Mus_musculus Locus Rpl7a
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl7a
Mus_musculus
Rpl7a
2
SNORD24, SNORD36, SNORD36, SNORD36
1456..1529, 2413..2486, 2725..2795, 3043..3110
4506
gcttctcagaaattatttaaatagaacagcatttctcaacctgtggattgcctttcaca
ggggctgcctaagaccatcggaaaacactggcatttacgactcaaagggtaacaacagtt
ctgtagttgcaacaaaaataattttatggctggaggtcaccacaacatgagggttgtggt
gtttaagggttaaactcaccagtcatcacaagaatctatggcaagggtaaacctcagccc
aggtggctagtgctcagtaactaacgtagagccctggcaaacgggccagagttctcctct
ctgctctgtgcttgtcactatttggctcttctatttatctgctgtcccattacttttaac
gcctcttcactcctacccgcaccggtcaggtgagtcacattccctctgctttcctcaccc
ctgtacccaggccccagggaaaaccagtcccagccttctccaatggcttcggaacagcta
ccacacaccttggcggtcttgatgatctcggtgaagttgtccatgatggacttgatgtcg
tctttgagccgcttgttgtatgactgcagcagcgtctccttgctctggggaagggctctc
tgctgggccatggcgggccctggacgagaaccagtctggtccggcccgaaccgagtactg
agggctggggaccgggatttccgatacaacagctccgtccacgaacacacgcccggcagc
aggcccttacggcgagggaacaaagcacccgcacgctccttcccgcggcttccgttcact
cctggcgcctcccgccgcctctcggagcctgcggtccggtgccagggcccgcccgcctgg
acgaacgcgcagccgcggcccgacacgcccccgctcaggctccgcccctctgtcagagtc
cgaagtgggtccttgtcgctttaaatccgaaatcccgcgagggcgcctgctctcgcgata
tctgcggccacttacttatcccccacaattccctcttctttctttctccagcagccgagc
aagatggtgagtgtctctgggcccccgcgctatccgcctccatccgccgcccgtcgcccg
tcagcggcgttctccgccgtccctgtctcctcggggtccctcgcggaaagggagccacag
cgaccgactcacaggcaatgactccgctgcccgatggcacgggtttctctcttccgtaca
gcccaaagggaagaaggccaaggggaagaaggtggccccggcccccgccgtcgtcaagaa
gcaggaggccaagaaggtggtcaaccctctgttcgagaagaggcccaagaacttcggcat
tggtaaggagtggcgtcggcgtgtcacaagggcaaggcgccttgacgggcaatggactga
atgagagccgggcaccgtcccgagcagccgccactgcgcatgctcggctggtgtgagaag
gggaatggtggtcgtgtgcagatgatgtgacagaatatttgctatcagatgagtggtgat
gacactagaaccaccaagatcgctgatgcaccgacgccctcctgccctgggtactgcctc
ggctgcaggccggcccgaggagaggcctcggtcacagtgtccctcttaacttcccaggac
aggacatccagcccaaaagagatttaacgcgcttcgtcaaatggccccgctacatcagac
tgcagcggcaaagagctatcctctacaagcggctcaaagtccctcctgccattaaccagt
tcacccaggccctggacaggcagacaggtgaggttccgggccccagagccagaaactggc
cccgagtttgcccttactgcagtgcatggccacactaatacagctatgaagagagaggtg
gaagggggtccccagtccctccacctggaatgggcgggatttggtgaggaagcagttgag
gaaggatccccgtgttgacctcctgccgtctcatcagtgtaccacaatagggtggttttg
ttgggggatcagggtctctagttgtggagctcagcattgctgcctgtttcatgagtgctg
gtattaatggcatgagccacagccattcagggctaggaggtcagacacaacttttcaatg
ccaggttaagtgacaggttagaattgggcctgggcgtgagattgctggccaagtaatagc
cccagcgcctttaaagggattcaggcttagagtccaattgaatgtgttttccagctactc
agctgcttaagcttgcccacaagtacaggccagagacaaagcaagagaagaagcaaaggc
tactggcccgtgctgagaagaaagctgctggcaaaggcgacgtcccaactaagagaccac
ctgtcctccgagcaggtcagtgcttccctgcccgtcccccccaccccccaaagggaggat
ggtaaggcaggctgtgcagtgatgtgtgaatttcttcacctgaaaatattgtgaagagta
aatcgagctttttaaccctgagtcgcagcttagtggagctgcatttttgtgactgcagca
gccggagcacacaggcaaagtggttgtgttgtatgttccaggagtcaatacagtcaccac
cttggtggagaacaagaaggctcagctggtggtgattgcccatgacgtagaccccattga
ggtaggtgtgaggttctgtgtggcttctggaaggttgggatctcttgctgggtttgaaga
gctggggaaaagattggtgtggctcttgcaatgatgtcaatctttgactgaagtgacctt
gaagtgcaattactgagctttttaaccctgagcaattgccacaaagtatctgtgcagcta
gctgttgcttctgccaaaacaacctacagctcatgtttgcttctagctggtggttttcct
acctgctctgtgtcgaaagatgggggtgccctactgcatcatcaagggaaaggccaggct
ggggcacctggtccacaggaagacatgcaccaccgttgccttcacacaggttaactcgtg
agtatttatgcgcccacaccttaccctcacagctttggaccatttgccagtgatgcttag
gaatttcttcacctgaatcaactatgtggtcacactgttgtctgaggcaaaaaggcaggg
agggaagggtttattactcctgcttcttaaacagtaacgagaccttcctcattgcctttc
cagggaagacaagggtgctctggctaagctggtggaagctattaggaccaattataatga
cagatatgacgaggtgagtatataggccacaggcttaattttgattgatacataaaatat
tggtctatgccttaaagtgtaagggggacaggctaacgactactgcttctgtcatttcag
atccgtcgccactggggaggcaacgtcctgggtcctaagtctgtggctcgaattgccaag
ctggaaaaagcaaaggctaaagaactcgccactaaattgggttaaatgtacactaaattt
tctgtacctaaatataattacaaaattatcttgactgcctttggttatttgggttggcgc
gagtgtgccctgtaaaacggtttcagactgagccatggtttttacatagcaagatcttta
ttttatggttgttgggaacaggctccttacttcacatgatgggtgtccgacgtacaaatt
tttggaaccacaaatatgatgtggccgcacacagtccgtacctgtggttgaaagagatta
tagcctgtgcggggtggggtgggtggagggggtagcaggcagcaggactaaccaggtaag
gatgtactgcatgtgctcattgcgcagagtcactctcgtctgtcctccgatgggcccgcc
gggggctgtgctgtctgtggagacaggagtcagctctgtcagacccctaagtgcaaccag
agaaagtctgctgggctgttttgagactttgttaatgcaattaatattaatttctttgcc
ttagcctcaggaagacttcaggcaaaaggtagctacattcttcgccaaaataccacaaaa
acagtctccacaccacatactaagattctcctctaaaacgctatccaatagtgcatgctc
tccccaaagcaggctgaccacaacatacggaagtctgcatcaatgaaaatggggtccgct
cctgttatcttggccatagcttccaggtctcgataataccagtgattcctttctgggctg
ttctccggaacaaagggcttcctgttttctgtgagcctcactatgccaactaggtctact
tctcccagaacctacaagagaaggcaggactgctttttacgggagtcctgtatggaggca
aggtgacttaactatatacatttctcgggctgaagagccatatgccttacctggcctttc
tgtctggtctcaggattcactttcttcctgggaacaaaccctctattaaccaggatggtg
actctagaacaataataaaagtcaccctttgggtgaggaagagttccaatacagatgtca
ctagtgg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1201..1321, 1617..1766, 2214..2354, 2561..2640, 2866..2996, 3183..3252, 3360..3506
1023..1025, 1201..1321, 1617..1766, 2214..2354, 2561..2640, 2866..2996, 3183..3252, 3360..3464
BC089624.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved