAGCAGTTAAGAGCACTGATGGCTCTTTCGAGGGGTCCTGAGTTAAATTTCTAGCAA
CCACATGGTGGCTCACAACCATCTATAATGGGGTCTGGTGCCCTCTTATGGTGTCTCTGA
AGAGAACAATGGTGGTGTACTCGTGCATAAAATATATGAATAAATCTTACTCTTAAAAAA
AGTAGGCCCGGGCTGGAGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAG
GTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCTTAACGAGATCTG
ACTCCCTCTTCTGGAGTGTCTGAGGACAGCTACAGTGTACTTACATATAATAATAAATAA
ATAAATCTTTAAAAAAAAAAAAAAAAAGTAGGCCCAGGCAAGTTGACTTAAATTGAGGCA
AGCCTAGAGACTGAAGGGTGCTATGTCTGAACAATTGTCATATCATTTGCAAGTGGACAG
TGCCAGTCAGAGTTGTATATGTGAGACAGTTGCATTTAGGGTTTGGTGCTGGAGTCATGG
GCGCCTCAGGTCATACGTGAGGCCTCCTGGTACATAATGTTGAAACTTTCCAAGGCGATT
GTGATTATCTCAGCAAGTCCCATTCCTTTAGCTAATAATTGGAGACACTGGTATTACAGC
TGTCTCCTGTAAAGGAGATGTAGTCCTAAGTAGCTGTCTACCTAGCCCTTGGGATCAGGC
TCAGCAGCCTCCCACAGACAGGCATGTGTGATGACACAACTTTTTTCCCCATCAGATCGA
CCATGTTGATCACATTCTTTTAAGCCAGTATGTCTGACATGCCTGCCTGACAGTACCCAC
TGCTGCTGTGCCCTTGGCGCTCAGGTAGTTGACAGGTTATTTCTGCATTTTATCTCAGGT
TTGCTGACAGACAAAACCGGGCTTTGAATGGAGCGTGAACTCCTGAGGCGAGCATTGGTG
AGTGGTTTCCACGTGTCCCTCTTCCAGTGTATACTTTGTTTCTGACATAAACTTGGCTGG
TGAACTGATGATATCATTTCTTTCCCCGTCAGATCGACCCTGTTGATCTCAAATACTAAT
TGCCAGTTTTGTCTGATGCATCAGCCCCAGGAATAATTCATTGTTGGCTTTAATCTATTT
CACTTGATAATGGCTTCGATTTATTTTCTACAGGCCCGAGAGAGCCGAGGATGCAGGTGT
TGGTCTGATCTTGATTTCAGGTGAGGTTCTTTTACTGTTTTAACCTGTTTCTAGGGATGT
TATAACAAGTGTGGAGAGTAACGGGTGTTTGATTCTTGGCTTTTGCTGCTCTGTTCATGC
TGTTAAGGTTCCTGGTGGGATTCAAGTTCACCATGTTGCTTGCTAAGTGGGGGTGGGGGA
TGTGTTCAGCCAGAAAAGCCTATCAACATTTTACTTTTCTTTTTAGGTACTTTTGGAATA
CAGAATACCAGATGTGTTCCTGCTGCCCAGCCCCACAAGGCTATGCAGAATGCAAAGAAG
AGTTACTTTTTGGCTGGGGAGTAGTGGTATCATGTGCACTATTGCTGGAAATAATAAATA
TTGGCCTATCTGTAGAAATAAAAATCTGACTAATGATATTTATCTGCTGTGTCTTGAGTT
TCTGGGTTGGGTGGGCCTACAGCTGCTTCCTGTGAACATTTCCCACTGCCTTAAGTGGGA
CAGCTGTGAGTAGCTAGCACCCTGGTGCTAGCTTTTAAGTTACAGGTCAGCCTGGCTGTA
GCTGCTTTGCTGCTCCTGGCTTGCAGAGCATCTCCAGCCTTGTGGGGCCCAGGGATCACA
TTAGGGTTACTGCAGGTGAGAAGTGGCAGCCAAGGTTATCTGGACTTGGGGGTGACTTTG
GCTCAGGTAAGTGGGCCTGAGTTTTTAGGTCCAGTGGCCCTGTGGTGGCTGATACATGGT
TTGCCTGGCTGCTTCTCAACAGCCTCTTCTAAGCCCAATCCCTCTGTTTACTAAGAATCA
TAACCACACTTTTTAAAAAGATTGTGGGGCTGGAGAGATGGCTCGGGGTAAGAGCACTGA
CTGCTCCTTCCAGAGGAGCAGCAACCACATGGTGGCTCACAACCATCTGTAATGGAATCC
AATGCCCCTTTCTGCTGTGTCTGAAGACAGCTAGTGAATTCATTACACAATCTTTTTTTT
TATTTATTTTTAAAGATTTATTTGAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAG
GGTGTCAGATCTCATTACAGGTGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTC
AGGACCTCTGGAAGACCCGCCAGTGCTTTTAGCACACCCTGGTGCTAGCTTGTAAATTTA
GTTACAGGTCAGCCTGGCTGTAGCTGCTTTGCTGCTCCTGGCTTGCAGAGCATCTCCAGC
TTTGTGGGGCCCAGGGATCACATTAGGGTTTCTGCGGGCTGAACTAGGTTCATGGAACTA
CCAGGTTCCATGCCAATCAATGCTTAGCATATTGTATGACTTGTTAACCACCTTCCTATA
GTACAGAGGTCCACCCCACAGTTAATGTCCCTGGAAGGGACAGTGGGCCCTCTACATTTA
ACAACCCTTCAGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1076, 1415..1506, 2938..2996, 3213..3259, 3466..3634
2967..2996, 3213..3259, 3466..3625
NM_001081005.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved