Mus_musculus Locus Snx5
snOPY snoRNA Orthological Gene Database
Mus_musculus Snx5
Mus_musculus
Snx5
2
SNORD17, SNORA70
5357..5594, 9847..9984
22450
GTTCAATGTTAATGTGTTGGCCGTTTCGGATATGACACCTTAAATCTGAATGTGACAAG
GCCTGGAGGCATAGACCAGGAAACTTAAGTTACTTGGGTGGCTGAGGCAGTATGAAATTG
AGATTTTGGGTTAGCTTGGCTTTGTCTCTAGAAACAAAACAACTACAATCTGCCCCCCCC
CAACAAATTCACAAGTCTTAATTAACAGTTAAACACCTACATCTACATACCAAACTCTTA
CTAAATATTCTGTATGGGCATCGCTCATCTATTCCTCACGCCGCCCTTTAAAAAGTGGGT
GCTACTGTGACCTCGTGGTCCAGACTCGGGACATGTCGCAAGTGGGTCTGCACAGCCCAT
CCAACGTTAATTCCAGAAAATGATCTCTGCAGGTGTCTCCCATGGCTGCGACAGGACAAG
CGTGGCCCTTCGTGCCCGAGTTTGGATAGGGAAGAGAGTATTTAAATAGAAGGTCGGTCA
GCGGCAGGGTTCTAGCTGTACCTGAGATGCCACCACGCTGTAACACCCAGCCCGCAAACA
ACCCTCTCGGGACCCGTACTTTCATCGGTCCCGCGCTTTCCCAAAGCGAGGCGGCCCCAG
CATGCACTACGGCGTTCCCGTCGCACCTGTGAGGCGCCATCCCCTCCACGCCCCCGAAGC
AGAAGCGCGGGCGCCGTCAAGCCGCGCGTTGTCGCGCTCACGAGATCTCGCGCACGTCAC
CGCCGCTCGCCATCTTGGACTCTGGCTGAGCCATAAATTGCCCGGGCCGCGGTGCGCGTC
CTTTCTCGAGGCGTGCCTCGCCGGCGGAGGGTTCGGAGCCCGCGTTCCCGTCGCGGCCCT
CCGGTGCTGGTGTCCGCGTGGCGCGGAGCGAGGGTAGGCTCCCCGCGTAGCTTCTATTGC
CCGGCTCCAAGATGGACGGCCGCGGGGACGGGGGAGGCCGCACTGGGGGAGCACGTGGCG
TGCCGCTCGCTGGCCTGCGCCCGGGGCTGCTGGGATGGTGGCGGAGTCCCGCGGCCTCCA
GCCGCCGTCCGGCAAGGAGGCCGGCGGAGGCGGGGCCGCGGCCGCCCCTGAAAGGCGCCC
CGGCGGCGGCCCAGCCTCTTCTTTCCTCGCACAGCCACACGGCCCCTGCTCGAGGCCCGC
GTCGCCATGGCCGCGGTTCCCGAGTTGCTGGAGCAGCAGGAGGAGGACCGCAGCAAGGTG
AGATCCCTTCCTCGCTCGCTACCTGGGCTGGAGGTTCCCGCCGGCCTCCTTGGGCTGGGT
GGATCTTCTCTGGGGCTCGGACCCCAGCAAGATCCCGAGGTTTTCCCTCAACCACCCCTT
TAGAGATGGCTTTCCAACGGGGTGTCTCTGCACGCTCATTCTCTGACCAAGGAGACCCAG
ACAAGTGGGACCCCACTTCTTGAGCTCTCGGTGGGAAGCTGACCGACGCTCTGCCAGTCA
TTCGACTGAGGCTAATCCTCTGAAGCCCTTAGGAGCGTGGTTTTTTTTTTTTTCTTTTTT
CTTTTGCTCCTAAAACTTAAATCGACTACATGGTAATTGGAAAGTGGATCAAAGTTTCGT
TTGCTATTCCTATCTCCTTTTAAGAAAATGGCCTTTTCGTTTAAAATAGTGGGGAGATTT
CTAACGAGTATCTGTATGTAGCATGGTTTTTGCAACTTGGGAACGCTAAATGTGTCCTCG
TGGGAGTTGTAATTTTTAGTAAATCCTGTGTGTTGATATAACCCTCGGGCTGCAAATATC
TTGAGGACTAATGCAATAAACAGGGATTGCTATACGGGCAATAAAGGATTCTACTTTTAT
TGGCTCTTTAAACTTGAATTTTCCACCGCACAGGTAGGTTATGAGTCAGTTTTGTGGACA
AAATCGTCAGTAATATGGGAGCTCTTAGATTTTAATAAGAGCTGAATTAAGATTTCATTT
TAAGTACCTTTGAATGGGCAAACATTTTTTTTTTTGTTTTTGTTTTTGTTTTTCGAGACA
GTTTCTCTGTATATCCCCGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAA
CTCAGAAATCCGTCTCCCAAGTGCTGGGATTAAAGGCATACGCCACCACGTCCGGCGCAA
ACTTTTTATCTAGTAAGTAAATACCGGTCTCTGGCGCACCAACCAGTTGGATTGTTCCAA
CAAGGGTATTGTATTGAAATAGAGCTTTGTGCGAGGTGTTTTATTTCTTTTACATTAGAA
GAATTAGTTTCTCTCCCCTGGCATATATAATAGGTACTAGGGGCAGGAGAGGCCCTGGTG
GCTCTTTTTTTCCTCCTTTTTTGGTACGGAGCAGAATCATTTATGTAAAATGACTTGATC
GTCTTTATTAACTGCTAATAGAATTTTTAAAAAAATGAGTTCACCATCACTCTGATAAGC
AAAATTGGAGATGATCACAGTGGAGAAAACGACAACTTTGGCTTTCTCTTGAGTTAAAGA
AATGTTGAGGTAAATGACTGGTTTTAGTACATGGTTTCGTTTGTGTTATCTGGTCTGTAC
TAGACTGGCAGATCACATCTGGATGGCAGTCATTTGAAGGGAATTTGGCAAGTGTCAAAG
AACTGGAGTTCAACTTGGGCAAATTTGTCAGCTAATAAATTTTGCCATTTTATTTAAATG
TTCGGATTATTTAGTTTGGAATTTCTATCAAAATGGGATTCTGGAAGTTGCTCTAGTGAC
TAGATTAGAATCTAAGGATTCTTCAGATGAGAATGAAACTCTGGGATTCCCTCTAACCCT
GAGCTAGTGCTGAGGAGTTTGAATGCTAGTAAAGTTCCTTGGCAAGGTAAGGAGGCCTGA
AAGGAGAAGTCTGATATCCAGACATTTTAATTACTATAAAGTCTTTTACCCCAAGGTGTT
CTCTCCTTAAGATGACTTTAGGGTAGAATTGCATACCATATGTGTCTTACGTAGAAAGCC
TGTGCACTGTTGGCTCCTATAATTTGGTTTAGTTTTCCTTTAGTGTGGTAGACAGAGGTA
GAGATTTACCAAGTCTAGCTGGGGTATGTGTGTAGGTAGGGTCTCCCTGCATAGAGTAGG
TTGAGCATTATCTCAAATTGTGTGTCTTGGGGTTTTTGATATTAGTCTAATGAGTCTAGT
TTAGGGTGAATCAATGTAACAGCTTTGTTTTGTGTTGGTGTTCTGATTGTCCCTGGATTT
TCTTTTCTTTTTCCTTTAGTTTGAAAAGCTTGAAATTTTTTGACTAGATGGATCAAGTGG
TGTTGCATACTGTAATCTCAGCATTTGGAAGGCAGATACTGGTGGATTTCTGGAGACCAG
AATGGTAGTGTGTTCCCAGAACAGCCAGGGAGAGACTGTCTCAAAAAGAAAACTCTGAAA
TTAAAATTTTAAAAAGTTGAGCCTATTTTAGCACTTGCAAGGTCTATATAACTTTCTATT
TTACAGCCCTTAAACTAGGGATTCTCCTTTTGTGTTAGAGGGCTAAGGATGGCTTGTTTG
TCTAACGTGAGCCAGACCCTGAATTCAGTCCTCAGTGACTATAGTAATATGACTTAAAAT
AACTTTCACTAGGGGGTTACATGGATTTAGTGAAGGATATTTATTTAGATTTAGTGACAG
ACATTTATAAATTTAGCTGCTGCTGTTTCTCAATAGATACTTCCATTAACAGTATAGACA
ACAGCCTTGAACTTTGATCAGTACTCTATGTAGCAAGTCTAAATTTATCTTTTTGTGTGT
GCAGTGAGGTTTTACACTGTAGTCATATGACTCAGGAAGTGTGGCTTCTCAAAGCTGCCC
ACGCCTTAGTTCTGGATCAGCAACTTGCACATGATGTCTTACTGTCCCATTTGTGAATAC
TTGAGCAGGTTATGATGTATTCAGTTTTTGGCTGCAGAAAGTAGCCACTTTTCTGGGTTT
GATTTACTATGATCTAAGTGTTTATTTGAGATTTTGTAAGTGACAGGCTTTCTAGCAAAC
CTGAGCACTGATGGTGGGTTTTTTTTTTGTTGTTGTTGAGAGCCTGTCCTTTCCATACTA
GACCACTAACAAACAGTTTTGCTGTAGGTGACAGTAGCCACCTCTCCTGTAAACATTGTC
AAATGTTCTTTGCACTAAACAGATTTACCCTTAGTTGAAACTTGGGGTTTAACCACCTTT
TGAATATGGTGTGGTGGGTAGGGTGAAATTTGCTTGTAAGGGTTTACATTTGTGATTGAT
AGTTTGAAAGGAAGTAACATTAAGCTTGAACATCGAGCATCTTTGTCCTTGTCCAGATAT
TATGAGGAACTTTGTCGAAAGATATGAAGGGTGTGTTTCTTCAAGTTCTGTGCATTTAAT
GTAGCTGTTAAAACAGTACAGCTGTCTTTGGGTGATGTGGTAGGTTTTGGCTTTGGGAAC
CTTGAGGTTCTTTTGTTATAGTTACTCACCTAGGAATGGACTAATGGCCCGGTGCACGGC
TTTAATCCCAGCGCTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTCTGGTCTACATACAG
AGTATGTTCCAGGACAGCAAGGGGGCTACCCTGTCTTGAAAAACCAAAAAAAAAAAAAAA
AAAAAGAAAGAAAGAAAGAAAGAAGTGGATTAATGATTGGGTTTAAAGTCTGGTGAGTTA
AACTTGATGAGTGTGGCTGCCCTGCAACCCTAGTATACTAAGGATATACTGCACATGACT
GCCTAGTAGAATAGTAGCACTTCTCCCCTCTTCTAAAATTGAGTTGTTTGAACATTGTGT
TGTGTTATCAACCTGTTGCTTGAACAATTGAGGGCAGTTTGTGGATAGCAACCTGAGTGT
CTTCAAAAAGTAAGTATTCAAAGGTAGTGTGATTACAATCTTGTGATTATCTCAGGTTTT
TGAGAAGACAGTTTTCATTCTTTGGGATCAGAAGGAAACTTCAGGACAGTTGTAAGCTTA
AGTAATATCTAGCTTGGAAACATTTTCTTTTTGGTCTGATTTTCCTAAAATGACTTTTTG
TTGCCAACACATTACCACTTCTTGGTTTTTGTTTGTTTTCATTTTTAAGTTTGTGTTGAC
ACTTGGGAGTTTGTCTTCTCCCATGTGGGTCCTGGGGATCTAATCAGGCTTGGCCACAAG
TGCCTTCTTGCTGGCCCAAACACCTATTTGCTTTTTTAAAAAAGATTGTGTATGAGTGCT
CTTATCTGCATGTACATCTTCATGCAGGAAGAGGGCATCAAAACTCACTCTAGAGGGACT
CTGGAGGAGAAACCCCCCCCCCCCCTTAAGCTATTGAAGGTCTAAAAGGGAGAAATGGAG
TATTTTGCAATTATTTGAAAATAGTCCAGATAACTAAAAATTTCTTGATTCAGCATAGTA
CCTGGGCTTGCAGCCGTGTGAAATGATGATTCTGTTTATCCATTCGCTGAGTACGCTGCT
CTGACCTTCTTCCCAGTCTCGGTTCCTGTTCTGGGAGCTTGGGGCTGAGTAGCCACCAGC
CCTGCTCTCTGCAGTGTTCTATTGTGGATTGCTTGTGTGCTGGCAGGCTACTACTGGTAA
GAATGGCTAGTGTCAGCAGGGATGGCTCCTCTCTGGGTTCCATCTCACCAAGATGAGTGG
TGCAAATCTGATCACTTCCTGCAGCCCTTCTAGTTCCTTGTTCATGTTATTTTTTACATT
TATTTATTATGAGTTTACACCTCCCACTTGTTGAGCCATTTAAAGGGAGAGTTGGTATAG
TGCTTGTGGGTGGGTACCTCAGTTGCTTGTTAGGTTTTAGTAACACAGAAGTTGCCCAAG
AATACATACAGATGAGTTTGGAATAGGAGTAAACAATAGAACTGATAATTTGATTTAATT
CTAACATTTGAATTTATTTAAAGGGCAAAGGTTATGGTAGTAGAATTTCTCATAGGACTA
TTCCTAAGTATATGTGTTTCATAACTATCATGTAGGTCTTTCACATCTTAGTACTTCCTT
TGGAGAAAAAAAATCTGACTTATGAGGTGTCTGCTTCTTTTTAAGAAGATTATGCCGGCA
GTGATAGTGCACGCCTTTAATCCTGGCACTTGGGAGGCAGAGGTAGGCGGATTTCTGAGT
TTGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAACCAGGGCTACACAGAGAAACC
CTGTCTCGAAAAAACAACAACAACAAAAAAAGAACAAGAAGAAAGATCACTTATAGATGA
CTTGGTTTCTTAACTCTGCCTGGCAAAGATGTTGGTTTCTTAGGCAGTAAAGGACTCCTT
GGAGTGAACAGAATAACTGCAGGGAAGGCTCTTTGTTAATAAGTGCCAGGTAAGCATATT
TTTCTACATTAGGAATAAGAAATGGAAAAAAGTCATTGAAATAGAAACAACTACTTTTTC
TTTGTAGTGACCAAATAGAAATAATAGGGACTGACATTTTATTCGTGTTCCCCTGCTCCC
ACCAGGGTTTCTCTCGGGCACTTGTCCTGGAACCTGTCCTGTAGACCAGGCTGGCCCCAA
ACTCCAGAAATCTGCCTGTCTTCCTGGGTGCTGGGATTAAAGGAATGCCACCAATGCTCA
GCTCTGTATGGCTTAACACTATAAAATGGGACGAGGTGACCAATGCACTTTGACTATATG
GCACTAGTCCAAAGCAGAACTTGTAAGAACTGACGATGTAAGCAGTTGCAGTTCCGGTGT
CTTAGTTTTGGTGTTTCTGTGTTTTGAGGTTTTGAAATCATACCTTTTAAAACATTTTGT
CTACTTGGTGTTGGCTGGCCTCATTCCTGGTCTTCTGCCGCACAGCCTCTTAAGTGTGAG
GTTATAGACATAGGTTGTATGCATTCCTTCATGCCCCTTTTGCACAAAAAGTTTTAAAGT
TACTTTCTCAAACAATGATTAATTAAAAGTCAGCCTGATTTATGTAGCAAGTACAGAGGC
CTTCCTCAAAACATAATTAGCAATCCTAAACCTCTCACTGAGGTAATAGCCAGTAACTCC
ATGTGCTTCAAGACTCAAGGAGAGGAGCTGACTCAGCCTGGAAAACAGTGTTTGCTGCTC
TTTGATAATCTAGCAGTTAAGTTTCCAGCACCCACATCAACAGCTCATGCCTTTGACACC
AGCTCCAGGGATCTGATCTGGCCTCAGCAACAAAAGGACATATGCATGATGCTAAAATTA
ATTATTTAAAATATTTATGGCGGGGCTGGTGAGATGGCTCAGCGGTTAAGAGCACCAACT
GCTCTTCCAAAGGTCCTGAGTTCAAATCCCAGCAAGTACACGGTGGCTCACAACCATCTG
TAATGAGATCTGATGCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGCACACACATGT
AATAAGTAAATAAATAAAATCTTAAAAAAAAAGATTTATGGTTATCTGAGCTGACAGTAT
TCTCCAGAGTATAAAAACAAAAACCTCAACACCAGGCATGAGAAGCCTGTTTCAAACCTT
TGAGGGGTTAGTTAGGGTGGTCCAAGACTCCTAAAGACATTATAGACTATTGGCATTGCT
CTTGGTTGCTCTAGAGGTGGAAGGTAAATCTGTACTACTGCTGAAGATACCATGCCCTTC
AGACACTGGGCCCAGAGGTCTCCTTGGCTGGAAATGACCAGAAAGACCTTTGAGGACCAG
CTTTCATGGTACCCTGCAAGTCTCCAAAGGAGGAGAGCAGTCAACATCCCTACTTATTCA
TGTATTCCCTGGAGAAGGAAACAGTGCTTGATAACTGAAAACCTACACAGGACTAGTGAA
GTCATGAATCTTGGAGGAAAACCTACAACTGATACTTAACTACATTCTAAATATTTGTCC
TTGTATATATAACCACAGGTATGTGTAGCTCTCACCCCTCATGCAATAGAGAAAAATAAC
CAAACTGCAGAGGTTTGGAGGCCAATCACAACTGCATCTGCAATACAGCTAAGGCTCAGG
GGGATATTACAGAAAGGGGGGGGGGCACAAGACTGTAAGAGCCAGCAAAATAGAGAGTAT
GCTGTGGTATTATTGTGTCTTCTAGACCTATGAATTCTCACTAACATATCTGCCTAAACA
TGATCTGAACAATGCTAACTGGGTGAGGGAATTTCAGGAGTTCTTAACCCTACACAAAGA
AGTTCAGACAACTAAGGAGTGCTGAGAGAATAGAAGTCTCCCCTGGGGAGGGAAACACTG
GTTATCCAATACCAAATAGCCCCGTACACATACAAGTAACTTGGATAGACTCAGCAAGTT
GTATCTAGGAGTGTATGTGTAACAATAATGAAAAGAGTGGCTGGGAATTTGAAGAATAAG
ATGTATATAGGAGTGTTTGGAGGAAGGGCAGAGGGGTATAATTGTATCATACATAACTTT
AAAAGATGTGAGAGTGAAAGTAGGTGGCAGGAAGGCTGCCATCTTTTATCCTTGGTCCTG
GTTTATTTAGCAAATTCTATGGCTTTGGACTACTGGGTGTTGGTTTTGCTGGTTAAGCAT
AAACAGGAATGCTGAAGTTTTAATCCTACTTGGTGATTCCAGGATAAGGATGTAAGTGCT
GACTTAGAAATTGTAACATTACACAGCTTTTTTACTGCTGGATGCAGATATAAGTGGTAG
AGGGTATCTACCCTTTTGTGGTTGTCAGTGTGAGTTAAGGATAAGGAAATAAAAAGCTAG
GCTGTGTGGTGCATGCCTTTGATCCCAGCGCTCAAGTGGCTGAGGCGGGTGGATCTCTGA
GTTCAAGGACAGCCAAGACTGTTACAAGAGAAGCCCTGCCTAATAAAACAAAACAAAAAA
CTAATAAGGACATGGATATTCATAAAAAATATGGATATTATGTGTAAGTGCACTGTAGCT
GTCTTCAGATACCCCAGAAGAGGGCATCAGATCTCATTACAGATGGTTGTGAGCCACCAT
GTGGTTGCTGAGATTTGTTGGAAGAGCAGTCGGTGCTCTTACCCACTGAGCCATCTCTCT
AGCCCGATGCTAACATTTCTAAAGCCTGACTTTTGGCTTTATTCCTATCCTAAGAGTCTG
TCTGACTGTAACAGGAAAGATAGAGTGGCCAGTTTGTCTTTGCAGTTTGTATGTTGGTTT
TTAAAGGCTGTGTCTACTTAACACTTACTAACTTACAGAAGGAAGGCTGCTTACCATAAA
TGTCAGAAATAAGCAAAATTGTAATTAAAGAATCCCTTGACCTTCTGGCTTTCAAATAAA
TGGCCAGCCTCTTGATATTCTCTGGTTATTGAAAAAAAACCTCATGTTTTATAGGTAGGC
TTATGGTTCTGTATTGGTCATATATGTATAGCTATTTTGGTGTGCATGTTACTTAGCCAC
AGGTTGTCTGCAGGGATTTTGTGTTTGGTTTTTGAAGACAGGTTTTCTCTAGCTCTGGCT
GACCTTGAACTCTCAGATCTTTGCTGGGATTAAAGGCACCACTGTGCCTGTTAGACCTTT
TAGATCTTTGAATGGTTTGGCCTGTGACCAGCCTGCCATGGGTCACATCACTGAAGAACA
CTTGCTGGCTTGCCCTCTCCTGGAGAGAAATGATTCTGAATATGTAGCTAATATTAAAAT
GTATTTCAGTTAAGATCTGTGTCTGTGGACCTGAATGTTGACCCATCGCTTCAGATCGAC
ATACCTGATGCACTCAGTGAGAGAGATAAGGTCAAGTTTACAGTGCACACCAAGGTGAGT
GACAATAAATGACTGCTAGTGTTGGATACATTTTCAGAAGGGCGTGGGAAGATTTCTTAA
GCTGAAATGGTCACTTTTTAGGGGCAATGCGGCAAACTGCTGAGAACTTCTGTCTTGCTT
GGGCCTCCATATATGTTGTGCTTCATTCAGTTCCTTTCTGCTGGGATGGAGCCCTCAGCA
GGCAAGTGTGCAGCTAATTAAGCCGACCAAGTCCCTTTTCCCCATAGGGACTTGGTGTGC
AATGGTTGCAAACAGCAGCTTCCTTGGTGTGGTGTATGTAGCCTATTGTCTATATAGGTT
GCTTCAAGGGACCTTGGAGACATTTCTGGCAGTTGGTAATCAAGCCTCTGATCACAATGC
TGTCCCTGATCTAGGCCCCAGACAGGGATTCGTGGTGCCTTTGGGAAGCCCCAGGGCACA
TTGGCCAGATCATCATGTCCATCCGAACCAAGTTGCAGAATAAGGAACAGGTGATGGAGA
TTGTGGCTCTGCGCAGAGCCAAGTTCAAGTTCCCTGGCAGCCAGAAGATCCACATCTCAA
AGATGTGGGGCTTCACCAAGTTTAATGCAGATGAATTTGAAGACATGGTTGCTGAGAAGC
AGCTCATTCCTGATGGCTGTGGTGTCAAATATATCCCCAGTCATGGTCCTCTGAACAAGT
TCAGAGCCCTGCATTCCTGAAGGCTTCCACAGTGCTCTCCTATACCCTACCAAATCATGA
TCAATAATAAATCTTGCATCAAGTTCAGGGGGGAAAAAAGAAAGAAGAAAAGGAAGCCAA
GGATAATTTCCAGAATTATAGTTAACTGTAGAATCATTGTACTTGATGTTCTGTTTTTAT
AACCTGGGGGAGGTTCAGTCTCAAACTTGTCTGTTACTAGTATAATCTTTCATATACAGC
AAGCTTCAAAAGGCCTTGTGAAAAGAATTTCCTAGGGATAAGGATGTCTAAGTTGCCTAG
GTTAGTGGCTTTAGATCATATATTGATTGCTGTACTCTTTGAGTCTTGGTGTTGATTGTG
TAATGTTCCCATAGTGCAATCTAGGAAATTTTGTATGTCTTTTTGTATGTCTTTACAGAC
CACACTGTCCACATTTCAGAGCCCAGAGTTTTCTGTTACAAGGCAACATGAAGACTTTGT
GTGGCTGCATGACACTCTTACTGAAACAACGGATTATGCTGGCCTTATTGTGAGTTCATT
TTAGAAAAGAAATAAGCTGGGTTTTTTTTTTTTAACCTTTTTGCATAAAGAGGCCATATA
TTTTGCAGTGGTTAGAATTAAGTATATGTGTCTATGTGAAGGTGAGTGTGGCTGCCCGCA
GGTCAGATCCCCTGGAGATGGAATTCACAGTGATTGTAGTAAGCACAAGGGTGCTATGAA
CGGAGCTTAACCATCTCCTTCATACTTATCCTAGGCACCAGTAGAGTTGATTTCTAGGAA
ATTTCAGTAGTGGAGCATAGAGAAAAATTCCTCAGCGATACTCAGTGAAGGAGACAGTTG
GCAAAGCTCTTGGCTAGTCTCCCCCCCCCACCCCCCAGAAAGTCAGGGTTTCTCTGTGCA
GCCCCAACTGTCCTAGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGC
CTGCCTCTGCCTCCCAGTGCTGGGATTAAAAGGCATGCACCACCACGCCCCACTCTTGGC
TAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGTTTTTGGTTTTTTTGAGACAGGGTTT
CTCTGTATAGTCTTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCA
GAAATCCGCCTGTCTCTGCCTCCCAGTGCTGGGATTAAAGGCATGCGCCACCACCACCCG
GCTCTTGGCTAGTTTTTAAAGATGAATTCAGATACACAAATGTTCTGCTGGGCAGAATTA
AGAATCTGCCCAGTAGTGATTTCTTTTTGTTTCTTTGGCATGAGATCTCATGACCTGAAT
TAGAGTTATGCTTTAAAAGGTTTCCTCAGAATGTTAATTCAAAAATAAATTTGTTTTTGT
GATACTGAGGATCAAACTCAGGGCCTCAAACACACTTACATAGGAGCTTTGCCTCTGATT
TGGATCTCCAGCACTAAAACTCAAATCTTTGGAAATAGGAAATTCCTTTGGATGTGTGAA
GGCTTTGTTCTGAGTTAGCCATCCATTGTTGGCATTAATTGCACCTGTTTTAAGCTGAAA
CAAAGAAATGTATGTACACACGATGGTGTTCTGCCAGTTGTCTGAAACTGAAGAGATAGC
AATCAGTGCTCTGGCATGGGAGATGGTTTTAGTTTCTTGAGAGGGTTTTATTGTCTTTCT
TTTTTTTCAAGACAGGGTTTCTCTGTGTAGCCTTGGCTGTCCTGGAACTCACTTTGTAGA
CCTTGAACTCAGAGATCCACCTACCTCTGCCTCGCAAGTGCTGGGATTAAAGGCATGCAC
CACCACGCCCGGTGGGTTTTATTGTCTTAGTGGCTGTCCTGGAACTCGCTCTCTACACCA
GGTTGGCTTTGAACTGGAAGAGATCTGCTGGGGTTAAAGGAGAATGCCACCATGCCCAGC
CTAGAATAGTTCCTTTTTAGAAGGTCAGAAAGAATGTTTGCATGAAATGAGAGCTGTCTT
AGCTCTATTGGGATCACCATCTGACTTGGCAGATGAGGTGCAGTCACCATCTACACTGGG
ATAAGGTACTCACAGAATCCTTGCCTCTGCTACAGATCCCTCCTGCTCCTACAAAGCCAG
ACTTTGATGGCCCTCGAGAGAAGATGCAGAAACTGGGAGAAGGGGAAGGATCTATGACAA
AAGAAGAGTTTGCCAAGATGAAGCAAGAACTGGAAGCGTAAGTAATTTTCTTGAGCTCTG
CCTTATGAGAAATATATTCAGAAGAAATGGTGGAAAACCTGATATTAAAAGTGTAACCTC
CAGGCAGTGGTGGCCTGTGCCTTGGGAGACAAAGGCAGGTGGATTTCTGAGTTTGAGGCC
AGCCAGGGCTACACAGAGAAACCCTGTCTTGACCCCCCCCCAAAACAAAACAAAACAAAA
AACATTTGTTGCCTAGTGCTGGTTTCTAAAACTACATTTTGTAGAGTTTGACATGTTGGT
GATATGCTTCTAGAACTTTGCTGGATTGTACCATATGCTGTTTACAAAGTATTCTGAATG
GACCACATGGATGACTTAAGAGGGGGCCCACATTCACAAATTACAGCATCTTAAACATTG
TACAAAAACATTCAGCTACTTATGAGACAAAACAACATGGTATGGTGCTATTCAAATGTC
TGAAAGTTTAGGAGAAAATAATATACACATTGTCTCCTTAAACTTTGCTTATAGATGGGA
TTTTTAAAGTGTGTATATGTCAGAGAGCAAGAGCAGTGCCCCTTGGATTTCTCTCTCTTA
GAGGCTGATCAGGCCTGCACTAACAGTGTGCTCATGTCCCTGAGAATGAAAGAGGCTTTC
TTTTTAAATTTTTTTAAAAAATTGATGTGAGTTGTCTTCAGACACACCAAAAGAAGAGGG
CATTGGGTCCCGTTACAGATAGATGGTTATGAGCCACCATTGCTGGGAATTGAACGAGGA
TCTCTGGAAGAGCAGTCAGTACTCTCTCCAGTCCCACGGCTTCATTCCTTTAAAGAGGAC
GATAGAAACAGTAATTGCATGTAGGCTTGGGGGGGCGTCTCAGGCTTTCAGTTATAGTGG
CATTTTTTTTTTTCCTTCATTGGTTCATTCCACAGTTAACATTATTTAATTACCAAGTTG
AATTACAGTGTTTAGATCTAGTCTAGTTGTATTGCTTTTCCTAGTAACCTGAGCAGTAGA
GTGGAGTTAAATAAGGAAGTGAGCTGTATTGGGCAGGAATTGAGCAGTGCAAGCTGAATT
CTTTGCATGTGTCTTTTCAGTGAGTATCTCGCTGTCTTTAAGAAGACTGTGTCCACCCAT
GAAGTCTTTCTTCAGCGGCTTTCTTCTCACCCTGTTCTCAGTAAAGACCGCAACTTTCAT
GTTTTCTTGGAATATGATCAGGATGTAAGGCAATTTTTCTATTTTCATGGTTGAAAACAA
TACTAGTTTCTTGTGTTTGCAATTATCATTTAAAAATTGGTAGAGAGAACACTTTCTCTT
TAGATCCATTAGAGTTCACTTTCTAAAAACAATTGAAAGAACATTGACACCCCCACCCCA
AACTAATTTTCTTCCTTCTGTTTAATTTGTTGGAAGGAATTGAAATGTATATTATGTATC
TTTATCTCAGGGTTTCTGTTCTTTTCTTAAACATGCCTTTTCATATATGAAGCAAGCCCT
GACTTCTACACACCTTTAACCTAAGCATATTTCTGTGAGTTGGAGGCCAGTCTACATAGT
GAGTTCTAGGACAACTAGGGCTACATGATGAGAAAATGATAGATAGGTTTAGAAAATGAT
ATCTTCAGATTCTTGAGTCCTGGTACTAGTAAGATCAAGCAAAGCAGTAGCTCTTCAGAG
AAAAACCTCTGGGACGGTGCCACCATGATTGAGTGTTGGCCTAGCCATTGGAAATATCTG
TATTTAGCTACTTAATTTTTGACTCCTGGTTTAAGGTTGGGTTAAAGTACCTCGTGTATT
CATGATAGTAAAAATGTTACTTGTGTGATTACTCAACTAAAGATGCTAACAGAAACCGAT
GCCATGTCAGAAAATGTTTTGGAATTTCCTTCCTTTAGCTAAGTGTTAGACGGAAGAATA
CCAAGGAGATGTTTGGAGGCTTTTTTAAAAGTGTGGTGAAGAGCGCCGATGAGGTCCTTT
TTTCTGGAGTTAAGGTAAGGTGTGGGCAGTTTGAGAAAACTCTTGATTGCATGGGAATGG
GCAGGTTTTCTTTCAGGGGGAGTAAATAGGTGTTACAATACTTAGGAAATGGTTGCTTTG
CTCTGCTTCTACTTTGGCAAGGCTTCCCTGTAGTTCCTGGAATGAATTTTTTTTTTTTTT
TTAAATAGATAGAGTGACCTTGAACTCAGCTTCACCTGCCTCTGCCTAGTATGTGCTGGG
ACCAAAATACACCGCAAATTTAACTTTCAGTTCTGTCCTGAATATTTTTAAAGGTTTATT
TATTTATTTATTTTATGTATATGAGTACACTGTAATTGTCTTCAGACACACCAGAAGAGG
GCATCAGATCTCATTGCAGATAGTTGTGAGCCACTGTGTGGTTGCTAGGATTTGAACTCA
GGACCTTCAGAAGAGCAGTCAGTGCTCTTACACGCTGAGCCATCTCCACCAGACCCTGTC
CTGAATACTTTGATAAGGAATATTTTTTTTGTCCGGGTTGGGGGTGGTCCTTGAGTCTCT
TTGTTTTTGTTTTAAGGATGTAGGTTGCATTATTTGTAGAAAAGAAAAGCATGGTTTCAT
AGGGCTGAGAGTTATACTGAAGAATTGTTTTTTAGATTGTGTTGAGATTGAAGTTAATAT
TGTCTGATTGGCTTTTATTGAGGAATGGGCAGAGCTGTTCTATCAGATAATGAGAAAAAA
GAGGCCCTTGCTCACTCAGTGCCTCCCTGGTTCTTTGTAAATAATGGTTTTGGCAACTAT
CTAGTATCTGGCTTTGCCTCTCTAGGTCTTCATTAGGGAAGTCCAGAATACGGGTGTTAA
GTAGAAAGGGAAGGTTAGAAATGGTGTTTCTAGCCGGGCAGTGGTGGCGCATGCCTTTAA
TCCCAACACTCCGGAGGCAGAGGCAGGTGGATTTCTGAGTTTGAGGACAGCCAGGGCTAC
ACAGAGAAACCCTGTCTTAAAAAAAACAAACAAAAAAGACAAAAAAGAAATGGTGTTTCT
TAGGCATACTGTATGGGTTTTGTGTATGCATTCTGGGTCTGTTGGTATTGGCAAAAGCTT
ACCAGGAGTGCCCATATTGTTAGGCTGAAATCAGCCAAATTAAAATAAAGCCAAGCCCAG
GGACACACATGATATCAAGACTAGGTCGAGGTGGCAGTGTCCCACCTGACAAATGCACTA
GAAGAATTATTGACTTGTGGAAGATGTCAGTATTTACTTGCTATTCATAAATGATTCTGT
GCTGATTTAGTCTGTTAGTACCTGATTGTTTTTATCAGTCTTTAATTACAAATATTAAGT
GTCAGGATAATCAAGTCTGTACTGGTTAAACTTAGGTGACCATTTTGTTTGGTTTGGAGG
CAGGTTCTTAAGATAGACTCGATTCTTTAGTTACCACCTCAGCCACGAATGTGCCGGATT
TCCTGTGTTTTCTCTAGCACTATACATATTCCTATCCTTGACATTTTGGTTCTTTTCCCT
TCTTTTTAGGAGGTGGATGACTTCTTTGAGCAAGAGAAGAATTTCCTTATTAACTATTAC
AACAGGATCAAGGATTCCTGTGCTAAAGCAGACAAAATGACCAGATCTCACAAAAGTAAA
TATGTTTACCCACTTGGTTACTTAAACAGCTCTGATGTGTGCCTGTTCTGCTCAATGAAA
ATCTGCTTGTTTCTCCAGATGTTGCTGACGACTATATCCACACTGCAGCCTGCTTGCATA
GCCTGGCCTTGGAAGAACCCACAGTCATCAAAAAGTACGTCTTGGGTGGCTGAGGTGGTA
GTTAAGCAGAGTGCTGCCTTAGCTTATTCAAGGCCCGTAGTTCAGCCCATTGATCCTTCC
TCTTCCCCATCTTCTCACTAAAAATTACTAGCTTTGCAAAGTCCTGGTGGCAGCATCACT
TGCCTGCACTTCCACCACTCAGGAGGCAGGAGACAGGGTTTCTCTGTGTAGCCCTGGCTG
TCCTGGAACTCACTCTGTAGACCGGGCTGGCCTCAAACTCAGAAATCCACCTGCCTCTGC
CTCCCATGTGCTGGGATTAAAGGCGTGCACCACCACCGCCTGAGAGTCAAGTCTTAAGAG
TTTTATAATAAATTTATACATCATAGAGAGCTAAGACCTTGAACTGTGACCTTCCTTCTG
TATACTTTCAGGTACCTGTTGAAAGTTGCAGAGCTATTTGAAAAACTTAGGGTAAGAAGT
TTTGTGTTGGTCTTGGTACCATTTAAGGTGCATAGATTTCTGCCTGGGTGATAACTGGTG
ACCTTTATTTATTTAAACTAGAAAGTGGAAGGTCGAGTCTCATCAGATGAAGACTTAAAA
CTGACAGAGCTCCTCCGATACTACATGCTCAACATAGAGGCTGCAAAGGTAAGGTAGGAA
TTATTTAGTCCTTAGCAGCACTAGTTCATCTTGCCATAACCAGAAATTGAATGCTTAAGA
TAATTCCTCTGGGTTAGAGAGGAATGTTGCTTTATTTTGAGGTATACTTGTTTTTAGTGT
TGTGTGTGATATGTGAAGACCTGAGAACAACCAACCTTGTGGATTTTTCTTTCAGTGCCA
TGCATTTTACTCTCTTGTAAAATGGGGCCTCACTGGCCTGGATCTCTGAAATTTTAGGTT
TTGTGTTATGTTAGACATAATTCAAGTTAGATACTAATTTCCAAAAGTGGGATTCATGGG
GCAGGCTCTTGGTCATGGGTGTTGTTCTAGGTCATGGCTCAGTGGCATTCTCCCTAACTC
AGTCAGCAGTAAATAAACATGTTTGATATGCTGTTTGATTTTCTGAAATATCTTCAATTA
CTGATTCAACTAGAAGGAAATTTTTATGTGGGATGTTTTATATAATGATTATGGAAATGA
TCTTCAAACATCAGAAACTAAATAGCCTCATTATCCCCCCTTCTGCCCCTGTTGCTTTGT
ATCAGACCTAGAGCATGCTAGGCAAGTACAATATTAATAAGCTATATTAGCATAAGATTA
TGCTGGGTAAAGGGCTAGAGCGATGGCCCAGCAGTTTAATATCCTGTACCCCACATCAGG
TGACCTGTACCTCCAGACTCATGTATGCAGTTATGTCCACATAGTTAGAAAAATAAAATC
TTTATGCAAGATAGAGAAATTGGCTAGAGGCTTGCCATTTCAAAATGTTGGCACTGGATG
CTTTCTAGACTTTTGCGTGTACGCAATAGAGACACATGCATATGCCTAGACATTTTCAGA
TATGATTATTTCTTTGGAGATTTTTTTACATCATGATTGTTAATCTTTCCAGGATCTCTT
GTATAGACGTACCAAAGCCCTAATTGACTATGAGAATTCAAACAAAGCTTTGGACAAGGC
CCGGTTAAAAAGCAAAGATGTCAAGTTGGCAGAGACTCATCAGCAGGAATGCTGCCAGAA
GTTTGAACAGCTTTCTGAATCTGCAAAAGAAGGTTGAGTGTTTCTTCTGTATCTAGTTTT
CATTTGGGAAAAAAATAACAGAAATTATCAGAAGTAAGCCCCCTCCCCATAGGGCTGGGG
TTAGAGCTCTACTAAACAGCTTCCCTAGCACTTATTTGTGAGACCGGGCTTGTCCCCAGC
AACACAAGGAAGATGAATGGCAACACTAAAGAAACAACTGTTTCTGTTAGGTTGGGGAGG
GGCTGGAGAGTCGGCTTATCTGAGCAGGTGATGCCTCTTCATGATAGGGATGTAAGCACG
CAAATGCATGCATGCAGACACAGTGCATGCACACAATAATTAGGTCATTGTGAAAGGACA
CTGGTTATGGAAAGAAGCTATAGGAGTATATTAGAGTTATCACCATGAACGTGTGGGAGG
TAGAAGAGAGTTCATGCCTCAATATCAGAAACAGTAATGGGTTATCTGAAAGAAATCAGT
CAGTGATACAGAGTGGGATCGTTGGATAACTTGCTTCCCAGATGAGATCATGGTCTGAAG
ATGTGAATTAACTTGTTCACCAGCAATGTCAAAGAAAGGCTGGAATGTGAGGTATGGTCT
TTTCCTGGGAGGATCTCATATATCTTGCTTGGGTGGGCATGAAACAAAGCCAGTACAAAT
ATTAGTGTATTTCTTCAAAAATGTAATTATAATAGGACAGTGGACTTCATTCTACCCTCA
AGTTTTTATAAGAAAACATGGTTTTTCGCTGAGCAGTGTCACAAACCTTTTATCCCAACA
CTTGGGAGGCAGAGGCAGGTGGATTTATGAGTTGGGCCAGCCTGGTCTACAGAGTGAGTT
CCAGGACAGCCAGGGCTGTACAGAGAAACCCTGCCTTTAGGAAGAAAGGAAAGAAAAGAA
AGGCCATGTATCTGTAATCCTGCCAGCTATAGTGAGTACTTGCCAACTTGGTGCAATCTT
GAGCTACCAGTTCTCTGATCCAAGGTGTGCTTAGTGATTGAATGTTATGGCCCACATGCA
GGCAATGTGTATGACATGTGTTTAGTGTATATTGACTGGCATTAGGTCTGGAGGTCATCT
GTGATAGGTATTTGGATGCTGTAATGTGTGGGAAAATTAAAATTTCTTATAGTTTGGTAA
ATTTTAACTCTTTATTCTCATAGAGCTGATAAACTTCAAACGGAAGAGAGTGGCAGCATT
TCGAAAGAACCTAATCGAAATGTCTGAACTGGAAATAAAGCATGCCAGAGTAAGTTGATT
CTCACAGGCCTGACAGACCACTTTCTCAAGATTTTGCTTTGGTTTTTGTTAGTAATCTAA
TGAACCTTGGTGTGTGGTAGTGCAGATTTTACAGTGCTGAAGGCTAATGCAGGAGAAGTT
GGAAGACTATCATGTATCCGAAGGAGGGCATTTCAGATTGGGTTTTTTTTTTTGTTTTTT
TTTTTTAAGATGTATTTATTTATTATATGTAAGTACACTGTAGCTGTCTTTAGACACTCC
AGAAGAGGGAGTCAGATCTTGTTACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATT
TGAACTCTGGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAG
CCCCCTTGGTTTGTTTTTGAGACATCTTATAACTATAAGCTCTGGTTGTCTTAAAACTTG
CTTTGTGGCTTTAGCAGCTGATGTGGAACTCACAGAGACCTACTTCTGCCTGTTCAGTGT
TAGGACTAAGTAAAAAATTTTATTCATTGCCTGTGGTGCATGCTTAGTGGTGACTCAGCA
AAGAAATGGTACATGTTTGGTTCTTAGTTGAACGGTGGGTTAAGAATTTGATGCATGTAT
CAAAAGATGGCCTAGTCGGCTATCAGTGGAAAGAGAGGCCCCTTGGTCTTGCAAGCTTTA
TATGCCCCAGTACAGGGGAACGCCAGGGCCAAGAAGTGGGAGTGGGTGGGTAGGGGGTTT
GGGTGGAGGGTATGGAGGACTTTTGGGATAGCATTGGAAATGTAAATGAGGAAAATACCT
AATTAAAAAAAAAAGAATTTGATGCCTGTGCTTAAGGGTTCTCAGTGTAGTACACAGGTT
TGGTTGTCTAGTAACAGCAATCCATGGAAGGGTCTTTGGCAGTTTCTAGCCTATTCAGAA
TATTGTTAGTCTGCGGCAACCTGGACAGGCGGCCTTCATCAAGTCTGCCTCAGTTTTCAA
CATTACAGAACAAAGTGTTTAGGGCAATTTGGGATTGGGGTGCTGTAGAAGGAGAGGCCA
CCGGATTTTTAGCCTGGAGCCCTCTGACTAGCAGGATGTGGGTGGTGCTAGGGAGTTGTA
ACTTAGAGGTTCATGGAGGAGAGTGTCAGCTTGGTTTGGTCACTTTTCAGATTCAGAGTT
CATGAGAAAGCTGTATCTGGGTTTATTTCATTAATTTCTTCCCCCTCCCCCTTTCTTTTA
GAACAACGTCTCCCTGTTGCAGAGCTGCATCGACTTATTCAAGAACAACTGACCTGTCTA
CTCTGAAGGACACCAATGTGAAAGCCAGCATCACTTGCACTTAAATCATTACTGCAAAAG
AAATAGCTTTGACTAGTTTAAAATCATGTGAATAAATATTTTGATTTCTAAAAATCTTAA
CACTTAACCATGTTGGTTTAAAAATATTTTCATTGCATGTTACTTGGACATAACTAATCC
TTTTCTTATGCATTTAATACCTCAAAGTAGGTAGAATCTAACAGATTCTCCTATAGACTG
TCAGGAATTACTAAGAAATGGTATGGAGATGTGTGCCTTCTGGAAATGAGAAGCAATAGC
CTGGCCCATGTCTGTCTGAACATTTCCTGTGTCTGCTCCTACAGACATGTCAGGTGTGAA
TTACAGCAAACAGTGACTGCTTGTGGGCAGGTGGCAGACACTCTTCTTTATTTAGGTAGA
TTTTGCTCCCTCTTGTCAAGATCACTTCAGATGCTTGTACGGTAACAAGCAAGAAGATCT
CATATGTCTTTTTACATCCTTTACAGCTCCATTTTTGTAACTGGGATATAAATACTTGAG
AGAAAGGAGAATCTAGAGTTCTGACACTCCCTGATGGTGGGGCATGTGTGTTTGTGCTTT
GGATGTTTTTATAAAGTATATAATAAAGATAATCCATGTTACCATATGGAGTGCTTTTGT
AGAAAACTAGACCTCAAGAATGCTGGCAGCTCCACAGGTGGAAAGGGTTCATTAGCTGCC
CTCTTGTAACCTTTACTAACATCTTAGGGATTGAGCCAGGGCTTTGTGCAAACCATTGAC
AGTGCTTAGCCCTCAGTACTCCTTTGAAACAGGATTTGGCTCTGAACCCAGGACTCCACT
GACTCAGCTTTACAGCCTCTGGAGTTCTGCAGTTATGGTATACCAACATATCTGGCTCAG
TCCCAGGTTTGAAGACTGAGTCTTGGCTCTGTTTGCTGTATATGAATACTTGGGGGGGGG
TGGGTCCTATCTAAACTGGTTTGTTTGTATTGATTCCATAGCACAAATTGATGGAAGTCT
GGATTTATTTAAGAAAAGATTTCACAACAAAGTCTGGTTTCTGACTGTTTTCTTACCTGT
CACTCCTAGACTGCTCACAATGGCACACACAACTTTCCATTTCAGTGGTAGTGGGTACCT
GGACTCTAGCCACATGATTATGTGATCATACCTTGGCCTTGTTCCTCTGTCAAGATTGGT
TGTTGCATGTAAGGGTCTTAGATCTACCTCCTGTCTGGAATGCAGCCAGCTGAAGCTTAT
TAGTTGGTTGAACCCTTGCACAGTTGTAGGTAGACTTGTTTATGCAGTGTTCCTTGGTTG
GTCCCAGCAGGCACAGACTGAATGGAAACCATAAGTATACCTATACTATCGAGGCTGCCA
TTGGGTGGGTTCTCACAGGATGTCAACATAATTCAGCTGGCTTCAGAGTAAGGCTTCCTG
AGTGCTTGGGATCCCAGACATTAACTCAAACTCATCCCAAAGTGGTGTAGGAGCAGGGAA
GAGGCTTTAAAGGTGGGCTACTTGGGGTCCAATCCCAAGTGGTATCCCTGGGAAAGTTGT
GTCTTTGCATTTGCCCACAATGTCCAAGTTCTATATTTCCAACCGTGAACAAGACTACAG
ATTTGTAGGGGCTAGACCATTGAGCTGAAGTGTACAGCACCCTCATGAGGCAGCTTGTAT
CCCAGTTCCAGATCAGACTGATGTTGAGTAGCAAACTAAAAATTGTGAATCTTGTTCCAC
CCTGTGAGTCCTGTGTTAGTCTCCCCTGTCTCACTGTGTTGGAGACTGAGATAACTGGGT
CTTCTGTAAGGTGGGATATCCATTGAAAGGTATTTTCAGCAGAGGAAAAAGAGCAGGCAG
AGCCTAGTTCAAAACTGGGCGGTCTTGGCCTGCAAAGTGTTCAGGTCATTTAGCTAAGAT
GTCAATCATAACAGCAGGAAAAATGACCTAATCATCTCTAGTACCATTAGAGTAGTAGGA
AGCCTAGTTCCTAGTCAAGAGCCTTCCTGGTTGAGGCCCTTGTGTTCTGTAACTCATCCA
GCAGCTGGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1196, 9549..9653, 10738..10848, 12395..12516, 13580..13703, 14378..14473, 15969..16074, 16158..16233, 16631..16670, 16761..16847, 17752..17911, 19043..19128, 20341..21450
1146..1196, 9549..9653, 10738..10848, 12395..12516, 13580..13703, 14378..14473, 15969..16074, 16158..16233, 16631..16670, 16761..16847, 17752..17911, 19043..19128, 20341..20388
NM_024225.3
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved