Mus_musculus Locus Rabggtb
snOPY snoRNA Orthological Gene Database
Mus_musculus Rabggtb
Mus_musculus
Rabggtb
3
SNORD45, SNORD45
1370..1450, 2427..2497
6767
GGTCCTTCGGGCAGAGCGTGGCCAGCTACGTAGGGCGTGGGCGGCCGGGCGGGCGCGTG
TGCGCAGGCGCGCGGGCCCTGACTCCCCGTGCTCCCGCGCGCTTCAGTCTTTCGGCGGTC
GGACATGGTGAGAGCACCGTCGCTGCGGTGCGCGGAGGCAGGGGTGGTCTGGGCGGTGGG
TCGGGCTGCGGGGCATCGCGGGCTCGCACAGCATGGGGAACAGGCGGGCCTGCAAGGCGA
TCATTCTTGTGGGGCCCAGGCTGGCCTGGAGCTCTCCGCAATGCCCCTGCCTCGGCCTCC
TTAGGCCATACTTGGACTGCCGCTTGAGCTGTGTATGGCTCAGCGTTTTCTGCACTTCTC
GAGGCCTGGGATCTTATCCGCGGACCGTGGGCGAGCCTTCCTGGATTGGGCCGCCTGATA
TTTTTTCTTAACATCGGGGACTTGTACGTGCCTGTATTTTGAAGGTTACATGATCATTTA
CGAATGTTGTTTCATAGTTAAACATTTTAACTGGGATGGAAGGAAGTCGGCCTTGGCCCA
CGCCTTTTAATCCTAACACTCTTGGATTAAAGAAGTGAGGCAGAAGCAGGTGGCCTGGTC
TACACAGGGAGTTCCAGACCAGACAGGGCTTCATAGCCGAGACTCTGAATAAAGTAGGAA
ATTTATTTTGGCAATCGCTTTGACCTACTTATTGGGTGAGTCTTAGAATCGAAGGTGGAA
TTTGGAGCTAATGGGTCTGATTATTTAGCAAAGGGGTTAGCATGTGAAGACTGTAGAAAG
GTGCGCTGAAGCCTCAAACTTGTTAAGCAAGAGTGTGTATTTCTGGCATAACTCAAAAGA
TAAGCGTCAAGATTCGGGTCAATGATGAGCTGGCATGTATTCTGAATCTAAAGTTGATTA
TAAACCACTTTAGCTCTAGAATTACTCTGAGACCTGAAAGAAAAAAAGTACTGAGATCTG
GCTATGTGTGAGTCTGAGATGTCACGATTTCCGGATGGTGAATGGGATCTCTGCTTTTTT
CTTGGAAGGGCACACAGCAGAAAGACGTTACTATCAAGTCAGATGCGCCTGACACCCTGT
TGCTGGAGAAGCATGCCGATTATATTGCTTCCTATGGCTCAAAGAAAGATGATTATGTGC
GTATGATTCTTTTTTCTGTTGAAAGGTTTCTAAGACTAACAGCAATAAGTATAATACTTA
CTTGTATAATACTAATTGAGAGGCCTGATTTAAAATGTATTATAGGTGTACCTTGTATAT
CAGAGGTTGGTATTTGACCACATCAGTCATGTGCTGGTACATAAAGGGCGGAAGTGCAGG
GCTGCAGGTAGAAGGGGTTTGCTCATTTCTGTCTGGGGTAAAACCTTGAAGGTCAATGAT
GTGTTGGCATGTATTATCTGAATTCGCTGATGTGTCATAACACTTTAGCTCTAGAATTAC
GCTGAGACCTTGAAAAGGTTTTACCTAAACTTGATGTAATGGTGTGCCTGGGGAAATGGC
CGGGGAGGTTGCCAGCAGCAAGCAGGGGTGGCTGAGTTTGAGAAGGCCCAAGCTGTGGGG
GGACCCTCCAAGGAGGAGTCATTTGGGTAAAAGTATTTGTGCAGCAGCTCTCTGTCTTAG
AGAGCGTGGCATTTGACTGTCTTTACAACTTTTCAGTTAGTGGGAATCATAGGCCCAAAT
GTGTGGCCTTCTTGCCAACTGTGCACCTGGTTCTTTTGGGTTTGGTTTGGCAGCACGCCA
GTGAGGCCTTCACCTGAATAAATGCTTGTGAGGTAATGCTTCATTTGGTTCCCATCTTTA
GCGTCATTTATCTTTCCGTATTCATAGACTTCATTTGTAGAATGCAATAATTGATGCTTA
GTAAACAGTAGGCATCAATACTGCTTTTGGTTAATTCACCTGAGGTTAGCACTTGGAGAC
TAAGAGTATTGGCTCTCAATCTTCTTGCTGCTGTGACCTTTCCTAACAGTTCTACGTGTT
GTGGCGATCTCCGACCATGAGATAACTTTTGTTGCTACTTACTTCATAACTAGTTTCATT
GTTAGGAATCAGAATGTGGGGCCCAAAGGGTCGGCAACCGCCACTCTAAAGCCTTACGAG
TTGTTCACAGCTGACTTAGGTAGAGGTGGGTTATGTAAAGTCAGAGTGGCAAATCTGAGA
TGCTTCTCCTAGGAATACTGCATGTCTGAATACCTGAGAATGAGCGGCGTCTATTGGGGC
CTGACTGTGATGGACCTCATGGGACAGCTTCATCGCATGAACCGAGAAGAAATCCTGGTG
TTTATCAAGTCGTGCCAGCATGAGTGTGGGGGAATAAGTGCTAGCATTGGGCACGACCCC
CACCTTCTGTACACGCTCAGTGCTGTCCAGGTGAGCCCTTGTGAAACCTTGCCACTTGCT
GTGACCACCCAAAGGCTACTTCCCACAGGTCAGTGATGTCATGGCATGTATTAGCTGAAT
GCTAACCTGATGCAAGTTACAAATTACACTGAGACCTTGGAAGGTGAACTCCTTGTGTAT
GTTAATTGAAGCACAGTCCAGTTCAAATTTGGTTTCAATGAAGAGCCAGAGGATAGTTAA
AGCCCTACCTGTTTCTTACCTTATCAAGGGAACAAGAAGTTTATAGTAAGCTTGAGAGGG
CCTGGTGGGTGACTCTGATCCAGGACAAACCTGTGACACCCGCTTGTCTTTCAGATTCTT
ACTCTGTATGACAGTGTTCATGTTATCAACGTAGATAAGGTCGTGGCCTATGTTCAGAGC
CTACAGAAAGAAGATGGCTCCTTTGCTGGAGACATTTGGGGTAAGACCAGATTGCAGTTT
TTGTCAGCTACTCCTACTCAGAATATCTTTTGTCTTGGTGGTAGTAATCATAAGATTTCA
AGTTGTTCCGTCTTTTCAGGTCCCACTAAGCAGTTGGTCTAACTGGAATAAAATGGCCTG
CTGGAAGTCCCAGCATGCCCCGTGCTGGCTTGTCAGCACACCACACTAAAAGATAAGGTA
GGTTCAAGTTTTATCTCCAATAATAATTAACTTCCCTGAAGGTAAAGACCTGGGGAGGTC
TCTAAACGTTTGTCAAATTAGTAAATATCTTGAGTTGGGAGATGGAAATTTTTCCTTTGA
TTAATTTAGATAATCTGGGGGGGAACAAAATGCAGTCCTGAGACCAGCTGCTTTGTGGGA
TGTGAACCTTTTTTAAAGCAGGGCTTTGATTATGTTACTAAATTACTAGCCCGAATGGGG
GGCGAGGCATATACTCCTGCCATTTTATAGGTTCCTTTCTTTTCTGGGCCCTTGCAAGCT
ACTAGGCTATTGCTTTCTATTTGCCTAGCTGGTTTCCTCAGAAGTTGGGGGACTGCCTCC
TAGTGAGCATAGTCAGTCTTGACTTTGGGGAGTTTAATGGGTTTTGTTCTTAGGTGACTT
GGTAGCACTTACATGTCTGCCTTGGCTCTTTTTGTCTTTTAGGAGAAATTGATACAAGAT
TCTCATTTTGTGCGGTGGCAACTTTGGCTCTTTTGGTAAGCTTTGACTGTTGCATTAAAG
GACCGAATTAAACACTTGAGTACTAGGTAGCTGTAATAGGCTGCTTCCTTTCTCGTCATA
GGGCAAGCTTGATGCTATTAATGTGGAAAAGGCGATTGAGTTTGTTTTGTCCTGCATGAA
CTTTGATGGTGGATTTGGGTGCAGACCAGGCTCTGAATCTCACGCTGGGCAGGTAATTTT
GCAATTAAAGTTTATAGGGGTTTTGTGTTGTGAATGGCCACACCTTCTCACTGAGTTTTG
TGTATATGCTGGGTCTACACAACTTCACCCTAAGTAAACACCAGTGCTCCTTATTGGCAT
TTGTCTGTTTATGTGGGGTCTGCATTCTGTGCTGTTAACTGACCTCGAGGCTTACTGTGT
GTGTAGTCCAGGCTGTCCTCGGGGCTTGCTACGTGCTGGGATTGGAGGCATGACCCTGAC
CTTATTCGTACAGATGAACTAACCTTACCCAGTGCAGAGAACATTGTGCATAAGTATAGC
ATTCCACTGTCGCATTGAACCTACTAATACAACCTGAGATAACAAAGATGGAGCTTTAGT
AATTTTGGTAGTGTCTGTCATTTACTGTTAAACTATACCTGTGTACTTTATGTCTGTAAT
TTTAGATCTATTGTTGCACAGGATTCCTGGCCATAACTAGTCAGTTGCACCAAGTGAACT
CCGACCTACTTGGTTGGTGGCTTTGTGAGCGGCAGTTGCCCTCAGGCGGACTCAATGGAA
GACCCGAGAAGGTATTATCTATAGTGGCTCTTTATGCATTCATGGTGCTGTGTGCTTAGA
ACTGAGGGGTTTCTCAGGTATAGTTTTAAGATCCCTTAAGGAGAGAGCTTGGGGTCTCAT
TGACTCTGAATTCATTTCTGCCTTGGGACATGTACAGATACTCAAAAGCGATACTGAGGT
TGGGGGTGGCCCTGCTTTTAGTTTAACCTAATCGCCTGGGAGGCACAGGCAAGAAGTCTT
AGTTTGAAGCTAGCCAGCTCTATTAGGGGGACCTAGTCAATTAATAAATTAAAATGGATT
GTGAACACTTCAAATGTTGCTAGTCTGAGCTCCAGATCTATAATTAGTTACTGTGTGGAG
CTTGCTTTGTGAGAAAGGCAGAGAGAATTATTAGTATGTGCTGGAATTATTAGTGTAGCT
AGCTACAGTGCTGAGGTGGTGTGAGAGACAAATGGGAGGTAGTCTCAGTTTGCCCTACAA
TCATGTCTGGGAACACGGGATTAGACATTAAAAAAAAAAGAATCCATCAAATCTGAGAGA
ATACAATGGTGCAGTAGAGGCAGCTGTCTTACTGGCTCCCCCTTCCCCTTCTCTAGTTAC
CAGATGTGTGCTATTCATGGTGGGTGTTGGCCTCCCTAAAGATCATCGGGAGACTTCATT
GGATTGACAGAGAAAAGCTTCGAAGTTTCATCTTAGCGTGTCAAGATGAAGAGACGGGAG
GATTTGCAGACAGACCAGGAGATATGGTCAGTACAATTCTGGCTTTGCAGTTTTTCATTG
TTGATTGACTTTCATGGTTATAGGCATTTCTAATGCACTAAAAATAGTGCCCTGTAAGAA
ATAGTCCAAAGGTTGTCTTGGGGGTTTACCTTGGGTGTTTTTTTAAAATGTGTTAGTTAC
AAAGGCTAGAGCTGATAGAAATATCTTGTAGTGATAATTGTTTATGTCTAGTATTAGAAA
TACTTGTCTTCAGAAAACTTTTAAAGTGGTATTCAAGATACACTTCACTGTGGACAGATA
GATAATTGAGCCTTTTCCATGTTTGTGAACTTCCCACAGGTGGATCCCTTTCATACCTTA
TTTGGCATTGCTGGGTTGTCACTTCTGGGAGAAGAGCAGATCAAGCCTGTTAGCCCTGTC
TTCTGTATGCCAGAAGAGGTGCTTCAGAGGGTGAATGTCCAGCCTGAGCTAGTGAGCTAG
TCAGATGGGAGAGATGCTGTAGTGTGCAATATGAATTACTGCTGTATTTGAAGTGTTTAT
CAAACCTAGACGTGACTTAATATTTTGTATATCATATGTTAATGATAAATTATATAAGTA
TTGTAAAATAAATATGTTGTATTTAGATCTTTAGTCTTCTGAGTCCAGTTTTTGTTAGTC
CTATTTAGAGCTGGTATTTAACTGATGCCTCCCCGTGTCCTATTGTCGTGTAACAATCAA
TGATGGAAAGTGATTTCTGTTAATAAAACTGATGAGTGAAACTCATAATTTAAATAAAGG
TCAAAATCAGTGGCTGTTGTGTATATAGCTTTTTATTTAGAACTGAACCATTTTGTAAGT
GTGAACACCTTATTTATAGTTGGGGCAGAGGGTACAGTACATTTTTCAGGGAACTCTAGT
CTGCTGTTGGCTTGGATTTCTCAGGCATGCAGTTGAGTTAGCCAGGATCCTGAAAGTCAT
CCCCAAAGAATTGGTCCACTCCATAATGGCTTTAGGTGTTGTTTCGTGATGGGGGCCCTG
TGAGGTGTTAATGTCTCAAGGGTTTGAATGTGGTTACTCTGGGTGGGTTGCAGGTTGGGT
GAATAGTAATGGTATAAATGTAATTTTGACTCTAGTCTATAGCCGCTCCTGGGTCAGTTA
CTAGAGAGGTAACTTACTATTAAGGACCTCTACCCCTTAATATTTAAGGAAGGAAACGTC
TCCCCTCTTTGAGAGTCCTACATTGCACTGGAACTCCACATCTTTAATAGGTATCTCCAA
GTGTGTTTTATGTCTCCTGATTGTTGCTTAAGCATTGCTGTCACCTTGAGGCTACACATA
ACTAATATCGTCTACATGTCCTTAGTGTTCTATTTCTGTAAAGACATGCTGTGACCAGCA
AAGCGACTCTTGAAATTTAGGGCTTGCTTAAAGAGTTTCAAAGGTTTAGTCAATTAGGAG
GGCAGGCCTGCAGACATGTTCCTTGAAGACCACACCTACTTAAAACAAGCTGCTTCCCTC
AAGTTTTCTACAGGGGCTTTTCCTGCTCAAACTACACTCACTACACACTAGTGTTTGCAG
GTACTAGTGTGAATGCCCTATTTGCTGGAGAACATTTATCCTCAGTTCTGTCACCTAGAA
GATGTTTTATGTGTTGATTGTTGAAGAGCTTCCCAAGGGTTTCGAGCAAGACTGTAGTTT
GTTTTTACCCTATGTGCAAAACTGCAGTACTCGAAATAGGACGGTTGAGAAGTGCTGTTT
TTAATTGTTAATGTGGTCTCACCCGTGTTGTGCTCTGTCCCGTACTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1135, 2172..2369, 2694..2799, 3462..3514, 3601..3711, 4145..4270, 4856..5005, 5319..5767
1001..1135, 2172..2369, 2694..2799, 3462..3514, 3601..3711, 4145..4270, 4856..5005, 5319..5456
NM_011231.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved