Mus_musculus Locus Nol5a
snOPY snoRNA Orthological Gene Database
Mus_musculus Nol5a
Mus_musculus
Nol5a
2
SNORD110, SNORA51, SNORD56, SNORD57
2061..2128, 2792..2924, 4252..4321, 4571..4642
6860
CCGACTTACTCCATGATTCTTTTTTCTCGCATAAGGCATAGACTATTTAAGAGAGACTA
TTCAAGTTTGGGATTTATTTTCTCTCTCTATTAGATATTTTCTGAATTTACATTTCAAAT
GCTATCCCCAAAGCCCCCAATACCCTCCCTCCGCCCTGCTCCCCAACCCAATCACTCCCG
CTTCCTGGCCCTGGCATTCCCCTGTACTGGGGCATATGATCTTAGCAATACCAAGGGCCT
CTCCTCCCATTGATGGCCGACTAGGCCATCAAGTTTGGGATTTATAATCCTAACACTAAA
GTAAAGTGTCTTTTTATTTTCTTTTTTAAAGCAAAGGTGATTTTAAATTATCCACCTTGG
TGTGCCTAAAACTGGCACTGAAAAAAACAGGAACGCAGCTCCTTGGAAGAATTCTGGGCC
TACGCGGCCATGAGCAACCACGTGGTGCCGAGCAGCGCTGGGTTCTATGAATCAGGGAAA
GGAACAGAACTAGGAAGAGGTAAACCGCTCTTGTCTATGCCTCAGCCCGCACCAACAATT
TTGTTAACAACAAAATGTAAAAGGAAGAGGCAGGCAGCAAGAAGACGCCATTTCTGCAGG
GTCTGAGGCCGGGTCCCACGAGGACCCGGAATATCTGGGCAGCGGGAAACCTGCGAGGCT
TATCAGGAAGCCTCATGTCCCCTCACCGAGTTCTGCCGCCCGGCACACGGGTGACAAAAG
CACGAGGAACGAAGAAGGGTGGTCTCCAGGCCACTCTGCGGCCTGCCGGCAGGAGCGACA
CCATTCACTACAGACGCAGTACCGGCTCGCGCAGCCGCAGAGGCTGGGCTTGGCAGGCCC
GCTCGCGCCCGTGGTAGTCCAACCCGCCCGACGGACGATACCACACCCGCGAACCCCCTC
CGAAGACCTGACAATGGTTTCGTCCGCAGCCTCTGATTGGTCAAACCGGAGAAGGTGTGG
TCTCCGCAGTCTGGTTCCGCGCGCCAGAGCGCGCTAGCCGCATTGCGAGCTGGGCACGGA
GCAGGCGCCATGGTGAGGAGTGGTGGTGGGGTATTTGCGTAGTGAAGGCCTTAGCGTGCG
TCTGGGTTTGCATTCGGGGTCGTGCTCCGGGTCTGAGCCAGGGCCTGCTCTAGCAGCGGC
CCCGCGGACTGGGAAGTTTGACTGATGGCCGCGCGCCGGTTCTTTTCAGGTTCTGCTGCA
CGTGCTGTTCGAGCATGCGGTCGGCTACGCGCTGTTGGCGCTGAAGGAAGTGGAGGAGAT
CAGCCTGCTGCTGCCGCAGGTGGGTGAGCTCGGTGGGCTCGCGGAGCTGCAATGCAGCCC
CTAAGGCCGCCAAACCCCAGCATGCACCGCGTGTTCCCACGTGGCCGACCGCACCGGGCC
CGGCGGGGGGGGGGGGAGCTCTAGAATGAGGGGACTCTTTAACGCGAATCTATATAATTG
GAAGCGGTCGGAGATAAACATCTCATTTCCATTTCTTGAGAATTAAGATTCGGGGCCCAG
GCACCAATTGCTACAACAGCTGGTGCTTCTGCCTTACTGCGCTGTAGAAGCCAAATTCAA
AGAAAGCCCATTCATCCTTCTCTCCAGGTGGAGGAATGTGTGCTTAACCTTGGCAAATTC
CACAATGTCGTTCGTCTGGTGGCCTTCTGTCCCTTCTCTTCATCCCAGGTGGCCTTGGAA
AATGCCAATGCTGTGTCTGAAGGTGAGTCGGTCCCTCCGGAACATGGGATTCTGGGTGGT
TGATGTTCTTAGATGATTTTCTTCTAAGCTTGATACAGTCTAGGGATTATTTGAGACCTA
CAGGATGGCATTTTAAAACATTAATATGCAGGGGCTGAAGAGATGGCTCAGCGGTTAAGA
GCGCGACTGCTCTTACAGAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACA
ACCATCCCTAATGAGATCTGATGCCTTCTTCTGGGGTGTCTGAAGATAGCTACAGTGTAC
ATATAATAAATAAATCTTGTAATTTAAAAAGCACTTAAATGCTTTACAATTGTGCTCCTG
GACCTGTGGTAGAGCCAGGCTTTGCAATGATGACTTATATATCTGTCAATCCCCTGAGAG
ATCACTGACGACTCCATGTGTCTGAGCAATGCCTGCGGGGATGGGTGTTAACTAATCCGA
TTGGAGACAGTCTCCAATCTGCAATGTGTGGTTTAGAGCTGTTTTCTTTGTCCCAAAGGT
GTTGTTCACGAGGACCTCCGCCTGCTCCTGGAGACATACCTGCCATCTAAAAAGAAGAAA
GTACTTCTGGGGGTTGGAGACCCCAAGATTGGTGCTGCAATACAGGAAGAGTTGGGGTAC
AACTGCCAGACTGGTGGTGTGATAGCTGAGATCCTTCGAGGTAAGAGTCCTATTTCATTT
ATTCTGTCCACCACGTGGATGCAGTGCCCACAGAAGCCAGCAGGGGGCCTACGGGCCTGG
TGATGTGATCTGCTGTGAGTGGTTACTTGGGTCCTGGAGGATCTATTCTTAAAGTCCCAT
CTTCTTTTTAGGAGTTCGTCTGCATTTCCATAATCTGGTGAAGGGTCTGACAGATCTTTC
TGCTTGTAAGGCCCAGCTAGGGCTGGGACACAGCTACTCTCGTGCCAAAGTTAAATTTAA
TGTGAACCGAGTGGACAACATGATTATTCAGTCCATAAGCCTCCTGGACCAACTGGATAA
AGATATCAATACCTTCTCGATGCGCGTCAGGTAAGGTATAGAAGTCGAGCATGGCCGATG
ATTCATGTGGGTAAAATCATGGACCAAAGCAAGGCCTCCTTGTGCTTACCACAGGCTGTG
TTCCTACACTGACTGTATAGAAAGAGGAGGCAGAATAAACCTACCCCATGTACACCTCAG
CCTAGGCCACTGTGCCTGGTCTGTATTGTGAATGGGGAGACACGGGCCTGAGAGAGCTTG
GGACCTGAGTTGAGGTTTGATAGCTGGATCAGAGAATGACTTCCTCTACAGGGAGTGGTA
TGGGTACCACTTTCCAGAGCTGGTGAAGATCGTCAATGACAACGCCACATACTGTCGCTT
GGCTCAGTTCATTGGGAACCGCAGGGAGCTGAATGAAGAGAAGTTAGAGAAACTGGAAGA
AATTACGATGGACGGGGCCAAGGCTAAGGCCATCTTGGATGCTTCTCGGTCCTCCATGGG
TCAGTGCGGAGCGCGGCAGCCTGTATAAGGTACGAGACTCCTTGAGTATCTGGTCCCCCT
GTTCACACTAGGTGTTTCCTAGGCATGGACATATCTGCTATCGACTTGATAAACATCGAG
AGCTTCTCCAGTCGTGTGGTGTCTTTGTCAGAGTATCGCCAGAGCCTACACACTTACCTT
CGCTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCTTAATTGGGGAAGCGGTGCGT
CATGGGGAACACAAAGTGGGGGAGTGAAACTCAGCATTCTGTACCGCTATCCTTGTGGCT
AGCATGTTGTCCCTAGTTGATGCATGGTGGGGAAGAGAAGAGGGGATGAGCCTGGGAGGT
CAGGTTCCCACTTACTCACCTGACCTCCTCCTCGGATCTTTCTCCAGGTAGGTGCACGCC
TCATTGCTCATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCGTCCACAGTACAGA
TCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCGCCTGCTCATGTCAGGTG
CTGCTTCTGGTGTCCACTGTTTTGTTTGGGGATTACAATGATGGCTGACCAGGGCAACCT
GACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCA
GGGCCCAGCAAAAGGGGACCGAGTTTCCAGGTCAGCAAATTGGATGCCTTCCCTCTCTGC
CTCTGGGAGCTAGGTTGGCACTTGGTGAGGTAGAAAGTTCAGCCAAGCCTGGTGGGAAAT
TGTTAGAAGAGGGGAACTTGGCTATTTGGGTCAAGTCTTTTGACTAAACTATTGACTGAA
TATTCTCACAGAGCCCTGAAGACAAGGGGTAACACACCAAAATATGGACTCATTTTTCAT
TCCACCTTCATTGGCCGAGCAGCTGCAAAGAACAAAGGCCGTATCTCCCGATACCTAGCA
AACAAATGCAGTATTGCCTCAAGAATTGATTGCTTCTCTGGTATGGATGGGGAAGTTGGC
ATTTGAGTTGAAGGGGTTACAGTGGGGGGGAAACAACCTACCTTGGCAGCTTCTACAATG
ATGGTAATATTTTTCGTCAACAGAGTTCACCTAGTGAGTGTTGACACCTTGGGTCTGAGT
GAAGCTGAGGGGAGAGCAGCTGGGGAGTAGTTTGTCATTTCAAGGGTTGTAATTGACTTT
GTTTACACACGCACACACATCTAGAGGTCCCCACAAGTGTATTTGGGGAAAAACTCCGAG
AACAAGTTGAGGAACGGCTGTCTTTCTATGAGACTGGAGAGATCCCACGGAAGAACCTGG
ATGTCATGAAGGAAGCTGTGGTTCAGGTCAGTGTGTGCTTGGTTGTGGTAGCTGAGTGCC
AGAAAGACTGTTGGAAAGGATGAACGAACTTGGCCTGACCTTCAGAAATGGAGGCAATAC
AACTGATTTAATGAGCCTGATCCAGCAAGACTAGGAGTGTTGTGGCAAGTCAGGGGTCTT
CTGGGTTTTCAGCGCCTTGCTTTTTTGCCAGGCAGAGGAAGCGGCTGCTGAAATCACCAG
AAAGCTGGAAAAACAGGAGAAGAAGCGCTTGAAGAAGGAAAAGAAGCGACTGGCTGCACT
GGCCCTGGCCTCGTCAGAAAACAGCAGTACCCCAGAGGAGTGTGAGGTCAGTCCTGTGTG
GATCCCAGGTTGTAGGCTTCTCAACCGTAGAACACAGGACATCAAACCATGGTCTTGAGC
TTGGGCTCTTTGGACCAAAACACCTAAAACTACCTCTTGATTCTATAGGGAGGAGATAGG
TGCTGAGAGAACTTGACAAGAGCCCAGAATGCTGGTTGTAGCACATGGCCCATTCCATGG
GCAAGTGTGCTCTGTCCTCGGCTGCCTCCCAGGAGTCCTCAACGGGGGTAGTGTGAATTC
CTGCTCTCCCTGTTCTGTGTCTGGAGGTGATAGTGTCTCATGATGGGGGGTGGGGGCAGG
GAGGTCACCAATGTGACAGTTTAGAATTGTCCCTTAGGCTTTTTTTTAAAATCTTGAGCT
ATTAGTGATTTTCATTTCAGTGTTCCCTGGGAGCTCTGCATGATATCCATCGTGAGCAGC
ATACAGGGGGTTTTCTCTAGGGTTTAAGAGGGCCAGGGAAATTATAAAATGTGAGAGTAG
GTAGATCATTAAGTCACCAGAAGTACTAGGTTTGCTCTTCTGCCTGGATTCTAATGGGAG
CTGTGGCTGCTAACAATTGTAAGCAATGTCCCGTGTCTGATTCCCCCTTCAGGAGGTAAA
TGAAAAATCTAAGAAGAAAAAGAAGTTAAAACCCCAGGAAAATGGAATGGAAGACCCACC
TGTCTCTCTACCTAAATCCAAGAAAAAGAAAGCTCCCAAGGAGGAGTTGGCCAGTGACCT
TGAAGAGATGGCCACTAGCAGTGCTAAGAGAAAGAAGTCCTCACCTAAGGAGGAAGTGGC
CAGTGAACCAGAAGAGGCAGCAAGCCCCACCACCCCTAAGAAGAAAAGGAAATTTTCTGA
GGAGCCTGAAGTTGCTGCTAACTTCACAAAGAGCAGCACAAAGAAAAAGAAAAAGTCCCA
GAAAGCACAGGAGGATTAGAACGGACCTGCTTGGTGGGAGGGGCATACCTTGTGGCAGCT
CCTGCCCATGAATGATAAAACCCCAATAAAAACACAAAACCAGATAGTATGTGTGTATTT
TGTTTATTGACTATTTTTTTCATGGGCATGTATAGGATTTATGACAGGGCAGTAATGACA
GCTTCAGTGAAGTCATGACATGTGGCATAACCACCCATATCTGAGGTTCGAACCTGTGGG
AAAAAGTTATCATCTTAGGGTCTGGGCCTTGTCGCAACAACCCACCCTTTGAGATACCCT
TAACACCAGCCCCCAGGACAGCCTAGCCTCAGAAAAGCTATTATAGTCTACTGTCTAGAT
GTTCTCTTCTGGTCCATTGTACTGAAGGGATGTATACGAAGCATGGTCCTTTTGAAATTG
GAGGGAGTAAGGGCTCTAGCCCCCATGGGGGTGCAGGTGGCCGATGACAGACTTGATGAA
GTCAGTTGTGGTGCTGTAGCCTCCCATGTCTCGAGTCCGTACCTACAGCCACCAACAGCA
AAAGCCGTGGGGAAGAAGAGAGAGCCCATGAAGGAGATGGGACAGCATGATGAGATGGAG
ACCAAGAAAGATACAGTGCAGTGGAGAAAGAATGGAAGGAAGTGAGCAGGTGTGGGGGTC
AAGGGCCTGCCCACTCGAGCAGACAAGGGAGTACAGGAGGCCGAGCAGGCAGCAGGATGG
GGAGAAGAGCATATCACAAAGGATGAGATGAGGTTACCTTGCAAGAAATGAGACCAGCTG
GGAGGGAAAGCAGGCAGCTAACCCTGCCTGTAATCTCCACCCCGACAAAGCTGCAAGGTC
TGTAATCAGATGGCCCAAGAAGGGCAAAGGATGGTTTGGGAAAAGTAACAGCAGATGGAA
CTAAGGTGAAGAAGACCAAGAGGATGAAACAGCCAAGAGAGGGGAAGTGAAGAACAGCCC
CGAGGTCACAAAGGAGGTATTGTTGGGGCCTGGAGGAGAGAGGTCCCTCAGGTCCCAGCA
ACAGCAGTGCCGAGCCCCTGAAGCCTTTTGAAACTCACCTTGCCAGCTTTGATCACTTTC
TTCACTGCATCTGCAATCATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1031, 1189..1278, 1587..1701, 2218..2379, 2531..2729, 2991..3178, 3262..3413, 3587..3687, 4031..4179, 4404..4525, 4711..4845, 5452..5860
1029..1031, 1189..1278, 1587..1701, 2218..2379, 2531..2729, 2991..3178, 3262..3413, 3587..3687, 4031..4179, 4404..4525, 4711..4845, 5452..5775
NM_024193.2
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved