Mus_musculus Locus Eif4a1
snOPY snoRNA Orthological Gene Database
Mus_musculus Eif4a1
Mus_musculus
Eif4a1
11
SNORA67
5342..5484
7381
CCTCTATAGGAGAATGTTGCCTTGTGGCCTAGGTGGAGCAGCCATTCCTCCTTCCATGT
TCAGAGGGCAGGAAAACAGTGTGGGGGTGGTGGACGCGCAAAGGGATTACTGCCTGCCCG
ATCTTCAAACTTTTTTTTATATATATAAATATATATAAAAATGCCACGGTCCTGCTCTGG
TCAATAAAGGATCCTTTGAAGATATGCAAGTGGTGGTCTTCCTTAAGGGGCCTCAAAATA
GTGGCTGTGCTTTATCTCAGGTCTTCTTCCAGCTAACACTGTTAGCGATCCCCATTTCAG
GGCTTGAGAGTCCAGCTTTCGATAGATGCCATCCCCGGGGAGCAGATGGCAGTAAATATG
AATTAAGACTCGCTTATTCATGTAAGGAAGCCCAGGAGAAACTGGAAACATACTAAATGA
ACCAGTGATTGAGTGGGACAATCCTTGACAGCTTATCCCCCTATGCCCTTTAACCCAAAA
GTGGGTTCCATCCTTTTTGTCTCCAGTCGGGGAAACTTACTATCCAATGAGATATCGCTA
CAATATTTTCCTGAACGGAAGAATAAATAAAACTTGTCCTGTAAAGAAAACCCAGGTAAA
GGAAAGTGGCAGTCCAGACTGCCCGGAAGTTCCTGGAGGCTAAGGCCTCACCCCCGTCGC
TTGATAGGACCTGCTGAGCCACATGACTAAGGCACGATCGCCTCCGCACGTGTAAAGGTG
CTGGGTTCCAAGATGGCTGCCCCGCCGCGAGGCCCGACTTAAGTATGTCACTTCCGCACC
AGCGAGAAAGGCGGACCCTTCAGCCAATGAGGCCATAGGGCGGGGCTAGGCCATGATGGG
CTTTCAAACTACCCAATAGGGCGTCCGAACTAAAGCGCCTACAAAGTAACGTCACGTCGA
GTTGCAGAGCGCCGGCAGGCGGGGCAGAGGTGGCCAAGCCAATGCGATGGCTGGGGCGGG
GTCGGACGCTCTATAAGTTGTCGATAGGCGGGCACTCCGCCCTAGATTCTAAGGATCATG
TCTGCGAGTCAGGATTCTCGGTAAGAAAGGCTTTTGCAAAAGGTTATGGCTACTTACCCC
GTAGTTCCCTCCAAAGGGCCCGCCGTGGGGAAGTTGAGAGGCCCATCGCACCGAACCTAC
CAGGTTGCGGGAGAACCGAGCCGGGAGGAACCGTCCGGGGTTGGGGGGGTGGGGGAGATT
CCCATGGCCGCCGCTGACCCCAGTGTGGTTACGGGGAAGGACGACCTGGCTAGGGCGGAG
GGCGCGAGCTTCGTCACGAGGCCTCGGCCTGTGGGAACGCCGTACGCGAAGCTCGGATAC
TGAAAGGCAAGATGAGGTCGCGACATAACGTGGGAAAGAGGCGGCTGCGCGGCCCGGAGC
CGGCTGGTCTGGCTGCCTCCCTGTGTCGGGCAGGGCGTGCGAGCGAGGGTTCCGGAGAGT
TCTGGCGGTACCACTCGCGACAAGCAGGGGTGCCCCGGTCTTCAGCGAGTCCCTCCGTCG
CGCTTGGAATGTGGGTCGGGGAAGAAGAAACCGGCCGATCAGGGCGCTGGCCTTCTTGAC
GGCCAGGAAAGAGCCTAACCCGGAGGAGCGGCCGCGTGAGGCACGGGGAACCCACCCGGC
GCCTGGCGGGCGGGTCCATTTTGCCGCACAAGCCGGGCAATTGGCAAACTGCGGATGGGC
AGGTCCACTTTCCTTCGGGGGTGAGCGGCCTGAGGTATGGGAGGGCGACGCCATTTCTCG
ACGGGGGCGGGCGGGTTGCGGATTGTTCCATGGCGGGGGAGACGCCGCCGAGTGGCGGAG
CGAATGAGCACATGGCCGCTTGAGAGATTCCCCTCCCCCAGCCTGTTTCGCTTGTCTGTT
GTGCAATCTCCCCCTTTGCGAGCGCGGCTGGGGCTCATTGTGCGCGAGGCCGCCACCGCC
CGCGGCCTCCCACATCCGGGTACTGTGGAGGGGGGCCGGCCAGAGGGAGTGGGGGAGGGC
GCGGGCGGCATGACGTGGGGGGAAGGGGATGGCCCACCCACGGAACTCGGAGGTGGAAGG
CGGGACTTCCGGTGGCCTTGGTGTTCATCCAGGAGGTGCACGCGCTTTGATCCACCAGAC
CTAGAACATGTGGGCCTGGCTGCAAAGACCGCATCTCGGCGTTTTGTGTATGAGAGAGAG
AGAGAGAGTGTGAATGTGTGTGTGAATGAAGTCCTTTACAGCCGCTTGATCTTAAAGGAG
CGTCACTCTATGAAGTGCCTCTTGATGGTTCTTTGGGAGTACATGGGAGTTGGATCGGGA
ATGGGCTGGTTGCTTCCACTCTGGTCAAGGCATGAAGCAAAACTAGTGCTTTGAATCAAC
AGATCCAGAGACAATGGCCCCGACGGGATGGAGCCGGAAGGCGTCATCGAGGTAAGACCA
GAACCTGCGGTTCCCACTTTATTTTGTCAGAACAGGCACTTCCTTAGCGTGACAGTGACC
TTAGACATTTGGAGTGGTAGAACAGAGCAACCTGTAGGATGAGGTGACTCCAGCTTTAGT
GTAAACACGTTACTCGAAGTGCCTAAGTTTTTTTTTTTCCTAATCCTGCAGAGTAACTGG
AACGAGATTGTGGATAGCTTTGATGACATGAATCTCTCAGAGTCCCTCCTCCGTGGTATT
TATGCCTATGGTTTTGAGAAGCCCTCTGCCATCCAGCAGCGAGCTATTCTTCCTTGTATC
AAGGGTAAGACTTGTACTGGACTAGATTGGACTGGACAGAGTGGTAGGGAGTTGGTGGGC
ATAGCAACCGGGAGGAAACATCCTTCTTGGATCTTGGATTTTTAGTTTTGTTAGTACATA
GGTCATGCCTTGGATGCATGGGTTTGTTTCCAATTAGAGGCTTTGTTTTTATTGCTCTAC
ATCTAGTCTAACAAGCTGTTGTGAGTTCATAATATTTTGGCAAAAGTTTGTTTGCAAACC
TCTACCATTTCATTTACAACCTTTTTTCTGTTACTGATGTCATGAAGTAAAGTTTCAAAT
ATCCTCTGATCCCAAGGTGCACATCTAATTCTTGATCTGGTTGTAGGTTATGATGTGATT
GCTCAAGCCCAGTCTGGGACTGGGAAAACAGCTACATTTGCCATATCAATTCTGCAGCAG
ATTGAATTAGATCTAAAGGCCACTCAGGCTTTGGTTCTGGCACCCACACGTGAATTGGCT
CAGCAGGTGAGATTGGTGTGTTTCCTATATGACTGGTTTAAGAGAGAAGAGTACTAGTGG
TGAGTGATACAGGTAGATTGAGCACTGCAAGTTCAAGGCCACCCTGGTCCATAGAGCTAG
TTCCAGGACAGCCAGTACTATGACGTTTACCTTAAAAATAAGACAATTAGAAGAAGGTTG
AGGACATTGTCTTAATGCCACTGGGTCTTGTTGACAGCTTTTAGTTCTATTGAGATTTGC
TGACCTAATTACCACCAACTTTACCAGCAAAAAGAAAAAAGAAAATGCATCTTTTGAGGA
AGGGGAAGAGGATTGGTAGAATCTATCTAGCTGGCTGGGCAGGTTTAGCTGTTTATGACA
CACCCCTGGCAATGGGCAAAGAGGCACCTTGTTTGTGGTGTTGTTCTTATATCAGTCAGG
GGCAGAGCAAATGGCAGTCCTTTGTTCATCCTAGCTTGATGCCTGGCTTGGTGGCCAAAG
CTGTTTCATGCCTAGGGCACATAAAATCCTGAAGCTAATTAAGAGGATTGACGTCTTAGA
GCCCTGTAGATTTTGGGTTTTGTTTGCACATCAGCTGGGGATGTTGGCTCTAGTGGAACA
CTAAGTCTTGGTTCTGTGGCAGGGATGAAATAATCACACACATTGTTGGTATAAGGCTAT
GTTCATAATCCCAGCCTTTGGATTTGGAATGTGGTAGTAGGGTGGAGAGTGATTTCTAAG
CCTTTGTAGAGCTGGCCTGGTGTTTTTTTACAAGGCTGCATGTAGGGGTGGGGAAATTAC
TGTGAACCTGTGTGGTGGGATTCAGCACTGCCATTTGTGGTTGTAGTGCTGGGATTGAGA
GAGAATTACGTGGGTACCGCCCGAGTTAATGTAGATGTTCTTCTGCATTCAGATACAAAA
GGTGGTTATGGCATTAGGAGACTACATGGGTGCCTCTTGTCATGCCTGCATTGGGGGCAC
CAATGTGCGTGCTGAGGTGCAGAAGCTGCAGATGGAAGCTCCCCATATCATCGTGGGTAC
CCCTGGCCGGGTGTTTGACATGCTTAACCGGAGATACCTGTGTGAGTACCATGTAACAGT
TGGTGGGCATTCCCACATGTCATTTTCTTGGATGCAAGTTTTCCTTTAGTTTAGAACTGA
GTTGCTCTGTGATGAACCCCATGCGTGTCATCTGAGCCTGGCTTCCCTGTTGTTACCTTA
GCCCAGGTAGTGTTCTACTTACCAGGGCTTTTGCCTGGCTTATCAGGGAAGCTTTGGGCA
AAGGATCAGTCCTTGTATTCTGAGAGCAGACATCTGCCCTTTGACTGCCCTCTTACCAAG
AGATTTCCATGTATTTCACATTTGTCTGATCACTATGTGTTGGTGTTTTTTCTTCTGCCT
TCTAGCCCCCAAATACATCAAGATGTTCGTACTGGATGAAGCAGATGAAATGTTAAGCCG
AGGGTTCAAGGATCAGATCTATGACATATTCCAGAAGCTCAACAGCAACACACAGGTGGA
CAAATGGCGAGGTTGATAGGACACAAGGGGCTTGGTTGTGATCTGAGGAATGTACAGTGC
CCTCATCATGGCTGCTGTTTTCCCCATTAGGTAGTTTTGTTGTCTGCTACAATGCCTTCT
GATGTCCTTGAGGTGACCAAGAAATTTATGAGAGACCCTATTCGGATTCTTGTCAAGAAG
GAAGAATTGACCCTGGAGGGTATCCGCCAATTCTACATCAATGTGGAACGAGAGGTGAGG
CCCAGTGCAGGAGGCAGACCTGGTAGTAAGTTGTTGAGTGTAACCCCTGACTTCTGAATC
TCCAGGAGTGGAAGCTTGACACATTGTGTGACTTGTATGAGACGCTGACCATCACCCAGG
CAGTCATCTTTATCAACACCAGAAGGAAGGTGGACTGGCTCACCGAGAAGATGCATGCCC
GAGATTTCACTGTTTCTGCCATGGTGAGTTTTAATGGCTATGTGTCTCTGTGTGTCTGTC
TGTGTTGGGAGCCTTGTGCCAAATGCTTCTACCTCTTTGTTTTCCAGCACGGAGATATGG
ACCAAAAGGAACGAGATGTGATCATGAGGGAGTTCCGGTCTGGCTCTAGCAGAGTATTAA
TTACCACTGACCTGTTGGTGAGTAGATGCTTTCAGGGAAAGAAAGGAAGACAAGTTAAGT
TAGTCCAAGGTGATTCCCTCTCCAAAGGGCTGACTGTGTGCCCTTTTCAGGAACGTAGCA
ACTTGGAAGAAAACCAGGCGTGCCTGAGGTCTCTGGTGGACAAGAAACTCTTGTTTCCTT
TGCCCTCCTCTGGCTGCCTACATGTATGCCTACTTAATTAGGATAGATTGTATCCTCTGA
TGGCTATATTCTTTCCTGACCTAGGCCAGAGGCATTGATGTGCAGCAGGTCTCCTTAGTC
ATCAACTATGACCTTCCCACCAACAGGGAAAACTACATCCACAGGTAAGTCTAGGTCTGA
CAGACTAAACAACCCCTATGCTGAAACCCAAGTGTTCCATCATCCTTTTTACCCCCCTCA
GAATCGGTCGAGGTGGTCGGTTTGGTCGTAAGGGTGTGGCTATTAACATGGTGACCGAAG
AAGACAAGAGGACTCTTCGAGACATTGAGACTTTCTACAACACCTCCATTGAAGAGATGC
CCCTCAACGTTGCTGACCTCATTTGAGGGGCTGTCCTGCGACCTGGCCCTAGCCCAGGGT
TCAGTCCTGGGGTGGGGCTAAGGAAGAGCTGGAGGGGGGAGGGGAGGGAGCCAAGGGATG
GACATCTTGTTTTTGTTTTGGCTTTTTTTTTTTTTGTTTCAGTTTTTTTTCTCTATGAAT
AAATGTCACTTTTTGAGGCAAAAAGAAGGAACCGTGAACATTTTAGACACCCTTTTCTTT
GGGGTAGGCTCTGCCCCAGGCGCCGTCTCCTTCCCCCCCCAAACACTAATGCATTTCCCT
AACCTAGTCACCTCGTTCCTAAAGGCTTTCCTACCCCAGCCAAATCTCCAAAAGTGAGTC
AAGGGGCTAAAAAACAAGGCTGGCCTCATTTGCTGGACCAAATCTACAGGGAGAACCCCT
GAGTGAGGTTGTCCAGGGAATTGTCCCCTGGTGAGGGGAGCAGGGGAGAGAAAATGGTAG
CCATTTTTACATTGTTTTGTATAGTATTTATTGATTCAGGAAACAAACACAAAATTCTGA
ATAAAATTACTTGGAAACTGCCTGTTTGGGCTTCTTGTTTCTTTCCCTTCCCTCCTACCT
GCTAGTGTGGATCACCTGCCCCCATACTAGTTGATTACTGAATTTGCCATGTTGCTTCCT
GCAATACCAAATGACCCACATTACTAACATTTGGTAATTTGCCTCAGTGTTAGGCACAAG
ACATGAGTGAAACTTGCTGCATTAAGACTTAAACTGGCTGGGTATGGTGGCGCAAGCCTT
TAATCCCAGCATTCTGCCGGAGGCAGAAGCAGGTGGATTTCTGAGTTCGAGGCTAGCCTG
GTCTACAAAAGTGAGTTCCAGGACAGCCAAGGCTACACAAAATACCTGTCTTGAAAAACC
AAAAAAAAAAAATTCAACTGGTTGGTTAGGCCTAGCCCAGATGATGTAGGTGTCAACTCA
CCTTGGGGATGTAGGGAGATGGTTGTTCTGTAGCTCTTCCTGTCCTGCAACTAAATAAAT
AGGCTAAGCTGACCTCTTACATCTGCCTTCGGCCTCCTGTGCTAGGATTGGAGTGCATGG
GTGGGGTTGCATTTCTTACCAATGAGGAAAGGGCTTCCCATTTCTCTGCTGCATTGTAAG
CTCCCAAGTAGAGCAAGTTTTGCTTAGGTAAGTTCCGTGTGAGTCAGCTGCCTCATTCTC
ACGAGGTAACCAAGGCTTTGTACCGCCCACTGAGAACGTCACTGCCAATCACAGCCTAAT
TGTGAAAACCAATGGCTTGAGTGGGTTGCTAAAGCTGAGGTGTCTGAGTCAGGTTTGGGG
TGGGATTATTTTAGTTAAGGGAAGTGAGGCTTTTCATTTCCTCTTCCAAGAGAAGGCAAA
GGGGATTGGATTGAGGAAGGAACTGGTGTAGCCTAGCTGGTCTGAGCATCTCTGCCATGC
GGCTCCCTGTGTGTCTGATCTTGCTAGGACCGCTTATAGGTAAGGAGAAATGGGAGGTGG
GGGAGGGAGGGCTCATGGGCAGGAGCCTGCACCTGGGTGGCCAACCAATCTCTTACTGAA
AG
  Untranslated Region
  Coding Sequence
  snoRNA
895..1039, 2342..2390, 2571..2703, 3046..3185, 4072..4240, 4565..4674, 4770..4913, 4985..5122, 5207..5296, 5544..5623, 5712..6383
1017..1039, 2342..2390, 2571..2703, 3046..3185, 4072..4240, 4565..4674, 4770..4913, 4985..5122, 5207..5296, 5544..5623, 5712..5730
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved