Mus_musculus Locus Rpl23a
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl23a
Mus_musculus
Rpl23a
11
SNORD42, snoZ17, SNORD42
1434..1502, 2802..2872, 3195..3259
4618
AAAACAAACAAAAAACAAACAAACAAACCAACAAAAAAAACCTACAACTCAGGCCACGT
AGTGTTGGCACAGGCCTTTTAATCCAAGCACTCAGCAGTCAGAAGTATGTAGATCTTGGT
GAGTTCAAAGCCAGCCTCCTCTACAGAGTGAGTTCCAGGACAGCCAGAACTAGAGAAAGA
GAAACCCTCTCTCGAAAAGAACAACTCAAAACGAAACAAAACAGAACAGAACAAAACCAA
ACCAAAACCTAGGGACCCTAGGGTAAGAACACTGGCTGATCTTCTGAAGGTCATTAGTTT
AAATCCCAGCAATCACATGATAGCTCACCGGTAATGAGACCTGGCACCTTCTTCTGGAAC
AAATGAAGACAGCTACAGTGTACTTAAGTATAATAATAAATAAAATAAATCTTTGGACCA
GAGAGCAAACGGGGCCGACTGGAGTGAGCAGAGTTCCCAAAAATTCAATTCATGCTGGGC
AGTGGTGGCGCACGCCTTTAACCCCAGCACTCCGCAGGCAGAGGCAGAGGCAGGCAGATT
TGAGTTTGAGGTCAGCCTGGTTTACAGAGTGAGTTCCAAGACAGCCAATCTACACAGAAA
AACCTTGTCTCGAAAAACAAGAAAACAAACAACAAAAAAATTAATTCCTGACAATCACAT
GAAGACTCAACCATCTGTACAGCTACAGTGTACTCATATACATAAAGTAAATAAATCTTT
AGAAAAAAACAAAAACAAAAAGCCAAAACCTACAATTCCCCCAGAGAAACCCTGTGTCGG
AAAACCAAACTAAACCAAACCAAAAAACGCCACATTTCCCAAGAAGCCCTTTCAAAGGGA
AAGGTGGCGCATGCTTGGTCTCCCACTCTAGGGAATTAAATGGAACTACAATTCCCAAGA
AGCCTCATATTACAGTTCATCCAATCAGTGCTATATATAAGCTATCGCGAGACTTTTATG
AGCCTCCATTCTATAAGCTCATGGGAATTGGGCTGGGCCATCCTTTTCAGCCAAGATGGC
GCCGAAAGCGAAGAAGGAAGGTATGTTGCGGTATGGGAATCTGTCAGGTCGGTCTTGGAT
ACCCGCAGAGCGAACTCGCGGGGAAGAAGAATGCCCGGCTAAGCCATGGGGGGCTTGTTC
TGTGGCTACTGTCGCGACTAGGCCCCGCTGCGGGGTATGAGGACCGCGTGGGCCAAGCCG
CATGGGCTGGTTCCAGTGCAGGGGATTGGCAAAGCCACCGGGCCGGCAGCGGCCGCCACT
GATGGCCAAGCATTTGACTTTGGGAAGCTCCTTAACATCCACAGGGTGGCGCTCCGGGTC
TCCAGACCTATAAGGGATTAAAAGTAGTCCTTATTCGCCCTTTCCCCACGTTAAATGGGG
TTATACGCACCCACGTGATGGTACAACGGGTTAATTATCTTTGCCTGTGGTATCGTGCAT
ATGATGGAAAAAATCTGAAGTCTCCTGAGACCTGTGATGTCTTCAAAGGAACCACTGATG
CACATGCTGGCAGGACGGCCGGAAGGGGTCACTTTACGAATGCCACACTTAATTTTAATT
GTCCTCTCCCAGCTCCTGCCCCTCCCAAAGCCGAAGCCAAAGCGAAGGCCTTGAAAGCTA
AGAAGGCGGTGCTGAAAGGCGTCCACAGCCACAAAAAGAAGAAGATCCGAACGTCACCCA
CCTTCCGGCGGCCCAAGACCCTGCGGCTCCGGAGGCAGCCAAAATATCCTCGGAAGAGTG
CGCCCAGGAGAAACAAGTCAGTAGGGACCCTGGACCCAGTAGCATGTAGTAGGGCATTAG
GAGTTCTTAACGTAGCTTCCCTTATAAAACACAATTGTTGAAGGAGCTGGTGCGGTGGAA
GTGTGAGGTTATTTAGTCAGTGTTTGAAAGTTGACTTCAAAGAGATGTTGCTTATCTTGG
TTCCAAGTGATAGGGGACTTGTTGGAACACAGGAGAGTGTTGATTAAGATGTCCAATTGG
GGAGTGATGGCCTTCGAATAGTGTTATGAAACACACTTTTTTTTTTAAGATTTATTTGTT
TTTTTATTTACATGAGTACACTGCAGCAGTCTTCAGATACACTCACTAGAAGGGGGCATC
GGATCCCACTACAGACATTTGTGAGCCACCGTGTGGTTGCTGGGAATTGAACTCAGGACC
TCTGGAAGAACAGTCAGTGTTCTCAACAGATGAGCCATCTCTCCAGCCTGAAAGACACTT
AATTGATCAAATTCTGACGCTACTCAAAGGAAGTTTGAGAGAATGCTTACTGAAAAGTGT
TTTGTCTATGGGGGAAGTACTCACCAGACACAATTCATTGCCTATTTGTACCTAGAATTT
TTGAGTCATTACTTGGCAGTTGCATAAGTAAAAACTTGGCTTTTCAGAATCTTAAGAAAA
AGTTGTTTCCTGATAGCTCAAGGCCAATTTTAGAGTTGCATTGTTTTCACCATGCTTGGT
GGTTATTCTGTAATGCTGGGTGGTGGAGGCTAGAGAATCTCAAGTCCAAGGTCATCTTGG
GGTTCATGTCTCAGATCAGAGGGGCGGGTGTGAGTGAGTGTGGCTCTTGGATTTCAGGCT
AGCTTGTGCTGTATTGTGAGCCCCTGCCTCAACTACACTCTTGGGGTGTAGCCAACCTCT
AGCAATTGAGCACAATTTTCTCTATAGTTATTTATTTGATCTGGTCTCATAATAGTAAAT
GTGGAACTCCAGTGGATAAATGCATAAATTAAACTTGATTCTTTAGTCAAGAGAATATAC
AGGATTTGACTGTAAATGGGAAGTTGAGCCCATAGTGGTTTGGGTGCATGTGATGACATT
ATTTAGCGACCAAAGTCTGATAAAGATGATTGTGATCTATTGTCTGATGCACCTATTCTT
TCCTAGTCTGGTTCTAAAGTAAACCATGTGTTGAATGCTGGCACCAGGGCAGCTAACTCC
ATTTTCCTCTCCCATCTCTCCCTAGGCTTGACCACTATGCTATCATCAAATTCCCACTGA
CCACGGAGTCAGCCATGAAGAAAATAGAGGACAACAACACTCTTGTGTTCATTGTGGATG
TCAAGGCCAATAAGCATCAGATCAAACAGGCTGTCAAGAAACTCTATGACATCGATGTGG
CCAAAGTCAATACCCTGATAAGGTGAGTTGGGCCAGGCAGAGATCAGAAAGCTTGTGGGC
CTTTACTTAAGCTCTGTGCAAATGATGGAAAACTCAATGTTTGGAAAAGAATGACACCAA
CAAAGGAACCACTGATGCTGAGGAGGGATATGGGAAGGGTGTGGGAAGGGCAGGGGTTGT
GAGCATCTAACTCTGAGGCTTCCTTCTCCACACAGGCCCGACGGAGAGAAGAAGGCGTAT
GTTCGCTTGGCTCCTGATTATGATGCCCTAGATGTTGCCAACAAGGTAAGCATAATCATT
TCTCTGTTTAGATGCTGCATCAACAGCAAATCTGACTGCACTCTCTAACAAGCCCCGCCC
TCCCTGTCCTGTCCTCCCAGCACACTTAACCTTAAGGAATTCAGCTCCAGTAACTCAGCT
CCGTTTTGTTTTGTTTTTCAGATTGGGATCATCTAAACTGAGTCCAGATGGCTAATTCTA
AATATATACTTTTTTCACCATAAATAATGCTGCTTGTCATTTGTCGCTTTCTAGTTGGGC
TGGGGACAAGGCCATGCTGCGGGGTGGGTGCTGGGATCAAACCCAGGGCTTTCTCAGCTC
TGAGCAATTAAGACTTGATTTGCTTAACCCAATGGGGACACATGATGATGCAGTCCCCAT
GCTAGCTCAGTACCAGGGTCATTTATTATAGACAGGTGTTGGTTCTCCTGGGACACTGCT
CCATCACAGGCTCAAAGGACAAGCTTTACAAGAATTCCTTCCCTGCTACAGGCTGGTGTG
AAACCAATACCAGGGTTTGGAAGAGCAGAGGGGTTATTTTAGAATTGTCAGCATCCATTT
CAGGGCAGTATGGGTTGGCAGGCTTTTGGACAGTGTCTTGTCCTCACCCATTTAGCCATG
CCCAACCGGTTGGTCTGCTTCCCTCAACCCTTGCCCAAGAACAGGACTTCAGAGAGCTTT
CATTAGTGTTTTCAATAGTGTGGGTGTAAGCTTAAGGTGGAAAGGCTGGCCCCAGAATAC
ACCCAAGCTTGGGGCAGAGTACTAGTTTATGTTACAGAGCAATTGGCTGTGCTTGCCATC
CCTTTTACAAGTCCTGGGTTCTACTTTCTCACTCAGTCAAGAATTTGTCTTTTTGTTGGC
GCCTGGGTGCACGTTCAGGGCAGAAATCAGAGCGGAGGAGGCGAGAAAAGTAGATGATTA
TCATCAAGTCCAGCATGAGCAGGATGGCCAACAAGAATGTGCCCAGGGTCCTCTGGCCAG
CATACTGTAGGAAGAACTTGGTGAGGTAGGCCTGAGGGGCCAATCGGAAGAGGAAGTACA
TGACCAAGTTGATATACTTGTTGACCTTGTAGAGGAGGAGATCCTGAGCATTGTTTATCT
TCATCATCATCCTTAAGGTGAGGAAGATGTTGCTGACCTCTACCAGTAGTGTTAAGACGC
CACCACCAACAAATCTTTTCCAAAAGATACCAGAGAAGAAGGCGCCCATAGCCTAGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1572..1755, 2965..3141, 3335..3404, 3561..3618
1015..1039, 1572..1755, 2965..3141, 3335..3404, 3561..3572
NM_207523.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved