Mus_musculus Locus Tsr1
snOPY snoRNA Orthological Gene Database
Mus_musculus Tsr1
Mus_musculus
Tsr1
11
SNORD91, SNORD91
8345..8434, 9030..9120
13257
CAGCAGGCCCGGCCCCTTCCCACTGCCGGCAGGGAGGGGGTGTGTGCGCCGCAACTGGG
GAGGTGGGGGGGGGGGTCAAGGGCGGGTGCGGACGCCTGGGGGCGTCGGGGCCGGGCGCG
CGCCGCAGGGACGGTTGTCATGGCGACTGGCCGGCTCCCGCCCCGAGGGCGCGAACCCGC
ATTGTGAGCGCTGGGAAGTCAGCCGCTCCGGCCTGCGCCGCGCAGCGGGCGGACTTTGGG
AATGTGCTTGTGTCTGGGCAAACCTCAACCACCGTGACCGCTCCCGACTTCTGGCCCCTG
GGAGAGGAGCTATACGGAGCCAGGGTCTCGGCTCTGCGTCACTGTGGTTCGAACCTGGTC
CTGTCACTCCTCCGGATCCTGTGGAGTGTTCATATATTACTTGCAGCTCAGTCGCAAAGC
TTGCAGGAGGAAAGCAAGGACCCGACTGTGAGCTCCTAAGAACAGGTGCCCGAGCGCAAG
GGGAAGTCTTCGCCCTCCTCCGGGTCGCCGACATCCGCTTTGGTTCATCTTGCAGATTTG
TGGGAAGAGGGGGGCGCGAGTTGGAATAAGAGACATTCCAGAGCCGGTGACACGAGCCCC
TTCTAAGTGCTTCGCGTTGGAAATTAGAGTAATAGAGGAAAGGAAAGGCCACTCAGGTAC
AAATGTCACCCCTTTGTACAGTTCACTGGGACCGCAGAGAGCGGCGTGCAATAGTCTACG
TGAAAAGACTTTTATTTCTTCCCACGTGATGCAACTGAAGCGTGCAAAAATGGAAAGATG
GGCGCAAAATTGACCTCCTAATCCAGAGCCGGAGCCGGGAGACTCCTGCCGGCATCCTCC
ATCTCTCAGCAGAGGACTGCAGCGTGGGAAAAGGCACCACGACGTCTCTGCGGACACTCA
GGGCGCTGCGCTTGCAGGCTGGCGGCAAAAAACCTCGCGAGAGGTCGCGGAAGTGCTAAG
CCTGAAGTCCGTCCCCAGGGCCGGAAACGCTCGGGTCCGCCCGGAAGTAGAGTTCACTTG
GTGCACACGTGGACTGCAGAATGGCGGCTCACCGCTCCGGGCCGCTGAAGCAGCAGAATA
AAGCTCATAAAGGCGGGCGGCATCACGGCGGTGGGTCCGCACAACGGGACAGCAAAGGTG
AGTAGACAGGAGGGAGAGGGGCTGCTTAGCCGGTACCCGTGCCCACACCGAGACTAGACT
TGGGACCCTTGCCCAAGGCTCTTAAGCGGCGCAGGAAGGTTCTTGTTGGTTGATTTGACT
GAGAGGAGAAGAGCAGCCACTTCCGATCTGCCTTCCAGGCCGGGTAGGACCGAAAATCCT
CTGCAAGAAGCTGAAGAGGCAGCTCAGCCGAATAGACCAGAGGCATCGCGCCAGCCAGCT
CCGAAAGCAAAAGAGGGAGTCGGTGAGTAGAAGCGGGGGTGGGGAAGCTTATGGTTTGAG
ATTGGTAAAGTCTCAAACTAGAAAATGGGACACGGAAATGGGCCGAAAACGGAGGTAAAC
CCAGAGTACCTTCAGGCAGTGTTCATTTTAGAACGAGGCCCTGCCAAACTCCTTGACAGC
ACATCCATACACGTGGCTTTTTACGAGAGAATGCTTGGTCCTTCCTCATCTTTATTTATA
CGGGCTTGCTCTTTTGCAAATCATGATTATTTTAAACAAAGGGTCTCACTGTGTAGCCCA
GGCTGGCCTAGAACTCAGATCCTCCTACCTCTGCCTTCTGAGTGTTAAGTTAAAAGGCTT
GGGCCACCACACCTGGCTCCTCTGATGTTTTCTTTTTTCTTTTCTTTTTTTTTTTTTTTG
GGGGGGGGTGGTGGTGTTTCCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCCGGAA
CTCACTCTGTAGACCAGGCTGGCCTCAAACTCAGAAATGAGTGCTGGGATTAAAGGCGTG
CGCCAGCTCCGCCCGGCCTGCTCTGATCTTTTCTAATGTTTTACGTTACATAAAATTACC
TTGGTACTTTTACAAAGCAACAGAAAGGGGAGTAGTTCTGCCCTGGGGTTACAGCACCTG
TATATTTGAAGATAGAATAGTGAAGCAAATGATTGAGGTATTCTTGGATCTTTGTGTTGC
TAGGTTCTGGCCGAGAAGAGGCAGCTGGGCAGCAAGGATGGTCCTCCACATCAGGTGCTG
GTGGTGCCTCTGCACAGCAGGATTTCCCTTCCAGAGGCATTTAAACTGCTTCAGAATGAA
GACTTGGGAACGGTGTATTTGAGTGAACGGGGAAGCACCCAGAGTTTTATGCTTCTGTGC
CCTAGCTTGAAACATCGATGGTTTTTCACATATGCAAGACCAGGTTAGAGTGTCCGATAC
TTTTCTCTCATTGTGTTTAAGTAGTTGTCTCTCTTGAATATAGTGTGCTAACTATCTTTT
TTTTTTTTTTATGGTGTCTTTTGTATACAGGGGATCTGCATACTCTGTTAGACATGGCTA
AAGTCGCTGATACCATTCTGTTCCTCCTGGACCCACTAGAAGGCTGGGACAGTACGGGGG
ATTATTGCCTGTCTTGCCTTTTTGCTCAGGGCCTTCCCACCTATAGTAAGTGTGCTGTAT
TGGATACCAGCAAAGAAAACAGCTCTGGTCTAGTCATGCAGGCACAGTGTTTAAGATTAA
GTTTAGGAGTAAATCAATGGGTTGTATTCTGCTGGTGTGGGCTATACTTGGTAAACATTT
TCATATATTTTACTCTTTTTATTTATTTATTTATTTGAGACAACAAGAGTTTCTTTTGGG
CGGCCCTGACTATCCTAGAACTGGTCCTGTAGACCAGATTGGCCCTGATCTTTCAGGGAT
CCGCCCGCCCCCGTCTTCTGTGCACCGCCCAGTTGGTTTTATATTATTAAAGTGAGTTTT
TCTTCCTGGGCTGTCGTGTGCCCGGTGGGGGAATAGAAAGTTAACACTCACGGTGACATT
TCGTTGTTGGCTCAGTGTTGCGTTTCCCAGTGATCTCTGGGACCACGGCAGAGCTGACCG
CTGGGTTGTCTGGGAACTGGAAAGGATTTTCAAGTGGTCAAACAATGACTTCCTGCGCTC
TTCTCTCCTTTCAGCACTAGCTGTCCAGGGCCTTTCTGGCTTCCCACCAAAGAAACAAAT
AGATGCCCGAAAGAAGCTAAGTAAAATGGTGGAGAAACGCTTCCCTGAAGACAAACTTCT
GCTCCTAGACACGCAGCAGGAATCAGGAATGCTACTTAGACAGTTGGCTAACCAGAAGCA
ACGGCATCTTGCTTTTCGGGATCGGCGAGCTTACTTGTTTGCCCATGTTGCTGACTTCGT
GCCTAGTGAGGAGAGTGACTTAGTGGGCACCTTGAAAATCTCAGGCTATGTTCGTGGGAG
GACTCTGAATGTAAATAGCTTGCTGCATATCGTTGGACACGGTGATTTCCAAATGAATCA
AATAGATGCTCCTGTGGATCCGTTCCCTTTAAATCCTAGAGTGATTAAATCCCAGAAGAA
ACCAAACATGGCAATGGAGGTAAGATTGGGGTTTTCATTTCTGGGAGTCGAACCCCGGCC
AAGCCAGCCCTCCACTACTTGCCTACATTTCTTGCCCGCGATTGTTTTCAACTTTTTTAC
TGAATTTATTTTGGTATGCTGGAGAGTGGTACATCACTGGTGTTCAAGGTCTGGTTCTCT
CCTACCTTGTGGACCCACCCTGGTTTTTAAATTTCAAAGCAGATAGTTTGCATGCTGAGG
CCAGTGAGGAGACTACTGCTAGTTTGAAATGTCAGGCAGTAGACATTCAGACACATGCTG
GTTAAGTGTATTTATCTGGTATTTCTACATACTTTGCACAGTTGGCAGATGTGGCCTCTT
GTCTCAGAACTTAATTTGAATTAGGAAAAAAAATTCAAATACTTGTGAATTTAAAAATTA
CAGTAGTTAAGGTTCAGACCTGCTGTGGAAATTCAGAGGACACTAGCTGGTTGCACAGGA
GAGATCAGAGTTAGCCAAGTGTGTGGAAGGTTTGAATGACTTAGTTCAGCAGAGCTGAAG
GGATTATGTTGGGACTTAGATCCTACATCTAGTCATAGAGTGGAGCAGTGTCCACCACAC
TTGGACTTCTGGCTTTCTTTGAACTTTTAAAAGGCTGGACCTCACTATGTAGCAGTGGCT
TAGACCAGGCTTGCTTCAAATTTTACAGAGGTCAGCCTTCCTCTCCAGTTGAGTGTTGAT
AAAAGGCGTTGCCCACTCTTCTGAAGAGAGCACCTTGATTGAACGGTGGTGTAGTAAACA
GGAGAGTGTCAGGATTAGTAACAACCTCCCAGGTTAGTAGGAGAGCAGAGCAAGTGCTAG
GCGATGGCCGTTTGGAAAGTGATTGTCTGGTTAACTGGTGGGTCTTTCAGATGAGTGTCT
GATAGGCTCTTACCTGCTTTTGGGTCTTAGGTTTGTGTTACAGATGCTGCTCCTGACATG
GAAGAAGACCTTAAGGTTCTGATGAAGGCAGACCCTGATCACCAGGAGTCTTTACAAACA
GAGGCTATTCCAGATCCTATGGAAGGAGAGCAGACCTGGCCCACTGAGGAAGAGCTGGAT
GAGGCAGATGGTCAGTGACAGCAAGCTCGTCACCTTCCTGACTTTAATTCTGTATGCTCT
TTACCTGGTCGACGGTCACATGCTTCTAGGGCTGGATGAGGAAGTGACTGAAGTTTAAAT
ACCGAATGGCTGCACTAAGCAAACACTGAGTACAGCTCTGTTTCCTCTAGAAATCACCCC
AGGCTTGTCTCTTTACATAATAAATGACATTAGGCCCACTGCAGGGTTTATTTAGCTGTG
TCTTTGTCTTAAATGTGAGGCGGCTGGGTTAAAATTGGAAGAAGTCTATGTTCTCGTGTA
GCTGCTGTCTTTCATGTTGGTAGCAGTGCCTGCATAGGTAAGAATACTAAAAATTGTTTG
TACTTTTCAGACTTACTGAAGCAACGGTCCAGAGTGGTAAAGAAGGTCCCTAAAGGAACA
TCCAGTTACCAGGCTGAGTGGATTCTGGATGAAGGTGATGAAAGTGATGGGGAAGGTGGT
GAATATGATGATATACAACACGAAGGTTTCATGGAAGAGGAGTCTCAGGTAAGAAAATTG
GCCACTGGGCCACTTATGTATATGGCTCCAAAACCAAGGCTGTACTGTAAAGTCAGCTGC
TGTAACTAAGGGGGAAAATGTGTATCATTTGAGGTTGGGAAAATGGCACATTGGGTAAAG
AGCACTTGCCACATAAGCTTTAGGACTTGCATTTGAATCCCCAGGACCCATAAGAAGCCA
GAAGTCGTGGTGTAATTCTGTGAACTCGGGCTCTGTGGCAAGATTTGTAGTAGAGGCAGG
ATATCTGGAACACTGAGGCCAAGTTAACAAACAAGATCCAGGCAGTGGTGGCGCACGCCT
TTAATCCCAGTACTTGGGAGGCAGAGGATTTCTGAGTTCAAGGCCAGCCTGGGCTACACA
GAAAAACCCTGTCTCAAAAAACAAAATAAAAGATCCTGTCTGAAGGCAGAAGGTGAGGAA
AGACAACCAGAGTTGAGCTTTGACCTCTACAGGCGTGCCTGTACTCAAATAAACATAGTC
TCGCCCTACATTTTTATATTTATATTGGTTGCAGATAGGTGGCTAAAAAAATTTATTAGA
TCTTTGTTTAATTCCTTTTGGGGCAGAAATCAGTGGATTCTGCTGATTTTTTTTTTTTTT
TAAATTTTAAAGAAGATGAACTTACTAGCCCATACGTGACCTTGTACTCATAGCAATCCT
TCTAATCTTTCCAGAACTAGGATCATTTGTGACACCAAGCCTGATTGCTATTTTGTTTAG
CTTTTAATTTTATTTTATTTTTTTTAAATGTTGGGACATTTTATTACTGTTGCATAGGTT
TTTTTGTTTGTTTGTTTTTATTCTTTTCATGCACCCACTGTATTAACTCTTGAGCTCACT
GTGTAGCAGAGAAGGACCTTGAATTACTTACTCTCTTGCCTCTACCTCCCCAGTGCTTGG
ATTATAGAGGTACTCTAGCGTACTTAGTTTTGGAAGTGGTGCTAGGAATGCATCGACTCC
CAGGGCTTCTTCACAAATGTCTGGTGAGCATATCACCAGCTGAACCACGCTCCCACACAC
ATTGTTTTTAGGTATTGGGGGGGGGCTTTTTGAGGGAGGTGTTTGAGACTGGGTCACATG
TTGCTCTTTGAACTCTCTCACACACCCCCAGCCTCCCAAATGCTGTGATGAGAGATGCCT
ATCATTATGCCCATCTTGCATGCTTGCTTGTGTCTATATGTGTGGTAGTCAGGAAGCTTA
CTGGAGTCATTTCTCCCTTTCCACTATTTGAATTTCATGGATATAATTCGGGTTTAGAAA
TAGATTATCAGGGTTGGAAACAAGCATCCTTACGTTTTCAGCCATCTTATAGGTGCTATG
ATTTTCATTTTTGGGGACGTAGTCTTTTATGTATCTCAGGGTGACCTTGAACCCAGCTGT
TGATGCTGTAGGCATGTGAAGTCTGCCCAGCTTTAGGCTCTAACCAAGAGCTTCATGTGT
GCTAGCTAGGAAAGCACTCTTAACAATTGGCTACATTCCCTGCCCTTTTGGGGTTTTTTT
CTTTCTTTCTTTTTTTTTTTTTGAGACCATCTTAGTCTCACCCAAGCTGCTATCAAACTC
ATAGTGAATCACCTGCCTTAGCTTCCTCAATGTTAAATAAGTATGTTTCATATTGCACAT
TTTTAATTCTCCATTTTACAGGATGGGAGTGGTGAGGAAGAGGAGGAAGAATGTGAAACT
ATGACTCTCGGGGAGTCTGTGCGTGACGATCTATACGATGAGAAAGTAGATGCAGAGGAC
GAGGAGAGAATGTTGGAGAAATATAAACAAGAAAGACTGGAAGAAATGTTTCCAGATGAA
ATGGATACCCCCCGTGATGTAGCTGCTAGAATTCGGTTAGTCAACAAGTGATTTCAAACA
AGTTTTATTTAAAACCAATAACAGAAGTCTGTGAGCAGAAAGCAAATAGAGAAAAACACT
GTTCTTGTCCTTGAAGGAAGGACTAACATGCTATATGAGAAGTAGCAACATACTATCAAG
GTTTAGAATTGTTCAGAGGGCCCTAGAAAGAGAGACATGAAGGTTAATTAGCAGATAATC
CTTGTGGGAGTAAATGCGCAGAAAAAATTCTTTTGGAAAGTAAGAGTGTATATTTTGAAA
GAAAGCTTGTAAAAGCAAGAAAATGTAAGGCTCTAATGTAAGGCAGGTTGAAGAGCCATA
TTCCTGACAGGTACTTGTAAGTACTTGTCACCTTTGAAAAGCCTGGGTTGATTCTGAAAT
ACTTGTTAGAAGCTGTTGTAGAACATGGTTTTTGCTAAAGCTATTAGTCTGGAGATTGTG
TGAAGGATAGGCTCTCATGCAGACCAGGCCAGCCTTGATCCTTTGCCACTATGTTTCAAG
AGCTGAGAATGTAGGTGTGCCTTTCCATGCCCAGTTCTAGCCTATTAGACCATTTTGGTG
CCTTAGTTTCTTGAGACAGTTTAGGCTGATGTGGAACCATGATCCTGCCCCGGCATCCCC
AGTGCTTAGTTGTGCTATGCTGGGGATTGAACCCTGGGCCCACGTGCATACTAGATAAGC
ATTATACCAGTGAGTTACATCCCTAGTAAGAGTACTTTGAAAAACCTAGAGCCTTAACTA
ACCATTTTACAAGTGAGGTGAGTTTTATGTAGTACTAAACCTCTTGCTTTCTTTAAAACT
TCCGTTCTAGATTTCAGAAATATAGAGGCCTCAAGAGTTTCCGGACATCTCCTTGGGATC
CTAAAGAAAACCTTCCTAGAGATTATGCTCGGATATTTCAGTTTCAGAATTTTGTTAATA
CTAGAAAAAGAATTTTTAAAGAGATTGAGGAAAAAGAAGCTGAAGGAGCTGAGGTACCTG
CCTTCTGCCCACCTTCTAAGTTGTTCTTGTTTGGTATCATGCTGCTTGTTTGGGAGTATG
GAGCAGTCAGAGATGAGTAGCCGAGGTTGAATCTGGGTGGTTGATGCGTCTATGAGTGTC
AGTCTTGAGAGATGAGGCTTAGCACATACCTGGAGAAAGGTTTCATCATTATCGGCACCC
TGTGACTATTGTGCTTTCTCCTGGCAGGTGGGCTGGTATGTCACACTCCATGTTTCTGAT
GTCCCTGTCTCAGTGGTTGAGTATTTCAGGCAAGGAGCGCCCTTGATTGCATTTTCTTTG
CTACCTTATGAACAGAAGGTAAATCAGTGTTTTATGGGAAATGGAGAGGTACAAATACCT
TTCCCAAGTGTACAACACTTTGCTCATTGGGATGAGAGCCTACCTTTTTGATTGAGGAAT
TAAGATAGAGAAGTCAATGATGGTCATGCCCAAGATGTCTGAACCTGTCTGAAGCATCTT
TTTGATGTAGTCTATGTGGTTCTGAGACTTCTCTAAATGTGTTTTTCAGATCAAAATGGG
GGTTAGCAGTTGTAAATGTCTATGCCCATGTATAGATCTCTTCTCTAGGTAGCCTATAGT
CATGTATACTGGGAGTGGGAAGGCTGGCATAAAGGTTGAAGAAGCTTGAATGGTTGTGGC
TGGGAGGGTATGTGGTGGTGAGGTGGCTCTTTAATATTACTATGGAACAGTGCTGACACA
TGTGCACGGAAGCACCGATGAGGCCTAAATCACCATGATGTCAGTTGGTGGATACAAAGG
ACTTGTTAGTAGCATGGTCAGTTCTTAGAGTGACTGATGTTGGCTTGCTTTGCCTTTCAG
GTTAGGCTGTTGTATGCCTAGACTGTGAAGTTTTTTCTTGTTTGGTCCTCAGATGTCTGT
ATTGAACATGGTGGTGAGCCGGAACCCTGGCAACACGGAACCTGTGAAGGCGAAAGAAGA
ATTGATCTTCCACTGTGGGTTCAGGCGCTTCCGAGCTTCGCCTTTGTTCTCTCAGCACAC
AGCAGGTAAGCACAGACAGCTGCTGGAGCCTTGCCACCTCTTCTTTGTGGTCGAAAGTCT
CTGAGATTAGAAATATTTTGAGTACTCTGACTTAGGAGCCAATAATGTTTTTATTCAAAA
TGTCTGAACCTGTCTGAAGCATCCCAGTGATGCAAAATGTTGTACTGAGGCTTCTCTGCT
ATGAGTATTGTTCCAGAGTAGGTATTAAATCCCAGTGTAGCTTCAGGAGTAGGAATATGT
GTTGCCTGCTCACTTGGGGCTTTTGCCTTTCAGTGACAGGAGACAAGATGGTGACAGCTT
CACTGGTGCTCTGGGTACATTCTCTTACCATCGTGTGTTTGTAAACAAAAGTTTTATTGA
AGAGATGGCGTATCTTGTTGCACTGAGCTGGGTCCTCCCACCTTCCCCTCTTAGTGTTAC
TGTTATTACTTGCTTGTTTAAGTAACTTGTGTGTAGCTGTCTTGTTTTACTTTCTATTTT
TATTTTATTTGGTAATTGAGAGACTAGGTCTTAATATGTTGCCCAAGCTGGCCTTGACCT
TCAGAATGCTTGGGGTATTGAGGTGGAGGGGGGGGGGTACACTACCATGCCCAGCTGGCA
ACTTTGTTACAGAGGCACACTGACATACCTGAGTGAGTGAAATATAAAGTAACATGGACT
AGTTGCTGAACCTGAGGACCTACAGTCAGCGAGTGCCCTGACCCCCATGGTGGAGCAGAG
AACTGTCCTCTGACTTCTATGCATATATGCCCCCACACCCCCAAATAAATGAGATGTATT
ACAAGGCTTTTTATTGTTTTGAGAAAGTAAGGTGAACAGTTTCCCTACTAGCTTACTCTC
CTACACCCAGCACAGAAGCAGTCATCTCACAGCCATGTTCACTGACACGGAAAAAGCCCG
AGAGTTAGTAGTATAGAGAAACCAAAAATGAACTGGGAACTTTAGCCCTTGATGGCAGAA
GGTACACAGCAACTTCAAGGCCAGCATGCAGTACTGAGCTCCTCTCAAAACTAAGCAGAC
AGGAGCCTGTAGAGGACCCAGGTTGGATTCCCAGCATCCACATTGTCAATGTGGAGAGAG
GCACCTGCATTCAGATGCATACACATTAATAAAAATACAAACACTGAGGATATGCTGTGG
GTCTATGGCAGAGCACTTAGTGTGGACACAGCCCTGGGTTTCATCTCCATTGCTGAAAGT
TTAAAGGGTGGGGCCACATGTTGCAGCAGTACAGCTTTTGACACTTGCATTGCTTATGGT
ATCTCACAAGGCCTTTTGCTTTTCTATTTACTTATTTTGCACCCTTATTATGGAAGCTGA
TAAACATAAATTTCAAAGATTCCTGACTGCTGATGCTGCCTTCGTGGTGACAGTGTTTGC
GCCAATCACGTTCCCTCCTGCATCTGTGCTGCTTTTCAAGCAGAGAAGAAATGGTATGTT
GGATTTGGGATGTAAATACCGAACATACAAGTACCCACTAGCACCATAACTCTTCTGTAC
TTAGGCATGGGGTCTTGCTGTATTAAGGAATACTGGTGTTTTGTTTGTTTTAAATACCAG
TTTTAGCCTCATTGAGGGTGTAAGCCCAGAGTGATACATCAGTTGTTACCTGTTGGCATA
CTTAAGTACACACTAATCAATATATTCAATATATGTAAGGTGGGTGTGAGGGACTGGCTC
ATTATAAATGTCTTTTAGTGGTCTTCCTTTGCCTCGGGAAAGTAGCATAGTAGTGGATGG
ATGGGCCCTTAAAGTAGACTAGAGCTACGGACTTGGCCTTAGATTGACAGTGCTCTCTTT
CTCAGGAATGCACAGCCTCATCGCTACAGGCCATCTGTTTTCAGTGGACCCAGACAGGAT
GGTCATAAAGAGAGTGGTTCTAAGTGGTCATCCTTTTAAAATATTTACCAAGATGGCAGT
AGTGCGGTACATGTTCTTCAACAGAGGTAGGTGTGAGAAGGAGAGTGGTGGGAAGATGGC
CTTGCGGCTGTGTGGGCAAATGTTTGACTTTGTTTTTCCATTCTAAGAGGATGTGATGTG
GTTTAAGCCTGTGGAACTGAGAACCAAGTGGGGCCGCCGGGGACATATCAAAGAGCCTCT
AGGTAAGAGCCTGGGATTCCCAGGGGTTGGCTATCGGAGACTGTGGGCTGTAAGTTCACT
GCTTGGACGTGTCCACTTTATTTTGACCAATTATCTGTTTAACTTTTAGGTACCCATGGC
CATATGAAGTGCAGTTTTGATGGGAAGCTGAAATCTCAGGACACAGTATTAATGAATCTC
TATAAGCGAGTATTTCCCAAGTGGACTTATGACCCATATGTACCAGAGCCAGTACCTTGG
GTTAAAAGTGACATCTCTTCAACAGTGTCTGAAGTAGACATGGAGTAAGAGACTCAGTTG
GGTTCTGTCTCTACTGCAACCAACCAAAACTCCAGTGTTGGAGTCTGGGTTGTGACCAGG
CAGCTTGTGCTCTGTATTTCAGTTGTCCATGTCTCTGCTAAGTACAGAATTTACATGATT
ACTTACACTTTCTTCATTAGGATTTTGAACATAATTTTTAAAGGGAAGATGGAAACAAAA
TTTTCATCTAGAGACAATCTTGCCTGAATTTAAACAGAAACCGTCTGGTAAGGAGCTGGC
CGTTCAGCCTGCCCCACCCAGTTCAGGGAGGTTAGGTCTACATTCCCCCCACTGAGTACA
ATGCAGACGTTCTTTACTTCTGGAGAGACTGTTTGGAAATGCTGAGACAGCACTGCAGCC
AGTGCCACGCCAGCAGTCGGCTCAATGAGCAGTTTCATTCTCCCCCACACCAGCTGGGTT
GCATACTGTTGGCACAGAAAGGAGCAAGGGTTAATGAAACAAGAAACGGAGCCGGAGTCT
AGTAGGTTACATTCGAAAAATGAAGTAGACATTTGGGTTTGTTGTGATAAGTATGTGATC
TACTGTCAGGGTTCTGTTAACAATGCCTGAGTCTTACCTTGATTTCATCTTCGGTGACAG
TGAAGACATCATCCACAAGGTCTCTTATAATAGGCCAGGTATTCAAGCCAATGCTGGATT
TGACACCATCTGCTATGGTTTCTGGAGGATGAAGATTGGGGGTCAGTTCTCCTTTCAGTT
TAGACTGGTAGCAGTCATCTGCATTCGAGGGCTCAGCAGCGTATACCTTCACACTAGGTT
TCAGGGCCTGGGGAAGGAAGGCACATGTTACAATACAGCCTTTGTCTACGTAAAGGAGGC
AGAGAGTTAAAGATGTGTTACCCTTGGTGATCAGAATGGAAACAAGACCTTGAAGCACTT
TAATAAAAGTTGTATCTGATAACTGGCTTGTCTGGATTCTAGTAATTGGGAAGGGCCATA
GCTTTGTGAGGTGGACTTGAGGAGTAAGGATGCCACCATTGTAACTGTTAACTGCTTCTA
TAGCAGCATAGAGCAAAAGGACAGTGGGCAAAGAAGGCTATGAGAGGTGATGGTCCTATA
CCTAGTCTAGGAAGTCTAGAAGGTGTTTTTGTCCCCAACCCCCATACAGGGTTTCTCTGT
ATAGCTCTAGCTGTCCTGGAACTCATTTTGTAGACCAGGCTGACCTTGAACTCAAATTCT
GCCTCTGCCTCCCAAGTGCTGGCATTAAAGGCATGCACCACCACCGCCCAGTGAGGCTGT
TTTTTTTTTTTTTACCTTAATTGTAATGGCTATTCCAGCAACCATTCCTCCTCCTCCTAC
TGGTACCACCAGTGCATCTACCAAGGGAACCTGTAGTAATAATGTAAATAGGCCAATTAA
TAAACCTTTATGTGGGCTGGAGAGATGACTCAATGATAAGAGCACTGACTGCTCTTTTAG
GGTTCAATTCCCAGCAACCACATGGTGGCTCAACAATCTGTAATGGGATCAGATGCTCTC
TCTGGTGTGTCTGAAGAAAGCAATGGTGTACTCATATATATAAAATCATTTTTTTCTTCC
GAGACAGGGTTTCTCTGTGTAGCCCTAGCTGTCCTGGAACTCACTCTGTAGACCAGGCTC
AAACTCAGAAATTCGCCTGCCTCTGCCTTCCAAGTGCTGGGATTAAAGTTGTGTACCACC
ACTGCCCGGCAAAATAAATCTTTTAAAAACAAAGCCTCATGTGTACATACAGTCCACAGC
AAACCACTTTACTAATAGCTACATAGAATTATGCCATCTTACCTGGTTCAGCACTTCCAG
GGCAATTGTTCCTTGTCCAGCTATCACTGCAGGCTCCTGGTTGGGATGGACCAAGATGCC
TTCTGTTTCTTGCATAATTCTTTGAGTGACCTTTTCTCTGGACTAAAAAGGTAGCATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1136, 1298..1401, 2103..2322, 2430..2564, 3074..3498, 4410..4569, 4930..5087, 6741..6934, 7750..7912, 8127..8237, 8812..8944, 10256..10372, 10745..10885, 10967..11041, 11149..12257
1040..1136, 1298..1401, 2103..2322, 2430..2564, 3074..3498, 4410..4569, 4930..5087, 6741..6934, 7750..7912, 8127..8237, 8812..8944, 10256..10372, 10745..10885, 10967..11041, 11149..11324
NM_177325.3
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved