Mus_musculus Locus Rps8
snOPY snoRNA Orthological Gene Database
Mus_musculus Rps8
Mus_musculus
Rps8
4
SNORD55, SNORD46, SNORD38, SNORD38
1238..1316, 1797..1900, 2502..2572, 2924..2993
4245
aaaaagaaatcggtcaggtgagaggtccctttaaaagtagacgttcactgacattcaag
gcgacgtttaagtttaagaaataaaatgtactgactgagctctcatcttgtctgacgccg
gagccccactgtcctctgctttgatttcacttggaggggtgtctagtgcctcagtttctc
ctcagccggccgcttgttcctcccactgagcagtagctcattctttagctcaggctagcc
ctcaactggtgataattctctgtctcagtgctggatttcaggtttgacccactgggccag
accagattgtcagatactttggaattggaatttcaggaactgtgagtcgacctaagcact
tgatgcttttgaagagaccctgagcacagtttgcagtaccaatctttccagaactaaaac
tgtttttaatttcctttttgattgctaattgctgccatgtaagagatacacatgaatttt
gtgtgttcatatacagggtcaagtccccctgtgaacagagcgttggagcttctactactt
cacttttccaattagggccctttactcttttttcttttttggttttacaagtttacaagg
gtttctctgtatagccctggctgtcctagaactcactttgtagaccaggttggcctcaaa
ctcagaaattcgcctgcctctgtctcccgagtgctgggattaaaggcgtgcgccaccacg
cccggtttaaaaaaaaaaaaaaaaaaaaaaatttaaaggacaaaatgtaagcacaacagg
caggcaagtgtgccctatagctcagcttaaggagcccgccctccagaccgcccaaggtca
agggatttgaggcggggtccgcgtgagttcgcacgccgcaggaccctcccctgtgccagc
gtcccaggctcgccgcggccccaggtccttcccggcaaccggaagagacgtaaagaaggc
ggggctgagttttagaaaccggaccgtgaagctttgcgcttCCTCTTTCCAGCCAGCGCC
GAGCGATGGgtgagtgttgctgcgggccgggtcgggccgcgggggagcgagctccatccg
tctccatcctgcctcccgacgcatgctcggcccgaccatgggccacgggcagccgtggca
agggcctgcggtgggctagggctgtggagatcgctgcggccgcctccggggctccgggct
gcgagcgggccaacatggctgccgcgggccgggccgcacgcggatgatgacacctgggta
tgctgcacactcccgactgcgtcgtggggaagccaaccttggagagctgagcgtgcgggc
agcccgcgcagcgcggggctcgggagcgggctgattggccggcggcgaggcccggttgct
caggcttgcgtcctcgctcccacacacagGCATCTCTCGGGACAACTGGCACAAGCGCCG
CAAGACCGGGGGTAAGCGAAAACCCTACCACAAGAAGCGAAAGTATGAGCTGGGACGGCC
CGCTGCCAACACGAAGgtgcgtgcgggggtcggggggaggacgactgggagaggctgcct
tcccctgcgctagagcgtgtttgctggggaacacgagtggctgtgatcacctttgtaagg
ctcaggtttctcggtgctggcgactggacatggaagtgtgtccacgtgcagggtctgtgc
accctaatctccaagcttagggtctactggagcctaggagtgggagagctgcaagcttgg
tgtgttccttactggggttcttcctgtgttagggggggtctggctttttctggaggtaac
tagggtgatgaaaacgtatccttaggcgtggttatggccgtcttggccacctgtacacca
cttgccaatgcaaggacttgtcatagttacactgactgttacctccgtctggttcgggtt
cctctcccagtccccactcgttttgatgacacatgttctggccttcttgtgttctctagA
TTGGCCCTCGCCGCATACACACAGTCCGAGTTCGAGGAGGCAATAAGAAGTACCGTGCCC
TGAGATTGGATGTGGGGAACTTTTCCTGGGGCTCTGAGTgtaagtaggtgttgaagtatt
tgaatttgttcttgctgaaagatcctgaggtagttggagaattctttgccatattctgat
ctcttaactcctgcaatgagaggtgctttctagagaatgttaaaaaaagatttcagtaat
aaaaaaacattaactgccccagcccctgattgtgaatctctctttgtatgcagGTTGTAC
TCGCAAAACAAGGATCATTGATGTTGTCTACAATGCATCCAACAACGAGCTTGTCCGCAC
CAAGACCCTGGTGAAGAACTGCATCGTGCTTATTGACAGCACGCCGTACCGACAGTGGTA
CGAGTCCCACTATGCACTGCCCCTGGGCCGCAAGAAGGGGGCCAAGCTGgtgcgttgtct
tcctgtaaggggttgattggctgggggtgggatgggtgctgccttcttgtgatgaaaata
ctgtccagttctgctactgaaggaatgagatgaacactttagtgctgaagaaggcaagca
tggcgacttggggggggggggttcaaggaggcttgtgactttcctggtgacaaatcaatt
catattcttttcattcagACTCCTGAGGAGGAAGAGATTTTAAACAAAAAACGATCAAAG
AAAATTCAAAAGAAATACGATGAAAGGAAAAAGAATGCCAAAATCAGCAGCCTCCTGGAG
GAGCAGTTCCAGCAGGGCAAGCTTCTAGgtgaggtggctgtggggctggggtgggtggac
ccttcctggttcagtggggtacatgtgagtgtaggtggctaataacgtgctgtgtgggtg
gaaagcaggttgtgtagctgggggcaggggatgatgcggcactgtctcggtgatgagaac
tttgtccagttctgctgctgatctcttaagtgaggatgaagttatctgaggagacggttg
gccttcaacgcctgccccctgggtgtcaggccagcgtggacttctacaggtggcgtggag
tgtcttgtcctttactgaagactgcctgttctctttcagCCTGTATTGCCTCACGACCAG
GCCAGTGTGGCAGAGCAGACGGCTATGTGCTCGAAGGCAAGGAGCTGGAGTTCTATCTGC
GGAAGATCAAAGCCCGGAAAGGCAAATGAGCCTCATGTGTAGTGTAATAAAGGTGTCTGC
TGTTCTatctgtatgctgtctaggtgtttggagaggctggtttttttcctgctctctgag
caaactcatctctactgtgcagctgtagtgaggggcccagtccagtaaagccagatttcc
cctggtcttttgggaacctagagtggattggtgtggcaggggctcttctatgcggagatt
caacattagggtgtgtgtaaatcatgcttgtattatggctagaaaggctgcccctttcct
ttgtagatgtgagttttgagggttctttaattggtgtatgtgtgctgggcatcttaagca
catagctggctacacctccagccaggttccgggaaaggctgggactttgacattgagtct
tcccagcagttaagattttcgtggattttgaagttacctgcaaagaatcctgaatggaga
gcacggacaggcccttagagctgatagtgatgtaaaagtgggtcacaggttagaacatgg
ccttactgggtggtttagggggttttggttgaggcacacttggccttggctggccaggcc
aggcagatggcagctcctgagatccagacccaccttatctaagaggactgttggtagatt
taacagcgaatattttctgctgaattgttttacttgtgaatgggctgcccactaaggtaa
ctggccacactgtctgcactgtctctttggacaccggtgtcaaggttaggttagaaggga
gtgtcttccaccttagaaatgggtctcactaaactgagatgccagcttagccagtgagct
ctaagagtcccctccaaggccggaaccggtgtgctctgttgtacctggcttttatctgga
tgcttgggggtttaaatttaggtctccatgtttgcatagcaattagcattttatcgtctg
acctcccaacaattcaaagtttgttttgaggggaagttctgaggctggaattccaaggcc
cacaagctgcttctgcctcttgtgagtggtgagagtaagggtgtgc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1028, 1409..1515, 1979..2078, 2273..2448, 2658..2787, 3099..3245
1025..1028, 1409..1515, 1979..2078, 2273..2448, 2658..2787, 3099..3208
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved