Mus_musculus Locus 1810032O08Rik
snOPY snoRNA Orthological Gene Database
Mus_musculus 1810032O08Rik
Mus_musculus
1810032O08Rik
11
snR38-1, snR38-2, snR38-3
1838..1913, 3480..3554, 3930..4003
6130
AGAGGGTCCCTCATTCAGGAATCCTGTCAAGTCTCTTGCCAACAGAGAAACAAGAATTC
TGGCATAATTACCAACTGCTGAAGGCCCTTTTGCCCTTCCCAGATATTAAACTACAATTT
TTCAGCGACCCTCACCAATTACACCACCCCCACCCCCATGCAACCCCTAGCGACTTGTGC
CTACAGTTCCATCCAACGCTTCTCTGGGGCCAGCACACTTATTTCACTTACCAAGATAGC
AAGAAAGTGGGGAGGGGGTGTCTCCTAGCAACCTTTTAAGATGTAACTCACGAGCTACTA
GAATTATACATGGCTAACACAATCAATTGCAACTCTCCTTGAGCCAGTTCCCACCCTGGG
TATGCATTCTTCTTGAGCGCTTCTCTTTCTCCTAATCCTCACACTAAACCCCTCTATTAA
AATGGTTTTTATCTCCAACTTATACCGGCTAGTCCTCAGCGCCGATTTCATTGTATCTTC
CCTGTGAGAACAGTGCCACAGGCAGGCGAATACCTGGGGCTGCTGCTGCTGCTACTGACG
GTCGCCCCTGCAGCTCTCGAGTGCCCCCTGCCGCCGGAACCCGCTCTCGCCCCCATCTTA
AAAGCTTCTGCCCATTCCCTGGGACTCTCCCTGGACTTCACTAAGGAACTAAGCCAAGTG
ACATTTCTCCACCCCAGATAAAAATCTGCAGCACAATTAACGAGCCTCAGTTTCCTCAAC
GGTCCCTGAACCCTCGAACATTCTCCACCTCCCCAGACTTAGCGGGGGACCGCCGAAGTT
CACAGTCCAAGCTCCTTACCCCGAACCCTCTGCTGCCCCTGGTGGCTGCCACCATCTTAC
CCCTTTCTCTTCACTCAATGTGAGGTGAGACGACCCATTCTTGGCAACGGTAGATTTAGA
ACTACATTTCCCATCAAACCATTCTCGACATCGCGAGAGTTCCGGCGAGACTTGCGGAGG
GGAGGGAAAACGGGAAGACTGCGCGCAAGCGCGATCTCGTCCTTTCCGAGGTCCTCTGCC
GCGTGTTTGGAAGTTATGGCCGCGCGGGTCTGTGGTGTTCTCCCTGAAAGGCCTAAGCTT
TGGGTGATGGTAAGTTGTGGAAAAGGGAAGATGAGGTTTTTCCTACACATACCGTCGACA
CGCTTGCTCTCTCCGGAGGTGACGTGTCGACGATCAGCCCTTTCCTTTGCTATTGTGGGC
CTTAGGAGGTCTGAGATGCTGTCTAAGGAAATGCTCCCCAGACTGCGAGACGTTTGATGC
GGACGGGATGAAGCCCTTTTTGGTCTTCGATCTCCCTTCTCTTGGGGCGGGGAGCGGTCT
TCTCTCTGTGACCCAAAGCCAGCCATGTGCTCAGCTCTGTCTTCCCTGGGGTCTCCATTG
AGGGTGGTGGCCTTAAGTGAACACGAGTGACTCCTGCTAACTACAGATTGTCATGAACGG
GATTGAAAACTGAAAGCCGTTAGCTCTAACGCGGCATAACTTCTCCTTCCCCGAAGGCAT
TGCCTTTTGGCACTCGGGAGACAAGATGCAGGTTCCGTCTCAGAAGTAATGGCTGGATCC
CTGAAAGCCAACGGGCTCGGTGTGGTCCACCCGTCAGAAGGCATAGGTAGATGGTGGGCA
TCTGCCTCAGACATAGTTCTCAAGTTCAGCCAGAAGAATGCGCGTTGAGCCCTCTGCAGC
CCGTGTCGGTAAGGGTTCCAAACAAGTCCAGAAGAGGGTCTGTGCCGGTGTAATTTGGGG
CTATAGAGTGTCGTTCTGCAACTCAACGTGGTTGCCAGAACCGGATTTCCAAAAATGAGT
TGGGTTGGCACTGGGGGGTTTGGGGGGCCTCTTGCTGGTTGAGCTGAGGATGATTTAAGT
TATCCCTGTCTGAAATGACACTTTTGTGAAGAGTCATGGTTTACTGAGGCTCGACGTTTT
GAGGTCTGTTTTGAGAATGACCACAGTAAGGTTGCTTCTGTTAGAATGAAGTGGGATCTC
TTTATTACTCCTTCAGACGGAGGTGTTGTCTCCAGGAAGCATCATGGAAAGGCGTGGTGG
TGCACAAGGGCCTTCAGGATGCCTGCGCCTGGTAAGAGCTTCATAGAGTCGCAGGGGTTG
TGGTAGCTGGGAAGGGTTGGTTGTTAGGTTTGGGGTGGGGGTGGGGTTAGAGGTTGTTGG
GGATTGATTGTCCAGAGGAGGGCGTGGTCCTCCTTACTCAGCACTCTCACAAGCTGCATT
TAACATTGGTGAATACAAAATTGTTCCTCACTCAACTGCTAAGTAAACTGACGTTCAGTG
AGTGGGTTCTGTTTCTTTTGTATATGCGTGTGCCACTGCATCTATGTGTCTGGTTGACTT
GAGTGAGTTTGGTTTCCCCTTTAGCCACCAAGCTGTTTTTTGGCCTAGAAATTGGGTTAA
GTAAAGATTTGGGCCTGCTACCTGGGAGTAGCACAGAGCCTTGTCTTCTGTAACACAGAA
TCACTGGCTTCCAAACCTGGATATCTCTCAGAACACGTAAAAAGTGTTAAAATACACACA
TTTCCACCCAGGTCAGTGGATGAGACGGGTATGGAGTGGAATTAAGAGTCCTCGAGGTTT
GAGCAGGCATGGAGAAACGGTTTGATGACCATTCTCACAGCAAGACCAGAGCACTGGCTA
TGTTTAAGCACCTCCTGAGATAGGTTTTTTTAATCCTCAGTCTTAACAGACAGCCATATG
CTTTTGTACATGTGGGTGGGGAAAGGAGACACTCCTTTGTATAGTGTCACCTCTTAGTGG
CAGGTGTGGTAATGGCTGCCCTTCAGTAGGGTCGCTGTAGTGGGTGACCTGTACCATTTT
AGGGATTTCACTGATAGTCTACAAAGACTTGCCAAAGACTCTGGCTCAGCTGTAAGGCAG
ATGCTGCTGGAAGTGACCTTTTTCCAGAGTCTTCCCTTGTAACCTGGATTGGCCTTGCAT
TTGTTGTGGAACAGGGGTTGGGTTCAAACTCATAATTCTGTCTTGGCTTCCTTCCTGTGA
GTCACCTTGTCTTTAAGAGGACAGGAGTGATTAGAGAAATGGCTTAGTGGTTAAGAACAT
TTGCTGAATCTTTTTTAAAAACTTGTAAAAAGTTCTCGTGCACAAAGGCTGACCTGCTGT
GGGAGCTGAGTCCATGATGATATAAAGCTATCTGTCTGGAGGCCTTTCTGTGTGGAGTGT
GGATGCCTGAAACTCAGCCTTCCGGGCTTGCCTGGAAGACTCCATGTGAGTTTTTTAGAG
TTAACCTTGTGTGTGTTTCCTTACTGATAGGTGACGGCTGCGCCTCAGGTTCTGGGCCTG
ACTCGGAAGGGTGCCTGTGAGCAGAAGAGCTGGCACGCGCAGCTCAGTGGACCATCAGTG
CCAACCCGTCCTGTACCCTGGCTGAGGGGTGTGCTAAGTGGCAGGCAAGTTTCAGCAGGA
TTTTTTCGTTTCTTCGCTAGGTTTGTAGCTCTCTTGTGACAGACAAGCGATTGTCACTGG
TTGAGCTGAGGATGATTTAAGTTATCCCTGTCTGAAATGACACTTTCTGAAGAGTCATGG
TTTACTGAGGCTCGACTTTTAAGACCTATTTTGAGAATGTCCACAGTAAGATTGCTTCTG
TTAGAGTGAGGTGTGTTGTCTTCGTTACTCAGATTCCCGGTTGGCTCATCGTAAGGCGTG
GCACAAAATCACCATCGAAAGAAAGGGCCTTCGGGATGCCTCTATCTGGTAAGAGCTTCA
CAGAATTGCAGGGGTTGTGGTTGCTGGGAAGGGTTAGTCTGTTAGATCAGGTGCTGCAGA
ATCGAGTGTAACCCTTCCTCCCTTTAGTCTTACTGTGTAGCCCGTGCTGGCCTGCAACTT
GCTATGTAGACCTGGTTGACCTCAAACTCAGTTTGTGGCCTTTCAGGTGCTGGGATTTTC
ATGTTCTCATTTTGTGTTCCCGAAAAGCCCATAAGCCTATGATGGATTGGTTATCCCTGT
CTGAAGATTTCAGCTGAGGGAAAATACTCTATTCTGAGGCTTAGGGGTGTGGCTCCATGC
TTGAAGAAATTTGAGCTTTATAAGGGATCAAGTTAAATAGACTCCATAGAGAGCTGTGTG
CCAACCTCCCAAAACCTAAGGTCTAGTTGCCTGTTAATCCTCCTCCTTGGGTGCTCTGAG
GGCAAAGTCCCTGAGTTAGCAGAAATGGGCGGGCTGCCAGCACCTGTCCTGTGCTCACTG
GAGTGAGACATGCTGGTCACATAGTTCTAGAAAATGAATGTCTTCCTTTAGAGGAGGCAG
GGATGTAAGGCGTGCCATGAGAATGCTTGACGACTCTGTCGTTGCCTCTAGCGGTGCTGA
CATTTAGAAAAGAAGTTGTGGCCCTGGCAGCCTCCTAAGTATCGTCTCCTTGATGGCACA
GAAACAAGTGGCGGGCTTGGGGGGGGGGGGGCTTTGCTCAGCCCAGCCTTAGTAATGCAG
TGTACACTGTGTCCTTTTTCTCTATGGAATCTGGGGGGTGGATATGGGCTTACACTAAAG
TAGCTGTACTTGTGGAATTCTCTGCAGGGTGGCTCTGCTTGCCTTCACTTCTGAGTGGAC
TCAGGTTCAGGTCCTCAGGGATTTGGTTGAATATAAATACTCTGATGTTTCATGAGAAAC
CTTTTTTTGGCCACTTACCAGGAACTTCTTAAAACTTTCTTTTAAAAAAAAAGTTAGCAG
CCTGCTTCTGAACTTGGCTGGTGCCTGCCTGTGTGTAGCGCACACAGTGCCTTGTGATGG
CGGCTGGAATCCCAGGACTATCTGATAATGCTTGTTCCTAAAGTTTGTAGTTTTGATCAC
TTAGCTGCCTGTCTCCTTCAGGTTCTTTCCTTGTTTCTAGGTTATTGCCCTGTAGTGCCA
GAGAGAACCACATAGCCTGCTGCTGCTCCTGCCTTTAATTTCCCAAAGAGTCATCAGACG
ACCTTGGAGTTTGTTCTGCAAGAGGAGCCAGTAAGGCCTCGTGACTGTGGTCACCCTCGG
AAGCCTTTGACAGCTAGCTGGTGAGGGCGCTCAGTCGGAGGCCCTGGGGAGGCCCCTGCT
AAGCCGAGAAAAGCATTTCTCACAGTGGATTTCCTGGAAGTCAGGGTTGGCCTTTGTATT
TTGAAGCACAAATAAACTTTATAAAATTTAACTTGGTAGCATTGTGGGTATATGAGTGAG
CCTTAGAAATACTTAAGGACCACTTGCACTGAACTGTAGAGAATCAGACCTTTTCTATTG
ACTTGCTAAAATTTACTTGTCACTTAAAGCATAGGTTAACATTGCATAACACCTCAACCA
TCCGGTGGTAATGTGCTGGAGGGCACAGGCTACTCTTGCAGAACACCTGGGTTCAATTGC
CAGCACCTACATGGTGCTCAGAGCCATCGGTAACCCTAGCCTTAAGGGATCCTTTGGTGG
ACACATCCTGGGTACCAGGCATGTAATGCACAGGCCAACACAACAGGCAAAACCTCATGT
ATAAACAATAGCTCTTAAATGGAGCATTGGTAAAGGACACTCATGTGTCTGCACATTTGA
TGGGGAGTGTACTGAGGGTCTACGGGTAGTCTGCAGAACTGACAGGGCTATCTGATGGAG
TCCGTCAAAAGGTAGGACAGCCATTCGACTCCTGCTGCAAGAGGCTGTGGTTTTTACGGC
TAACCAACTCCCAGGCTGACTTGCTCTGTACCCCAGACTGGGTCTCAAGCCATTATCCGA
CTTAGCCCCTTCTGTTGTGGTCAAGATGGAAGCCACCATTGCCACTTGGGCTTGGTTTTA
GTCTGTTAGATGCCCTAGGCTGGTCTGTTCGCCCTTCCTGAGTACTGGGAATAAGTGCGC
TGACCACCACTCCCAGCTGTCACCAGCAGTTTTCCCAAGCCACAGAACCAATGGTCGGCC
GGTCCTCAGCTTTGGTGAGTTGGCCAGTGTGGGTGGGCTGTTTTGAGGTTATCTGGTCCT
TAGTCCCTAGAGATACCCAGTCCCCGTCCCAGCCCTTCAGCTTAGGGGCTGCATGATAAT
TTGGTTGGATGAGACTGGAAATGTGGAAAAGCTCATTGGACTGCATCAGGTGCTGTTTAT
TGAAGCTGTGAAGTGAGGGTCCATCACTCAGTTTCCTGTTGGTGACAAGGACTGATGTGC
CTCTCCAGTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1088, 1496..1687, 1996..2070, 3270..3403, 3632..5130
1610..1687, 1996..2070, 3270..3403, 3632..3650
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved