Mus_musculus Locus Rps2
snOPY snoRNA Orthological Gene Database
Mus_musculus Rps2
Mus_musculus
Rps2
17
SNORA64
1663..1796
3814
ACTACCCTTCCAAAGGTACTGAGTTCAAATTCCAGTAACCACATGGTGGCTCACAACCA
CCCTTGAGATCTGATGCCCTCTTCTGGTGTGTTTGAAGACAGCTACAGTGAACTTAAAAT
AATAAATAAATCTTTGGGCCAGAGCAAGCAGAGGTCCTAAATTCAATTCCCAACAACCAC
ATGAAGGCTCACAACCATCTGTACAACTACAGTGTGTACTCACATACATAAATCTTTTAA
AAAAATGTCTCGTCGGGCGTGGTGGCGGACGCCTTTAATCCCAGCACTTGGGAGGCAGCG
GCAGGCGGATTTTTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCA
GGGCTATACAGAGAAACCCTATCTCGAAAAACCAAAACCAAAAAACACCAACATACGATA
AGTTAGGTTAAATCACTTTATTTGAGAAAAGAGGACAATTCTTGCGGGAGGCGGCGGCAA
CGTCCATATCCAGGGGAACCTGCGAAATAAATGAGGCGGTTAAGACTGTGGCCACAGGGC
GGACCGCGGGGCAGCAGAGTCGCTCTGGAATGTAGGGGCCTGGGTTTCACCCTCCCACAC
CGGGGCAGCGGGCGGTGAGCTGAGGCCTCTGTGGCTCTGGGCGCCGAATCTCACCCCCGG
CTACAAGCCAAAGCCGAGGGTGATTTTCAACGAACGCCCATTTACTGGATCAACTGCGTA
AGCCTGGAGAAGCCCGTGAGGAGCGACTTACCCGAACACGCCAACGTCGCCACGGGTTCC
TGGACACAAGCGGGACGGCCCAGCGCGGGCGCGAGTATTTATACGTCCTTCCGGCTGGTG
TAGGGCGCGGCTTCGGCGAGGGAAAGTCCGCAGGCGCAGACAGATCACGGCGGGGGCGGG
ACAAGACGCAGCCAACCACAGCCTGCGGGTGCTGTGCGTAGGCAGTCGAGATCTCGCGCT
TCTTGGAGCACTATAAATTGTCCCTTCCGCGGCGCCTCCCTCTTCTTCTTCTTCGGGAGA
ACACGTGAGTCTATGTTGCTGGGACCTGGCTTTGCGGCCTGGGCCGTGGGAATCCGTGGA
CATCCGGACAGACACAGTTTTGGCAGGACCGCACAGCCTAGCGTTCTGCTGATTTCCTTT
TTTTCCTCTTCTTTTTGTCACTAGCAAATGGCGGATGACGCCGGTGCAGCGGGAGGGCCC
GGAGGACCCGGGGGCCCAGGATTAGGTGGCCGCGGCGGCTTCCGCGGAGGATTCGGCAGC
GGTCTTAGGGGCCGTGGTCGTGGCCGAGGCCGTGGCCGTGGTCGAGGCCGCGGGGCTCGT
GGAGGTAAAGCTGAAGACAAGGAGGTAGGTCTGGGCCGCTGGCGGGGCGGGCTGCTCGCC
CCTGCACCGAGAGGCAGCCCTTTGACTGGTGTCTTCTTCCTTCAGTGGATCCCCGTCACC
AAGCTGGGCCGTCTGGTTAAGGACATGAAGATCAAGTCCTTGGAGGAGATCTACCTGTTC
TCCCTGCCCATTAAGGAGTCTGAGATCATTGATTTCTTCCTGGGTGCGTCCCTAAAGGAT
GAGGTTCTGAAAATCATGCCAGTGCAGAAGCAGACTCGGGCTGGCCAGCGGACCAGGTTC
AAGGTTGGTTAAGATTGCTTTTTTGGCCGTGAGGTTGAGCAAAACTCTCTCACTCTGCAT
GGTTACACAAGGTTTTACCCGTGTGACTTTCGTACGGAGAGAGAGAGAAAACGAGTTCCT
TCAGGACTTTGGATTGGCCTCACAGTGGCCTCTCTTGCCTAGAGGAGCACCACAGGTCCT
CTTTGGGATGTGCTGGTGCCATGACCTGTCTCCAGCCATTTCACCTAAGTCTTCTCATAG
GCTTTCGTCGCTATTGGGGACTACAATGGTCACGTTGGTCTTGGTGTTAAGTGCTCCAAG
GAGGTTGCCACTGCCATCCGAGGGGCCATCATCTTGGCCAAGCTTTCCATCGTCCCTGTG
CGGAGAGGCTACTGGGGGAACAAGATTGGCAAGCCCCACACTGTTCCATGCAAGGTGACA
GGCCGCTGTGGCTCTGTGCTGGTGCGTCTCATCCCTGCCCCCAGAGGCACTGGCATTGTC
TCTGCTCCTGTGCCCAAGAAGCTCCTGATGATGGCCGGTATAGATGACTGCTACACTTCA
GCCAGAGGCTGCACTGCCACCCTGGGCAACTTTGGTAGGTATCTCACAATTAACTGTGGC
CTCTCTTAGCTCTGCTGGATCACACAGGTCCAGTGTGTGGTTGGTGTCTTTTTGTTTGTT
TGAGACAGGGTTTCTCTGTATAGTCCTGGCTGACCTGGAACTCACTCTGTAGACCAGAGA
CTGGCCTCAAACCGAAATCTGCCTGCCTCTGTCTCCCAAGTGTGTGCGCCACTATGCCCG
GCTTAGGTTGCATGGCAGACCTGCCCCAAGGTGGCTTCTCTGTTCCTAGGATTGCAACAG
CACCTTGGTGGGCAGGACTCTAATGAAGCCACCAACCCTCTTACTATTTTACAGCTAAGG
CCACCTTTGATGCCATCTCCAAGACTTACAGCTACCTGACTCCCGACCTCTGGAAAGAGA
CTGTCTTCACCAAGTCTCCTTATCAGGTATTCGGATTCGGTTGGTGTGTTTGCCTTTATC
TTATCTGAGTTTGGGGCATGCTGCTGTATACTAAAGTCTTGCTTCTTTTTTTAGGAATTC
ACGGATCATCTTGTGAAAACCCACACCAGAGTCTCTGTTCAGAGGACCCAGGCTCCAGCT
GTGGCTACCACATAAGGGTTTTTATATGAGAAAAATAAAAGAATTAAGTCTGCTGATTAT
TATGTTTTTTTTTGTCTGTCTCCCCCATACATGATACTATGTAGCTCTGGCTAGCCCAGA
GGTTTCAGTAGACTTGTCTAATACAACCTGAGAGGATATGGCTGTGTGCAATTTAGTCAC
CAGAAACACAGTTTATGTCCAAAACTCTTGACTTTATTTTTAGCAGTGGAATGAAGAGTT
CTGGTCACCTAGGCAGCAGCCTCCTGCCTCGCAGCCTTCCTTTCTTCCAGCATCCTCTGC
TTCTGCTTTGCCAGACACTTTCTGGCAGAATAGTAGGCTCCCAGGTCCAAGTCTGGAAAA
GAGATTAGGGAGGGGGGCATGGGGAGCTGTTAAATGAGCTTGGTAAGGTCTTAGAGGCTG
AGAAAACTCAAAACTGATCCCCAGCTGCCTAACAGTTAAATAGGTGGGGAAAGCTGGAGA
GGAAAGGGTTGGCACAAAGCTGGGGGGCTCACAGCGGTCCTGGTAGGCTTTAGTCACTTT
GGTGAACTGCTCCAGTTCCTTGGCACAGTTCTGCTGGTAGTTCTCTCCCTCCCTCTGCTG
ACAAGCCTTCAGTCTCTCCTGGATGATGTTCATGATCTCCTGGTCAACTTTGCTGAAAGA
TTAGGAGAAAAGTGCCTGTCTCAAGAATTTGAAAGGGTAGAGGACTATTAACCTCAGCCC
AGGGAATCAACATTTCAGGAGAGATGGGGTTCCAATAGTGCCCAGTGTTCCCTGCTGCTT
ACGTACAAGTCCCTTCTCCACTGCATCTCAGCCTCATAGATACACAGAACATCACCCTCT
TTGCATTCTGTGATGTCTGGCACTCGACGGTACTGTCGGTGGTAGTAGTAGGTTCGGTTC
TTGGCATGCTGTCGTTCAATAAACTCTGCGGAAGAGAACACCTTGAACCTTGGCCTGTCA
GCTGAAGCAGCTTGAGGCGAAGGGTCTGTAGTCCCAAACTGGCCGGGCGTGGTAGCGCAC
GCCTTTAATCCCAGCAGAGGCAGAGGCAGGCAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1343, 1425..1622, 1860..2193, 2514..2605, 2694..2814
1167..1343, 1425..1622, 1860..2193, 2514..2605, 2694..2771
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved