Mus_musculus Locus A930034L06Rik
snOPY snoRNA Orthological Gene Database
Mus_musculus A930034L06Rik
Mus_musculus
A930034L06Rik
2
SNORA71, SNORA71
3585..3717, 4897..5029
12508
TCACTCAGAAGGCAAAGGCAGGAGGATCTTTGTGAATTCTTCAAAGTTAGCCTGGTCTA
TGTAGTGAGTTCCAGGACAGCTAAGACTAAATAGAGACCCTGTCTCAAGAAAGGCAAGTC
AAACTAAAACAAGAAGCACTGCTGAGCCACTTGCATGAGCTTGATGTCTCTACTTCACTT
TGTGCAAACCCTCCTGGATATAGTATACTGAACATTCCATAATTCATTCCTTATTTTCCA
TCAGGCTTTAGACTGTCTTCTCTTCAGAGACAGCCCTGATGTCTACGCTGGATAAATAAA
TAGGTCACCACTGTCACAATCTGCCTACCACTATTTCATTTGTAGTGCTTATGGTTTTTT
TTTAACATTTATTTTATTTTATGTGCAATAGTTTTTTGTCTGCATATATGTCTGTGTAAG
GGTGTGAGATTTTCGGAGTCACAGTTATGAGCTTCCATCTGGGTGCTGGGAATTGAACCC
GGATCCTTTGGAAGAGCAGTCAGCGCTCTTAATCACTGAGCCATCTCTCCAGCCCTGCAC
TTATGATTTTTAGTGGTTGAATTTTCTGGCCTATTTGTTTATCATACTGATTAAAATATA
GCCGAGTTATGGATCATGTTTGTCTTATTCCTTTTATTTTTTAGTGCGTAGTCTGGCCCT
TGATACGATATTATGGGTGGATGCAAAGCTAGATGAGTATATGGATAGATGGATGGATGG
ATGGATGGATGGATGGACAGGCAGACAGATGCATGCAGATGAATAGATACATAAGAAGGC
AGGTGGGTCAGTATGATAGATGACTAATGGGATGAGAGGAAGCTGGCGTTCTGCACATAT
TTTCTGGCAAAATGGATGCATGGACTGATCGGAAGAATGGAAGCTAGGACTAAGGAAGGA
GAGCCTCGATGGCGCAGTAAGCATTTCGGTTCTACTCCTGCAGGGGACGCTGCAGAGCCA
CGCCCACTGGCCAGTTGCGCAAAGGCGAAGCTGGAGACTGCAGCGCGCGCAGCCGCAGCT
GGGCAGACACTGCGGTTTTCGGGGAGTGTCCTGCGCAGTCCCGCACTGCGGCACTCACTC
ACGCACTCAGCCTGCTAGGCAAGTCACCTCGGCTCTGCGCTCTTGGCCGCTTCCAAGACC
TCCAGTCTTCTTTAACCGGATAAACCCAGGAGCCGGGAAGCTAGGGTGCAGGCGTGATCC
TCCAACCCTTGAGAGCTATGGACCTCCTGGAGTACTGGAAAAGAGATCGTTGGTAGGCTG
GGACTTCCGCCTTGCAGGGTCGGTGGGCTACAGTTGAGCTTACGCCCAGCCTTAGGGGAG
GGAGCCGGTAGGAGAGAAAGACCAGGGGACGCAGTGCTAGTGTCCGGGCGGAGGTGGAGG
GTTGGGGGCTGAACCCAGGTGAGGTTCATGAGGCATGCGAAGCCTCTTGTCCTTTCTTAC
ACAGGGTTCTCGGACTGTTGACCTGCGTCCTTCCAAGCTGATAAGCCCAGGACCCTAGGA
CGGGATGCTAGGACTCCTGTGTGGCGCCTTGCTTTGAACCCTTTCCCAAGGGCTGTTTCC
CAGATGAGCCTTTGCCGCAAGGCCCTCTTGACACCAAGGATGACGACGCAAAACCTGCGG
CAGCCAACACCCCTCTCCCCACTCTCCGCACTCACTGGTGGGTGCCACCATCCAGGAAGC
AAGTATCCCGGTAAGTGCTGCGGGTGCACCTTGAAGCCTGAGTGCCACCTAATTTTAGCC
TACCTATGGGCACCAGCAGAGGGGTAGTGTGGAATTCACCCAGGTTCAGAGGTCAGCCTA
GCAAAGACCCTGTGCAGGAAAGCTTGGGAGTCTGGACTCAGGCCATAAAGACCTCAGGTC
CTTTGTGAACTAGTTCCTTCATTCCCAGGTAGGGAAGTTGCAAAGGCAGATCTGGCTGCT
TGTCTTATTTTGAACCCTAGTGCCTGGCTGTATGGTAGCTATGCCCTGTGGTATGAATGA
AACCGATTTCTCATTTTGAACGTAAGTTGGTCTTCGAGTGGGGGCAGGTAGATTTCATAT
GGCTGAGGTCTTTGAAGCCAGCGGTTAGCCAGTTAGCCAGCATTTTTCCATTTGAGGTTC
TTTGGCAGGAGATGGGATAAAAAACCTTTTGGAGTCGCTGCCGTTTATCAGAGCTTGGAG
GAACGATCTGAAAAGTGCTCTCTGACAGGTAATGTGTTGTTAGCATCTTTCTTTGTTCAG
GAGAAAGTGCTGCGTCATTAGTTATCCAGCCTCGGGTGTATCTGTTGTATTTGGCTGTCG
CACCAGGTTCTCTGCCCAGGTCAGACTTGGCCAAGTGACATTTAGATGCTGATTTAAATG
CTTCTTGTTTATTGCAGAATTGACAGCTTGGTGCAGAGGGGACATGAGAGGTGTCTCTGT
CCAGCTAGGAAGCAGCTGGACCACAGCGCTCCCAAGGTAGGATCTGAACCTAAGATGGCT
GCCCTCCGGGAAGGGGAAGGAGAAGGGGAAGAGGGGCGGGGCTGGAAAGATGGCTCAGTG
GTTAAGAGCACTGATAGCTCTTCCAGAGATCCTGAGTTCAATTCCCAGTAACCACATGGT
GGCTCACAACCATCTGTAATGGGATCTGACACCTATTCTGGTGTGTCTGAAGACAACTAC
AGTGTACTCATATAAAACAAATAAATATTCTTACAAAAAAAGAAAAGATGGCTGCCCTCA
AGAGATGCTCACAGGTTCCCAGGAATGGGATAGACTGGAAAGTAAACAGACAGAAGATGA
AGGTGGCTGCATCTCTGTCCCCCAGTTTTGTTTTGTTTTTTGTTTTTGTTTGTTTGTTTG
TTTTTTCGAGACAGGGTTTCTCTGTGTAGCCTTGGCTGTCCTGGAACTCACTTTGTAGAC
CAGGCTGGCCTCGAACTCAGAAATCCACCTGCCCCTGCCTCCCAAGTGCTGGAATTAAAG
ACATGCGTCACCACGCCCGGCTCCTGTCCCCCAGTTTTATTCTCCTTTGGGCCACTGATA
TACATCTAATTTCTGTTGTGCCTGCTTCAGTTCTGAGTCCTCTGCAATGCTTCTTGCTTT
GGTGGGTTAGCAGCAGAAGGTCTGAATCAGACACGGGACAGTGCTGCGTATCTACCTGGA
CCCAGGTCTGTCTTGATTGGGGTTTCCCTTGCTGCAATGAAACACCATGACCAAAGCAGC
TTGGGGAGGAAAGGGTTTATTTGGCTTAGACTTCCACACCACTGTTCATCATCAAAGGAA
GCCAGGACAAAAGCCCAGACATGGCCAGGAACCTGGAGGCAGGAGCTGATGCAGAGCCCA
TGCAGGGGTGCTATGTGCTGCCTGGTTTCCTGGTTCTTACTCAGCCTGCTTTCTTATATA
ACCCAGCATCACCAGCCCCAGGGGTGGCCCCACCCACAATGGGCTGAGCCCTCCCACATC
AATCACTAATTTAAAAAATGCCCTACAGGCTTGCCTACAGCCCAGTCTTATGGAGGCTTT
TTCTCAGCTGAGGTTCCCTCCTTTCAGATAACTCTAGTCTGTGTCAAGTTGAAACTGACT
GCTCTAAACTTCTGCGTTTGACAGCAGGCCCTCCACCTTCTCTGGCCCTGCGTTCGTAAG
TGATCAGGGATACCCATGCCCTGACCATTGGTAGTGCAGGCAGAGGAAATGTGGAAAGAA
CTGTCCCGTGCTTGGAAGGTCCACACCCATGCCTTCCAATGCTGGGAGCTTTCCCACACT
ATGGTTTCTCAACTCAGCATACATTTGGCATCCATCCATTCCTGTTGGGCACTACTTATA
TTGGTGGTATGATTGGTGGTGACTGCCCTGCCATAGGCCAAACACACTGTTCTTTTTAGC
AGTTAAAGCCAACAATGGGTTCGTTCTAGAAGTAAGAGCCAACAGTTTTGGGATGCTTAC
TGACTGGTAACTTCTGTGCCAACCCTTTGCCCCATAACCACCATGCCCTGCTGTAAGCAG
TGGCAAGCTGGGTACTCATCAGATTTCATTTGCTTTGCTGGTGACTCCACTGTAGATAGA
GGCATCCTGAGTGTTGCCATGTCAGGAACATTCTAGACCCACCTGTACTTGAGGTCAGAT
CTCTTGTCCAGTCAATTCTTTGGAGCATTGGTCCCTTGCATGCAATACAGCACTATGCAT
GTTGCCACGGGTTTTCAGCGATGATACAAGAGCCGACTGGACACGGGACTCCTGTCCTGT
CACTCTCTGAGTCAAAGATAGACTCAGAACTTCATTTTCAGCATTTGAAAAATAAAAGGA
TAGGTAGATGTGGTGGTGCACACCTTTAATGCCAGCATTTGGGAGACAGAGATCTCTGTG
AGTTCGAGGCCAGCCTGGTCTACAGAGCAAGTTCCAAGACAGTCAGGGCTACACAGAGAA
ACCCTGTCACAAAAAAAAATGAAAAATCAAAAAACAAACAAACAAGAAAGAAAGAAAAGA
AAAGAAAGGAGGGGGCTGGAGAGATGGCTCAGTGGTTAAGAGCACTGACTGCTTTTCCAG
AGGTCCTGAGTTCAATTCCCAGCAACCACATAGTGGCTCACGACCATCTGTAATGGGATC
TGATGCCCTCTCTGGTGTGTCTGAAGATAGTGAGCATATTCACATATATAAAGTAAATAA
ATCTTTAAAGAAAAAAAAAAGGAGAACTAAAACAATGACAGGCAGAGATAACTTGTGTTC
CACTTGAGCTAATGTGCCTGTCCCAACCCCTTATGTCTCCCAGTAGCCGTGCTCAGGGGA
TCTTTGGTTATCCTTGGCCATGAGGCTTTATTGGGCCTTTGTAGGAAAGAAGGACCATGG
CAGGGGAGCTATGCTTAGCTAGGCTTTCCCCGGACTCAACCCTGCAGGCCTCCAGTGTCT
GCATCTCTTTTTGGCCTCATGTCTGTTTTGCATCTGCACCTGCATTTAGAAGCCGACCAT
GGGCTGCGTGTGCTCTGGCCATACATGATGCAGGGAGAGGAGTTGCTGAAGGCCGTTTCC
CGTGTTTGAAGGGTCCACTCCTCCCTCTCAAATGCTGGCGCTTTCACACACTCCTGCCAA
CACTTAAGCCTCCCCACAGGACGTGGATGGCTGCGTGAGAGTCATCTCAGTTTTGTTTTG
CTTTGTTTTGTTGGTTTGAGACAGGGTCTCACTATGTGGGTCTGGGCTGGCCTGCCTCTG
TCTCCCAAGGGCTAAGATTAAAAGAGTCATGTGCTGGGGCTGGAGCGATGGCTCAGCAGT
TAAAAGCACTGGCTGCCCTTCCAGAGGGTCCTAAGTTCAATAATTTCCAGCAACCACATG
GTGGCGCATGATTATTTATAAGGGGATCTGATGCCCTCTTCTGGCGTTTGGGTGTACATG
CAGCAGAGCACTCATACATTAAGTAAATGGATACATTTATATTTTGGCTTGGGCTTTCTC
AACGTGGCTCTCTTCTATCAGAGACCAAGGTTTTGACACTTTCGCATCTAGGAAGGCCAA
GGTGAATTGCACATAATGAGTGGTACGTACTCACCACTACAAGGTTTTTATAAAGAAGCT
ATCTTTTTGTGTTTCTTTTCTTGAAACAGACTCTCTTTGGAGTCCTCTAACTTGCTTTGT
GGCCCAGAATGGCCTTGAACTCACAGAGAGTCTCCTGCCTCTGCCTCTAGAGTGGCTGGG
ATTAAAACCACCATGCCAGACAGAAGCAATCTTTTGGAGTTGGTGTACATGCCCGAGTGG
GCCTTTGAAGAAATTTGATTCAATGAACAAAGGAGACTTTTTTGGTTTGTTTTTGTTTTT
GTTTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTACTGGAACTGTAGACCGGG
CTGGCCTCAAACTCAGAAATCCACCTGCCTCTACCTCCCAAGTGCTGGGATTAAAGGCGT
GTGCCACCACCGCCCAGCTACAAAGGAGACTTATAGGAGAAGGCGTGGGAGGGACTCTGA
GGTTGACATGCAGGCCACTAATGACAGTATATAGCGGAGGCTGCTGGATGTTGGGACCTT
GGTGGGAGGAGCCCTGAGAGGAAGGCCCTGAGCTCTGTCTCTGCCACTTATATGACTACT
CAGTTGTCCTGTGGGGAGCTGTTTTAGACTCATAGGTCTGCATGCGTGTTCACTTTCTGT
CCATCATTAATTAGGAACGTACTCCCCAACATCAGTGTGGAGCGACCAGAGAGCATGACC
ATCTCGCAGTGATCGCCTGCAGGGGCCTTAGCCAGGTGAGCTACTGCCAGACCGCTGGGT
CAGAATATGCAATCTGGAATGAAAATTCTAAGCTACTGGCCTTGCCTGGTTTTCTGCCCT
AGGTGATGGTGGTGGTACCCAGGAAGAGCAAGGTTGCTGGCACGCAACATGCCTGCAGCC
CTTGATGCTGTTGGCTCACCAGCACGGAGCACCTTTTTACTTTGGTAGGTATGCAGAGGG
AAGGGCCTTGACTCTGGAGACTTGGGGACCAAAGTTAGAGACTCGCTAGGTCTGTCCCTC
CCTTTAGAGCCACAGAATGCCACGTGGCACTGAGGTTCTTGCTCTCACAAATAAGCACTC
GGGAAACCAGCCGTGTTAAACACGCAGGTTGTCTCTTCAAAGGGAGAGACATATATCCTG
TTTTCCTCCCAGAAGGCTGGGAGCGGAGGTGTTTAATATCCTGGCGAACTTTGTGCTATC
TGTATGACCAAGACCATGTCAGAGCCTCCCCTAGAGCCTTAAGGTATCATCTATAATGGG
TCAGCTAGGTGGGGGGGGGGGGGCGCATGCCTTTACTTCCGGTATTCTTCTCCTAAACCC
TTAAGATGTCATATGTAATCAGTCACCTGGGTGGTGGTGGTGCATGCCTTTATTTCCAGG
ACTTGGGTGGCAAAGGTGGGTGGATCTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGA
GTCCAGGTCAGCCAGGACTACACAGAGAAATCTTCTGTCTCAAATAAACAAAACAAAACA
AAAAATAAATAATTTAAAAAAAAGATGTCACGTGTAGTCAATTATCTTTATGGAAAATGT
CATGACTTAAGCTTTATTATGTTAAACTACCTGGTATCAGACTCTTGAAGTTTGAACCAA
CACTTAGCCGGGCGATGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGACAG
GTGAATCTTTGAGTTAGAGGCTAGCCTGGTCTACCGAGTGAGTCCGGGACAGCCAGGATT
ACACAGAGAAACCCTGTCTCAAACATAGAATTAAGTAAACTAAAGTAATAAAGACATTTG
AATCAACACTGGCTACTGAGTCATGTTGAACCAGATGGCCTTTTTTACCTTACTTGGGTT
ACCACCCTGGCTGTTTGAGATACCTGCAAGGACCCCCCACAATGGCGACCAACATGAGAG
TCTCCAGTCTTGGAGTAGGTAAGAGAATTTTTCTCTAGTCACCCAGGAGCAGTGCGTGCT
CTCACCCAGGAGGTAACAGGTAAGTGGGAAGATAGAATATGCCTGGATTCTTCCCAGTCC
TGAAACAAAGCTTTTTTTTTTTTTTTTTTTTTTTTACAATTACTGAGCTGTTGGTTAAGA
TCCAGAGGAGGGAAATAGTTAGAGCAACAGAGCTGCAGCTCTGCACAAGTGTCAGTCAGA
TTCAGTCCCTTGGCTTCCTGAACAAGAAATGATTGATGTTGAAAATTGGAAATGCAGCCA
GGTGGTGGTGACGGTCTATAGACAGGACTACCAGGCCTAAATAAACAGGGTCAACTGGAC
CCCTAAGAAAGATGAGATAAAATGCGTGCCGATTATTTTGCTAGGTGAAGTTCACGTATT
GTCCTGTGTGGCGCGCAGTCTCTCTCGGGAGGGAGGATCATTAAAGAAGGTTTTGTTTTC
TCTGTAGGTTGCCGTGGACTCCGCTGCTGGCGCTCCGCAGAAGCCACCTGGAGGATGACC
AGCCAGGATTGTTCAGGGCTTTCATTGTCTTGGTCACATTGCTTCATTGTCTTTGTCTGT
CCAACCGTCTGTCTAATCAGCCTTAGCAAAATAAGCTATTTTATCTTGTCCTTTCGATTA
AAAAAAACAACAAAAGACAGACTTCAAGCCGTTTTGGCACCCAGAGACCAAACCCCACCC
AGAGTCTTTGTTTTTATGATTACTAAAACTTCATGTCTTAAATTTATATCTTTGTAAAAC
AGAAAAAAATTTAAATAGCAATGTGATCAAACTTGGATTTTAAAAAAAATAGGGGCAAAT
TGGAACCAAGAAGGAATATTTCTTATGGATAATACGGTGGCCAAGGACTGAAAAACAGAA
GTGTAGTCGATAGGAGTTAGATTACTTGAAAGTTTCCACCTAAGATTTTTTTGGTACAGC
CTGAGAATAGGTGGGATGTAGTAAGGAATAGAACGGTCCAGAAAGTTCTTCTTCCATGGA
AATGTTATTCTTCGATACTGTTCACATGTTTGTTTTGTTTGCAGTGTCAACCGGACATGT
TCTTTCACACTCTCGTGGGACAACCCAGTTGTTTCCCACTTCGGGATGTTCTGTGATGGT
TCCTCAGGTACTTTGTAATCTCCTGTTAACCTGATAGGAGAGTCTTCTTTCTTTCTTTCT
TTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT
TTCCTTCCTTCCTTCCTTCCTTCCTTCTTTCCTTCTTTCCTTCTTTCCTTCTTCTTCTTC
CTCTTCCTCTTCTTCCTCTTCTTCCTCTTCTTCCTCTTCCTCTTCTTCTTCTTCCTTCTC
CTTCTCTTACTCCTCCTCCTTCTCCTCCTCCTCCTTCTTCTCCTTCTCCTCCTCCTTCTA
TTCCTCCTTCTCCTCTTCCTCCTCCTCCTTCTCCTCCTCCTCCTCCTTCTCCTTCTTTTT
AAAGATTTATTTGTTATTATGTGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGGAGA
GGTTATCAGATCTTATTACAGATGGTTGTGGGCCACCATATGGTTGCTAGGAATTAACTC
AGGACCTCTGGAAGGGCAGTCAGTGCTCTTAACTGCTGAGCCACCTCTCCAGCCCTTATC
TTTAATTTCTAATAACTAATGATATTGCATATATTTCCCCTTACCATTCCTCTCTTGTGT
GGCAAATGTTTGTTCAAAGCCATTGTACAATTTTTACTGCTGGTAGTAGCTTTCTTATTT
TTGAGGGCTTTGCTTTATTTTAGTAGTTTTTTTTTTAATGTAGCAAGATAACATAATATC
ACCATTTTAGCCATTTACCTAAGCAAGCCTCAAACTTGCCATGCTGGTCTTGAACTCATA
ATCTTCCTGCCCCCAGCCTAAGCGCTGGGCTATAGGGACATGCCATCATTGGCGCTGTTT
TGTTTGTACATTTGCTTTTTCTTAAAAAAGATTTATTTATTTATTTATTATCTGTAAGTA
CACTGTAGCTGTCTTCAGACACCCCAGAAATGGACATCAGGTCCCATTATAGATGGTTGT
GAGCCACCATGTGGTTGCTGGGATTTGAACTCCGGACCTTCAGAAGAGCAGTCAGTGCTC
TTAATCTCTGAGCCATCTCTCCAGCCCCCAGGAGAGTCTTCTTGAACTCAAAATTCAAAT
TGCCCTAAAATGTAAAGATCCCAAATCTTACATAAATAGCCTTAGGTTTAAATCTTTCAA
AGTTAATGTGAATTAAGTAGGATTTGCTTGTGGTTTAGTTTTGTGCCTGCCCTTGGTCTG
ACGTAAAGGAGCAGACAAGGGAAGAAGTTAGGGGAGGCTCAAGAGCCCTGCCTTCTGTTC
AAGGCTCATGTTACACAGTATTCCAAGTTTCTAGTGCATATTAGTAGTGAGAGGTTCTCG
CATCAGTGTGACATCTACAACTGTGTCTGGGGCCTTGTCTTCTGTCTGTAGAGACCTGTG
CTCGTGTACACTGCAGGCATGTATTATGCCTCTCCCTAATTAGACAGCAGGAGAATACAG
CCCCAAGCATGGCATAGGGTCCTGGGGGCTCCAGGAAAACACCATTCTGTCATATCTTCA
ACTTGACTTTGTCAGATAGCTCTTTACACATTTCTTTCTAGGACTCCCATTACGACTAAA
AACTGATAAATGGACTTGCTGATACTGGCAAATGATTAAAAAATTTTTGAAGTTTATGGA
ATATTAATCATGCTACTGAACTCCCTTACAGTTGACAGTATCAAACTATTGTAAAACAGC
ACAATTCAATACTCAAATTACAAATTTGAATTCCCACATCTTACTTTTAGCTAGGCTAAC
TCTAAATTTTTTCACTTTAGAGCCGAGCAATGGTGGCACACGCCTTTAGTCCCAGCACTT
GGGAGGCAGAGACAGGCAGATTTCTGAGTTCGAGGCCAGCCTACAACTGAGTGAGTTCCA
GGACAGCCAGGGCTACACTGAGAAACCTGTCTTGAAAAAAATTAATTAATTAATTAATTA
AAATTTTTTTTCACTTTAAAAGAGAGTGCTTTTTCTACTTCCAAAAAAATTTTGCCCAAG
GGAGACACTACCTAGAGTATATATTTAAAACAAAAACAAAACCAAAAACCCACAAAAAGC
AAAAAACCTAACAACTAATCAATGGGAAATGCCCGGTGTCCTGCCATCGAGGCGAGGTTA
TGCTTATGTCTTCCAGAAAATGAAGTCCCAGATGGCTCCTGCTGTGACATTTCAGACAAG
GACTGCATCCCAGAGACCACCAGACAAGCAAGGGGTTGAAGCTAGACGACAAACCCATCA
AGAGGAGACGTCCCAAGAGGACAAGGAAGCCAATAACGTGGAGAGACTTAACTGGTCAAG
CCAAGACTTTGGGGAAGCAAGAAGGACCTGATACTGCTGACCCCAAAATGATGCTGTTAT
GTTTACTGACTGTATTTCATGTTGATTCTCAGCCTGTCGGTGCAGAATCCAAATGCCTTT
TGTCAAAAGGAGGGATAAAGGGTGCACCTGTAATAGGACACAGTATAACATTGTATTGCT
GTGCTAATCATTGTTTTTATTCTTTGGGACCAGCTGTCCAGGCAAAAAGAAGAGTATCCA
AACATTTAGACACATGAATGGGTGGCAGCTTGGTTAGACTAACTGAGTCGTTCAAATGTA
ATAATACAGATTTTAGCTTAATGCAGAACTCTTTAGAAAGCTCAGATGGAAGAAATTATA
GTTGTATGGAAATGAGAAAGGGAATAAGTGATGTATGGCTTGCTACGATTCAACCAACAC
CAGTTACTAAGTAGGGTTGAGTGGGGCTGCCTTCTTGTCTCCAGGCGAATCATTACATTA
GTCTGCTGGCCTTGGTGGAGGAAGTATGCCACTGAGGGAGGGGAGAGCCTTGAGAGTTTA
AAAGCCTCGCCTTGCTTCCAGTGTAGTCTCTGCTCTAAGCTTGACCTTCAAGGTGTGATT
GCTCAGTTTCATGCCCCTGCCACCATGCCTGCTGTGTGCTCTCATGCCTTACCGCTGTAA
TGGACTCACCTCTCTTCTGGAACCACAAAATAAACACTGTCTTCCTTAAGTTGCCTTCGG
TCACATGTTTTATCACGACGGAGAAGTACCTAAGACAGGCGGTGAAAGGCTGTTGTCAGA
GAGCACAGTGCAGATTTCCGAAGTCAGCACTCAGTAAGGGACAGTTCTTCCTAACTCAGC
CCTTTGTTTAGTTACTGAATGCGTCTCATCCCTGGCCCAGCCTCTCCTGTCTCCCAGTTG
CTCTTAGCTTCTTGCATCCTGTCTGGCTCTCGGCTAAGCAAGGGACATGGATGAGACTCC
CATTTCTCTTCCACCAAACCAGCCCCTCCTCCCTCCCCTTGTGCAATAAACTTCCATGGG
CACCCCAGCCCCCAGCCACTGTGTCTAGTCCTGAATGTGTTCTTTCCCTGTGTCCTCCAC
AGGGCAGCTAGCTCCGCAATGTCACCTCCTCCAGGAAGAGCACTCTCTCTGCCCCTCCCT
TGCCAGTTAATACAGGCAGTTCTAGGACTTAGCCAAGCAAACAAACCAAAGGACAGACAG
ATCTCTTTCCTAGGACTGACCTTGCAGAGGACGGGGCAGAGGATTGACCAAAGAACTTTC
ACAGTGTGCTGGAGTAGGACAAGGAGAAAGTTACAGAGCAGGGAAACGGGCTAGGAAGTC
CAGAAGAGTCCCATTTTGTGCTCGGTAGACCAAAAGTCACCTAGGTGATGAGTAAGTGGG
GCGCTTACCTCTATTATTACTCCAGCCCGTTTAAGTTTCGTCACAGCGTCGACCATGTTG
GAGAGGAGCTCTCTTCATGGATATCAGACCCAGTGATCTGGGAACGCCACAGTGTCTGAG
GCCTTAGGAGCCATTCCTGGTTGTAAATGTCTGCCAGCCATTAAGGTAAAGCAGGCAGCT
GGGTCTGGCCAGGGTTTGCAGCAAGCACCAGGTTGGGTATATCTGTAGCACCCCAGCTTC
ACACCAGCCAGCTGCACTTCTCCTTTACCCTGACTATAGCTCAGTGAACTAAGAAAGCAC
AGTCACCCAAGGGCAGCCATGGATTAGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1251, 1444..1689, 2357..2435, 6134..6214, 6302..11508
1563..1689, 2357..2435, 6134..6188
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved