Mus_musculus Locus Odc1
snOPY snoRNA Orthological Gene Database
Mus_musculus Odc1
Mus_musculus
Odc1
12
SNORA42
2175..2310
8113
TTAACATCGTATACATAGTATACATAGTAACAAATTGTAGTGTTCGTGTGTTTTTCCAA
TACTGAATATGTAAGTCAGTCCCACTTGTTCTTTAACAATGTAACTTTGGTGGATACAAA
TTTACTGCCCAGACTCTGTTCGCATTCAGGCTTCTCAAAGTTGTAGCTACCCTGAAAGAC
AGAATAAGAGAGACAGCTGGTGGCTGTCCACCACCTCTTACCTTGTCCCTAACACGCCTT
TCAATACGACCCTTGCTTAGATAGAAGGCGTACTTAGCATGCAACTGATGCCTAACATCT
AGTTGGAAGCCACCAACATAACACGGAGTGGCCGGGTCAGCCTCCGCGGGCTTGTCTCTC
AGCAAGCTTTCAGGCTTAGGCATACAGGGTCGTGATGCAGGGTCAGTCTGCGCCACCAAG
TCTAGTCTATGTGGCCGGCGCACAGCTCACGGCCCATCCATCCTCCGCTTGCATCTGCGA
TACGCCTGCCCCGCTAGGGAATACCACCCCCTGAATGGAAAGCCGAGGAAGAATTTTGCT
AGTCTTCCAGGTCTGGGTTCAGCCGTTAGGACCTGGAGAGGGGGAAGAGATTGTGTGCCT
AGGCGGAGAGGTAGGGGGCGAGAGACTGGCGACCAGGTACATGTGCGCATGCACCAGCCG
ACTCCCGCCCGCTGCCCATAGGGCCCTGCGGCATGCTGGCAGCCAGGACTGGTGATGTGG
TGCGCGTGCGCAGGCCTGCCGCAGGGCGTGTCCGACACGAGGCCCGGCGGGGAGCGCGGG
GCGTATGGGCGGGTGGGTGGGCACGCGCTGCGCCCCGCCCCACTGACGCGCCCGGCCCGC
GTCCCCCGCCTCCGGCGCCGGGACCCGGGTTGGCCGCCACGGAGTCCCCGCCCCTCCCCC
GCGCCTCCCGGCCGGAACCGATCGCGGCTGGTTTGAGCTGGTGCGTCTCCATGACGACGT
GCTCGGCGTATAAGTAGCGGCGCGTCGCACCGTCGGGCTTTGTCAGTCCCTGCAGCCGCC
ACCGCCGGCCGCCCTCAGCCAGCAGCTCGGCGCCACCTCCGGTCGGCGTCTGCGGCGGGC
TCGACGAGGCGGCTGACGGGGCGGCGGCGGCGGGCGGACGGACGGACGGACGGGCGCTCC
TCGGGGTTTGGCGGCGGCGCCTCCATGGGTCAGGCCAGCCGGGCCACCGTGCTGTGAGGT
GAGCGGGACGCGGGAGGGATGTGCGGCCACGTGTCGCGAGGCCCGGACTGCGGCCGCCGG
CAGGGGACACGTGGCCCGGGACCGGTGACCTTGCGAGCCGCCGCCCTGAAGGCAGCTGCT
CCTGGACCTCGGCTGCAAGCCCTCGGATCCCCCCATGGGAGCCCTCTTCGCGTCAGCCGG
ACTCAGCGCTCCACTTGCCCGGGTGATGATGGAGGGCAAGCCCGCGGCAGGTGCAGGGGA
GCGCGGCCGCGAGCAGCGGTCCTGCAGTTAGTTTCCTGCTGCTTTCTTTAGTTTCACTAC
GTGTACAGAGCAGAGGCGATGACCCGGAGTGGAAGTTGGTAGACCAAATTTAGTCTGGGA
GTCACTGCTAATGAATACCCACCAGCTGTGACTTGGAATTAGAACTCCTTGAATGACTTA
GTGGTTTAGGGGAAAACGGGTTCCCGGCTGTCCCGGAAACCCTACTCAGAATCCTCAATA
ACTGGAAAAAGTGTGGGGGGCAGAGCCTGTCAGGAATGTCTGGGAGAGGACAAAGAATGT
AGTGGTTTGTTTTATTCAAACCTAAGATCGGGCAGACTTTGACTGATTGGAATTCTTTTC
TGTTTTAATTGGCTTATATCTTCCAGAGTTACCTTCTTGTGCTAATTGTCTGACACGATT
TAGCTACTTCCCATACCAAAATGTGTTAGTAACATTTTTCTTTCAGATCTTATCTATTAT
ATTATTTAGGCAAAGCTACAGAAAGGCAAAACAGTATCTCAAAGCTTTTCGTGTTTAAAC
CGGAAGGTTGCCTGGAAAATACTTAAGACCTAAAATTACAAAGTTACTGCCAAAGCCCAT
TCATCAGTTGTAAATGATATACAACGAGTTGGCTGGCTCTCTTCTCTAGTCTTAACTTAG
GAGAGGTTTAGGCAGCTAACGGAAGTTGACATTGCCAAAAGTCTCGTTAAATTAAGGCTT
AACATGTTTAACCATGCATGGATTTGGATTTATGGCAGGCTCTTCCCCGTGGGCCTCTCA
TAGTGTCCCATGCTAGAGCAAATTGTGGCTCCTAACCATTGCCCAGCCTCCGTGCCTGTA
GGCTGCAGGCACTGAAGTGGGTCACACAACGGAAAAAAACGAGTTTTACTTGGCCACTTG
CTGTTGTCCATTTCATAAGGCCCAGACAGAAGCTTTTATTAAGAGTGGTGACCTTGCTTA
TTTTTGTTAGTCATAAAGTTGACCAAAAATGCCTTCCATATGGTTATTATCCATAACTAA
GTGGATATTAGAAGGCATTTGAGGACAGTCAGGATCCCAGAAGTGCTCATTTTGTTAGGC
AATATAGGCTTTGGGATACTGGTGTCTCATAATAGTAACTAACAATATCCTGTTGATTTG
AAGAGTTTGGGTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTAATGCTAGTACTGCATGAA
AGTTCCTTATGGAAAATTTTGATGGATTGTTCACTGAGTTTGAGTGCTCTAGATAGATGA
TAATGACTGTATTCACTTAAGATCATTCAGCATAACAAAGTGGGAAGGAATAAGATATTT
TCAGGGCTGCATGTAGTTACTGTAATGCCATTTGAAGTTTCTGAAGACCTGGAACGGCTC
AGAAATGAAGCCATGTAATACAGTAATATTGCCAGAGTTAATGGGCTGTATGCAGATATG
CTTCTGAGACACATTCTGTTTTGGAGAGATGTCCCATATGTATAGAGTTGTGGCATTCAG
TTTTGAACAGTGGAATCTGTTTGGGGAGGGTGGTGTCTATTCACCTAGGCCCTGGGATTC
CCACCCACAGTTCTTCCTGTACTGGCTACTTTATTTCACCTGTTTACTCTGGTGTATGGT
TGCAGCGTGTAACCTTTAATGGTAAGATTCCAAGGGAGATCACATCTTGTGTTTCTATTC
ACTAGTGTTTCCACCACTCCAAGAAGGCAGCATTCAGAGTTCTTGGCTAAGTCGACCTTG
TGAGGAGCTGGTGATAATTTGATTCCATCTCCAGGTTCCCTGTGTAAGTATCGGTTTACT
TGTGGATTTGTGCTGGAGCATTGCTACGACTTTGAGTGTGTTCCCGCTCACTTGCGGCTT
CCCCTGTTTCAGAAGCACATCGAGAACCATGAGCAGCTTTACTAAGGACGAGTTTGACTG
CCACATCCTTGATGAAGGCTTTACTGCTAAGGACATTCTGGACCAAAAAATCAATGAAGT
CTCTTCCTCTGTAAGTACGGGAAGCCCACGGAAGGCCGCAACTCTGCTGAGAGCTCCTAG
CACCATACATGAGCCTGTCTTGCCAGAGAATCTAGAATGTGACTGTGGACTGTCTAGTGG
TTGGTCATGCCATGTCAGTGACTGCTAACAGGGATAGAATTTGATTAAGGAAGGGAAAAG
GGTTTTCAGTGTGGCCAGCTGCTGGACAGCTAATGAGGTCCCTGAACCTGTTCTCATTCC
AGGACGATAAGGATGCGTTCTATGTTGCGGACCTCGGAGACATTCTAAAGAAGCATCTGA
GGTGGCTAAAAGCTCTTCCCCGCGTCACTCCCTTTTACGCAGTCAAGTGTAACGATAGCA
GAGCCATAGTGAGCACCCTAGCTGCCATTGGGACAGGATTTGACTGTGCAAGCAAGGTAA
GACTGCTCACCCCGCCCCAAGGAGGCATCAGTTGTGTTAATAAGTGTTATTAATAAGCTG
AGGTGCACATGACAACTTCATGTGCTTTTGTTTGTCAGACTTGGTCTGTATAGAGCCCAA
CACTGCTCTTCTCTTTCAGACTGAAATACAGTTGGTGCAGGGGCTTGGGGTGCCTGCAGA
GAGGGTTATCTATGCAAATCCTTGTAAACAAGTCTCTCAAATCAAGTATGCTGCCAGTAA
CGGAGTCCAGATGATGACTTTTGACAGTGAAATTGAATTGATGAAAGTCGCCAGAGCACA
TCCAAAGGCAAAGTGAGTCTTCTGATAGAGCACAAAAGGCCGGGCCTTGTTGGGCAGACT
CATATCTTGGTTCATTTATTTATTCCTATACATAGTAGAACTAGGCTAAACCCTGTGTCA
GACAAGCAGCAGCACCTACACGTAGGCTCCTGAGCGGATGAGCATTATAGAGCACTTACA
CAGTGTACTTCCACCTAGGTTGGTTCTACGGATTGCCACTGATGATTCCAAAGCTGTCTG
TCGCCTCAGTGTTAAGTTTGGTGCCACACTCAAAACCAGCAGGCTTCTCTTGGAACGGGC
AAAAGAGCTAAATATTGACGTCATTGGTGTGAGGTGAGATCTCAGTGATGTCATTACAGG
CTGAGACATGAAATTTTAAGGCCCTTTCTCTTCCTGAGAACTAGTGAAAGACCAGCTTCC
TGTTTGTATTTCAGCTTCCATGTGGGCAGTGGATGTACTGATCCTGAGACCTTCGTTCAG
GCAGTGTCGGATGCCCGCTGTGTGTTTGACATGGCAGTGAGTACACGGGACTTGTTCAAG
GGGAGGGAGGGGCTGTCTGAGATAATTAGAGTCTAGACTTTGTCTCTTGGGGAAGCCTTC
TGCATGACAGATTTTAAACCCATCTGTCGTGTGCATTTAAACTCTGGCAATTTGACTTGA
ATTTTCTTGGTTCTAGACAGAAGTTGGTTTCAGCATGCATCTGCTTGATATTGGTGGTGG
CTTTCCTGGATCTGAAGATACAAAGCTTAAATTTGAAGAGGTAATTACAGCATTCATTAT
TAATTAATGACCTACAGAGGGTATTTTATATCTAGTAGGTTCCATTTTGGTGTTTTTACT
GATATTAAAAGGTGCCAAACAAACAAGTGGCCTGGCGCTGCAATCCCATTGACTGGTGTA
CGGTAGCCTAGGCTGGCCCTGAACTCCCTGAACTTCAGTTCTGTCTCAGTTTGTACTGTC
ATCCCTGTCTCCCATATATTTTTAATGTCTCCTAGGAAATGAAGCCATTGTTTAGTGCTT
GTGTTATATTTGTACAATTATGTGAGCTAGGCAGGGTGGAAGGAGGTTTATCTTGGCATG
CATTATTTGTTAACAGAATTATTTCAGCGTTTGTCCCTCTTTTGTAATTTATTTTGTGCT
GTTTAATAAAAATATTCATAATGTGTTGGAACAATTGAGAGGGGAATAGGCAATGGTGTG
CAGACTGGTTTCCAGGGAGAGGGGTGTTGGTGTTGCCTGGTGACAGACCTGCTGGGTCAT
GTCCTGTTCCTTACACACTGCATAACATGGCTGCTCCCTTCTCTCCCTCTTAGATCACCA
GTGTAATCAACCCAGCTCTGGACAAGTACTTCCCATCAGACTCTGGAGTGAGAATCATAG
CTGAGCCAGGCAGATACTATGTCGCATCAGCTTTCACGCTTGCAGTCAACATCATTGCCA
AAAAAACCGTGTGGAAGGAGCAGCCCGGCTCTGACGGTATGTGGTGGCAGGGTGAGTCAT
GTAGGGTAACTGGAAGTTGATATGCTGGGTGGTAATTAGGGTGATCTGTTTTTCTAGATG
AAGATGAGTCAAATGAACAAACCTTCATGTATTATGTGAATGATGGAGTATATGGATCAT
TTAACTGCATTCTTTATGATCATGCCCATGTGAAGGCCCTGCTGCAGAAGGTAAGTTCTG
AGCATGCTCTTTAGCAGTGAGAATGGTGGACAGGATTCGGGGCTATTAAAGAACAATGTC
TTCTTCATTCAGAGACCCAAGCCAGACGAGAAGTATTACTCATCCAGCATCTGGGGACCA
ACATGTGATGGCCTTGATCGGATCGTGGAGCGCTGTAACCTGCCTGAAATGCATGTGGGT
GATTGGATGCTGTTTGAGAACATGGGTGCATACACTGTTGCTGCTGCTTCTACTTTCAAT
GGGTTCCAGAGGCCAAACATCTACTATGTAATGTCACGGCCAATGTGGTGAGTGAGATTG
GTTTTGCTTGTTTGGTGGTGGAATATTTGCCAACCAGGAGCCAGAAGCTATCCCTGGTTC
TATCCCTGGTGCATACATACACACATACTATGGGGAAAACAATATGTGCTGAAGGGGAGG
GATCACTTGAGTGAGGGCCTTGATAGAATAATAACTTGCTTGCCTGTCTCAAGAAAAGGA
CTGAACTTGTACTTTGGTTTTTGTCTTTTTGATATAAGAAATTATTTTTGTACCTTGATC
TAAATACAGATAAATGGAAGGGAGTTCTCCAATAATACTGTTTGCTTACAGATTCTTATA
CTAGGAAAGGTCTTAGAACTAAAAGCAATTAGATCCTTTGCAACTAAAATGTTAATTAAT
GCAACTAAAGTATTCAGCTGGCATTTGTGACCTGTGGTGCATTGGGTTGTTTCCTGGTGA
TGTAGTGACAAGGGTGAGGTCTCAGGAGACCTCTTGGGAGGCTGCCCAAATTTGGAGACA
CTTGGGTTTTGAATATATGTACCTCTTTGTTTTCAGGCAACTCATGAAGCAGATCCAGAG
CCATGGCTTCCCGCCGGAGGTGGAGGAGCAGGATGATGGCACGCTGCCCATGTCTTGTGC
CCAGGAGAGCGGGATGGACCGTCACCCTGCAGCCTGTGCTTCTGCTAGGATCAATGTGTA
GATGCCATTCTTGTAGCTCTTGCCTGCAAGTTTAGCTTGTGTTAAGGCATTTGGGGGGAC
CATTTAACTTACTGCTAGTTTGGGATGTCTTTGTGAGAGTAGGGTTGGCACCAATGCAGT
ATGGAAGGCTAGGAGATGGGGGGTCACACTTACTGTGTTCCTATGGAAACTTTGAATATT
TGTATTACATGGATTTTTATTCACTTTTCAGACATGATACTAACGTGTGCCCCTCAGCTG
CTGAGCAAGCGTTTGTAGCTTGTACATTGGCAGAATGGGCCAGAAGCTTATGTTGTGACC
CATTGTGAAAATAAAGTATCTTGAAATAACTGGGCATCAGGGAATGTTTGCAAGTATCCT
TAAAGAAGGCACCAACATCTGCACAGGCTGCTGTGTCATGGAGAGACCCACTGCCTGTGG
ATCTGAAGGTTGGGCTAGCCCCGCATAGCACAGAGGAGAGGTGGATGGCACAAGGCTGTG
CCCTCTCTGTACAGCATCAGTCTGCTTAGCCCATCCCAAGTGTGCAGTTGGCTGAGAACT
TTGTTGCCCAGAGTCTGTTGGTGAGGAATGTCACCTGCCTAGTGACCGGTTGGCATGGCC
ACTTCCTAGGGAGGTCATCTGAAGTCCTTGCCTGCAGAAACCCTGACTGTTCCCTCAACC
CTTGACTCCCAATTGCATCACCACCTAGTAACAGTTGGGAGTATCATACAACATCGGCAG
TCAACTTCCTGTAATAAATTCAACAACAGCAACTACTGTGTTGTAAATCTTTACCCTGAC
CTTTTAGATTATAGTTTACACACACACCTATTGCCTCCCCAAAGTATGCCAGACTCTTAA
ACTAGTTAGCATTGAAAACCTGTAGGTCAGGAGGAAGGGCAGTCATATCCTGTGATCCCA
GCACTGGGAGACACCAGTGTGGGCTACATATAGGCTCTATTTCAAGCAGAAGTGGCTGAG
TAAAACTGCTGACCTGTCATGGAGAGACTCACTGCCTGTGGATCTGAAGGTTGAACTACC
TGCACCTCAACAGCTGCTTCCTCTCCAGGGTTTCCTTTCCCAGGCACGGGGCTTTATTTG
CTAAGAACTTTCTTGGGAGCCACAAATAGTGGCTGGAGTTGGAAGATCTGAAGTGAAGCT
GCTGTGTCCTATGCTGTGCCAGTAGGCTCAGGTGGAAATGTTATAGGGTTGAAGGCTCCC
ACCCCAGGCCTTGGTTATTGGTAGTTTGTATAGCTGGGGAAACCAGGTCTCCAGCTCCTG
GCAGCAATACATTTTCTAAAGACTAAGTTCCAATCTAAAGGCTCAAACTGAAATGGCTAG
AAGCCAGCATGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1197, 3125..3222, 3312..3429, 3662..3835, 3979..4151, 4338..4472, 4574..4655, 4816..4899, 5453..5615, 5697..5809, 5892..6106, 6636..7113
3328..3429, 3662..3835, 3979..4151, 4338..4472, 4574..4655, 4816..4899, 5453..5615, 5697..5809, 5892..6106, 6636..6777
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved