Mus_musculus Locus Rpl12
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl12
Mus_musculus
Rpl12
2
SNORA65
2578..2707
4330
ctgtcagaggaggttgctgggcctgcagggcctgctcaggactctccgcactcaattgc
agcactcctgagagacagctccctccatccctatctgatggccacgacttaaatccctta
cagatggctcactaatgactagcctccctcgcccccatcctccagatctacatttccaaa
taccttcttcaatgactatctctgccaattccccctccctcaccgttctcagcagggctc
gttcagttctggtttgaactttcctgatggtccagcttggctgggaagaaccacacccat
ccttccctggcagggctggccagcggctaacctggctctgtggatggggaggtcctccac
cgatgttccgattcttgggtggacctcaaggtaggccagtcactccgaagacttggccac
agatacaaaccattggcccccaaaagctgagctggtgtccggtctccttcaaacatagaa
gtgagcaccgaaactttaaatttcagaaagacacgcaactcaggatgacaaagtctcgag
attctagaaaccaaggaattgcagaattaaagactcgtgattagactcgaatagtttgtt
tctgtaactaacatgcacataccgcaaacaggttaggagggtactagggtggcactggta
ctagggtcgctcaagtcaggtgcagatcccttaggggaggggcggggccctgggctgggt
cccaggggctccagagtcaccgtcaagagaagggaacgtggaccaggaaccaggacctct
ggtgcagccctactctgttgcccaggcaaggtgctccgaacatttaccccttccgaatcc
cgagctcacccacagaccaagctctgcagtcctctgccgcagacgcctgcccataagaaa
cagggcgaccagggtgtcgcccagagactgggtggggccagcggttctcgcgagagctga
gcttttccgcctatatccggcgtgggcggagcaggatccgtcttttcggctttcggctcg
gaggaggcaacggtgcaactttcttcggtcgtcccgaatccgggttcatccgacaccagc
cgcctccaccatgccgcccaagttcgaccccaacgaggtcaaagtcggtgcgtgccctcg
ccgcgcccgggtgctgtcccggggcctggcgggtctcccttgggccttggctgccacgtg
tgtaagaggggagggagcccgacgctctggcggcccgtgcgccttagggtaaggcctggc
ccgggacatctgaagcccgacggcagcgcgcagggcggcctgcgccgcagaggttctgat
tttgctttttcttcagtgtacctgaggtgcaccggaggcgaggtcggcgccacatccgcc
ttggccccgaagatcggtcctctgggtctggtaagtcgtcgctcccgagccgtagacctc
taacgtgcatgctgtttggcctgtagatgtgttctgtccccgtggagggcagaagaggcc
accatgtccctggtgcaggccgggatgtgggtgctgggacttgggacgcaaaggaaaact
gagataacacgtgcacggaggctcgtgccacagcccggttgaggcagccattggacttgc
ttaaatccactagcctccgtgggtaacgcacgggaacctagtgtttaaagctccgagggt
tccccattgcagcagaaagtgttttgctttgttagcccttactgcagagttgtcttagtg
aagaaggatgtggagccattgtgggcaggctcctgtgggacggtgaggagggctggcggt
gagcttgaaggtcctggcttcaactttgggcacatggtaacgaatgctattatttctaca
gtctccgaagaaagttggcgatgacattgccaaggctaccggtgactggaagggtctcag
aattacagtgaaactgaccatccagaacagacaggcccaggtatttacattgcttgctgt
ggggggttgagggaagggttgagatagcagccctcaggaatcatgggtcttggcaaagat
ttccctgtcccggtgaatcggattttatccttgtgggagggctatacgacagggttcact
gtaagtcagtagtaggtgccagggtgcaggagtccgccatgctagggattcaactctgga
ggtgaggccagcaggaagcaccttagctagccgagctgttttttcggggccctttagcgt
gtctggtggtggttggttttctgggctgtgttcacatcaagtctctttgcagatcgaggt
ggtgccttctgcctcagccctgatcatcaaagccctcaaggagccaccgagagacaggaa
gaagcagaagaacagtgagtcggccccactccctgggtttccgctgcagtgtgctactca
gctgtgtcgacccctttcttgggacctaggggtggaatgagatcacagtaggcgtctgtt
gtctgttccctttcctgggtgcagaaatgaaacagtgcctcaggggtttaactttatctg
tttccatccctaaaatcgtgttagggctgctggtgaggacttgcttgtgccccagccacc
cgccactgcacctgaccagtattgttggctggtgcaatccagtggtgagctgacagtgag
ccccagcttttaggaaacagggctgtcctacatgtggatggctctgtgccgaaagcatgg
gaacagcccagcgataggtaaaatggagccatgatctcagaagacaggggaagctgtaaa
aggccctgtacttgctttctgcagttaaacacagtgggaacattacttttgatgagattg
tcaacattgcccggcagatgagacaccggtctttggctagagaactttctggtaagagca
cgctattttccctgagtggtggctgccactttgctgttgaaggttcaagatttggatttt
cccatggatccatattttttccctgtgttcctgcaatggaaccctggaattctttcccct
gtgactgaggccaccattcttactgtaggaactatcaaggagatcctgggtactgcacag
tctgtgggctgcaatgtggatggccgccaccctcatgacatcatagatgacatcaacagt
ggtgcagtggagtgcccagctgtaagtgactgttatataagggggaagcagttaggctgg
gggaaagctggacttttgttgctttacttttggtgttttactggggcattgttaacttat
attccctgttgtgattgacaatatttcttttcccacagagttaagaagcaacaagaaaat
attccaataaaagactatctgataaccagtgaatgggcttggctgctttttggggccagg
ggagggttttgggaggttcagtatggctgtggtagcaggatctagaaagcactgattcaa
agtcctggggtagtacagcctagaaggaaaggcacttctgtgggcgtggctgggaggttc
agagctatgagtcttaagtcagatggatgatacactaaagcttgctctggatcctcccca
tcctggaggtacagtgggatctctggcatagcaattgcattaatccttaacattttccat
aagtctggggaatgtggttttggtagatatctacaattaacaaaagctactaagtacagc
agggcatattgaaagagcagcgtaaacctggaccaatggcagtagcagtaacaacacaag
ggaaaataatgctttgtgacctttgcatttttccaataaaattgtatttagagaagcaaa
cccagtgcaattgttggggctgcagcagtgacttgagtgggacatcaaatggacctgaat
ttgattcccagcactcaaggtggttcacaaccattccagatgggtaataggcatggtcag
cattaacctaagccacatcctgctcaccagtctagtctggtggctaggagggaggcgcca
aggaggcctgtgctgtcttgtggggtccttttttcttttttgttttgttttgtagacagg
gtttctctagccctggttgttggttgtcctggaactcagtctgtagaccaggctggctta
aaggcatgcgccaccacccccggctttgtggagtcctctttaccataaagggaaactgag
gttacagtccccaggtcgttgtgctgtgggtcagtgctaccaagatccaagcaatgtcac
catactgtgaagcacttggttgtatgtgatgctttctctgtaggtatgggtttctagaaa
ccaattctctggagaaaatgcaatatcagtaacaagccacagagcacacaagctctctcc
tggcacaggct
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1126, 1336..1409, 1861..1959, 2272..2353, 2784..2870, 3028..3140, 3278..3330
1090..1126, 1336..1409, 1861..1959, 2272..2353, 2784..2870, 3028..3140, 3278..3283
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved