Mus_musculus Locus Rpsa
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpsa
Mus_musculus
Rpsa
9
SNORA62, SNORA73, SNORA62
1994..2149, 2565..2767, 3629..3777
5786
ctttgttctttttagttttaccgttttatatttatttttgagacagagtatgactatag
cttcaaattcatggtcctcttgccccagcaagaactgaagaaacccagagcctttcgatg
ttagtactctaccacggagctgcacccacactcctctgggtttttgatctattatttttg
ttgtatgcatatatggttatccttcagtatctgtgggatttgttccagaaccacctatgg
atgccaaacccatagatgctcaagtccctaatataaaatggtctgagctgggcgtggtgg
cacacgcctttatttagccccggcactccggaggcagaggcgggcggatttctgagttcg
aggccagcctggtcaataaagtgagttccgggacagccagggctgtacagagaaaccctg
tctcgaaaaacaaaacaaaacaaaaatagtctggtattttctaataaccacaaccctccc
acagactccaagtcatctctagattacttgagacatggaatacagtaataaacgctttgt
aaatagatgacgcatccaaatttctccctgctcccttcaacacttttgtaatatcttact
gggtaactactattttgtagttctcaaatgtaggaaggagccagtaccagaggggcaggc
gggtgtgtgctcctggagttaatcctgacataggtggcccagcttgaagcctattcgtca
ctcagcggaccaaaagctacggactttccacgctcgctcccccccccccactcccccccc
tcgccccagctacttccggcctggggtctgtgcagcgactgcagccgcgcaggcgcgggc
cactttaacttccgctccgcgcgcgctacagcgggcccactcactgaatctgcgcgtgcg
ccagaggctttttccggagcggaagttctccctttttgcttagcctgctttgccattggc
tggctgtgggttatttaaggacgtcatttccggccgcccgtCCTTTCGCGCTACCCGGGG
ACGGGTCCATACGGCGTTGTTCTTGgtgagtctcacgtggagccctcggcgtctccggac
gccgcgggacgcgcgcttactagcttcccgcgccatgggtgggcgcggagggcgccgagg
ctgcgtgtgccggggcggcttggctcctggcggcagcgccacgtgctggcccgcagttag
gtggggcgggcgccactgcggggcccttctgcggttcgcgccacgctcgagggccctgtc
ggcaagatgctgggaaaagtgcttgtgaggcgcatggagatgggacgggaactgccggcc
agtctcgaaatacaactcccgaagcaccccgatcatggccgcctttgcgcaactctcggt
gcaaagaagcagctatacttaagtagctatcctgtagtcagtgtgcctgcggaggcgcta
acttcaactgtccagtttttctatatgtgctctgctgacaaagtcactttccttagtgac
taggtggccagaaaaatcgaaaggcaaggaggaataagaacacaacccatttcagctcag
atgatgtgctgcgcctagtggcatacgcctttagtccccctctcaggaggcagggcaatc
ttgtgagttctagtgtcagaagaaaaaagatgaattttattccttttttagATTCCCATC
GTAACTTAAAGGGAAACTTACACAATGTCCGGAGCCCTTGACGTCCTGCAGATGAAGGAG
GAGGATGTCCTCAAATTCCTTGCTGCGGGAACCCACTTAGGTGGCACCAACCTTGACTTT
CAGATGGAGCAGTACATCTACAAAAGGAAAAGTGACGgtcagttgccacctgtgatagtc
agttcctgactatggtgctctaatgggtatagtgcctggtaactgaatggttggtgttgg
agtgctactctggcttgtgatgtaactaagaggatgtgtgggaaggggccagaggtcatg
gaggactgactgaccctgcacactattaaagctcagagtggaggccagtcttggccagtg
aacttctgagtgtcggaagtgtgctacattgaatttatggcaggattttcgctaacacca
gtagagcttgcctctatgactggagtttggtagtggtcactgccacatgcgtatgcctta
ccttcccacagtgtccattcacaaggctatgaggctagcaagcctgtctgggacacccac
tttaaactacttgttgctgggtgtggtggtttcacaccctttaatcctagtgtttaggag
gcagtcaggagtctgatcagccaggtctgcagagtgactgccagacttcctgccttggga
agctcctcagagagttccgtttgctggcctagGTATCTACATCATAAACCTGAAGAGGAC
CTGGGAGAAGCTGTTGCTCGCAGCTCGAGCTATTGTTGCCATCGAGAATCCTGCTGACGT
CAGCGTCATCTCCTCCAGGAACACTGGCCAGgtttgtggcatgcatgtgcttttgtttgg
gggtcagtaatcgatagagtacattgggcatacaaagcaaagtatccaacgtggacaacc
caggaggtcactctccctgggctctgtcctagtggcataggggagcataggccttgccca
gtgacgtacagtccctttccacggcgttggagatgaagctgggctttgtgcccgcgcctg
catattcctacgacttctcagagtcctgtggacagtgactgaggaggcaaaccatgcagg
aaacagtgctgactcggtggcaaacagagctttgtgttagaggaaattggtgctgactta
agggaaaggcaacgtcagacacaaacaaaatagccaagttaagtctttgttaacatgtat
atcagttgataaaacaatgagatatgaactgttgagatagttttggtacgtggtggctta
aaaccatccatagttctgttcaaggagatccaataccaaaccaccatgtgtgggggtgat
atacttttgtacattgcaggataaccactcctaaattaactaaagaactatccacaaaca
gaggagggggggtgatgagcttgctctgtgttcggataaatttgtcaggtgtttgctgag
tacctgtaactgtcctttggggggcttgggcatgtgagaaacttgagtcaggtgcctcac
actaaggcatcatgcaggtgttacagttagcctaagaatgtgcttcagcacagtactttg
atgctttggtgtttgataggtgactagaagtgggtatcagcagtttcctcgtgaagcatg
catgataatgctgactcaatctcccttcaaagCGAGCTGTGCTGAAGTTTGCTGCTGCCA
CAGGAGCCACTCCGATCGCTGGCCGCTTCACACCTGGGACCTTCACTAACCAGATCCAAG
CAGCCTTCAGGGAGCCACGGCTTCTAGTGGTGACCGATCCCAGGGCTGACCATCAGCCAC
TCACAGAGGCCTCTTATGTCAACCTGCCCACCATTGCTCTGTGTAACACAGATTCTCCCC
TGCGCTATGTGGACATTGCCATCCCATGCAACAACAAGgtacttggtcttgcagagctga
cagaggcactggggaagccttcaccgtcccctgcacattgttagagcttggagttgaggt
cacacgctggtcgatgaactcacaagtgtaggtagtgtgctaaaagagtggcaaggtttt
cgctaacaccccactctggtccagtgagtggggtttgatagtaacctttgctacaaaatt
gatgcatgaactgagcctgtgtgttctcataagtgaatgttaagagatttgttagtgttt
gggggaagggggtcattttgtgtgtgcccagtgtattcctgtacctcgggcaatgagctg
ccatttgggtgtgtggaatctaagacttgggctggtgacatgagtcgggctggcttgtgt
ttaataactatcctccttacagGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTGGC
CAGGGAAGTACTCCGCATGCGAGGTACTATCTCCCGTGAGCACCCCTGGGAGGTCATGCC
TGATCTTTACTTCTACAGAGACCCAGAGGAGgtaaggctttctctagtatatgctggggc
cacaagggatgggcagaccttggttctggttcagtgaagctaattttgtcccttctgtgc
ttttaaaaaactagATTGAGAAGGAGGAGCAGGCTGCTGCTGAGAAGGCTGTGACCAAGG
AGGAATTCCAGGGTGAATGGACCGCACCAGCTCCTGAGTTCACTGCTGCTCAGCCTGAGG
TGGCCGACTGGTCTGAGGGTGTGCAGGTTCCCTCTGTGCCCATCCAGCAGTTCCCCACGG
gtgcgtatcaaggccagggcatcaggctgccagggagcttttacagtgtggggttgtgag
agattggcgaagcttcagtggccatgagtgactctgggtgacttcagtggctcctgacac
tggatgggcgggcgggtggatacactgtgtcttgacactgctcttggggtaatttgggga
aagttatactcctttcctagagctgatgattttttttttgtactttcttaacagAAGACT
GGAGTGCACAGCCAGCCACTGAGGATTGGTCAGCAGCTCCCACAGCGCAGGCCACTGAGT
GGGTTGGAGCCACCACTGAGTGGTCCTGAGCTGCTGTGCAGGTGCCTGAGCAAAGGGAAA
AAAGATGGAAGGAAAATAAAGTTGCTAAAAGCTGTCTTATGGTCCTCactgcagactgta
cctggattggcatttggctatacaacagaggcatggtcctactgacatgttttgtgttga
atacttaagcatgtgaacacatgggttttttttttttttaatgtaaaatgtagtaacaca
atgtttaggtggctttggtgttagctctggagacttcatgtgtcatctaggtgaggtgtt
ctttaacacagggtctctgttctgtcatgcctcatagatccttctacctccagattggag
agggaaaaggcttatgtcactgaacctggccagattgggattttgtgtcccaggaacaaa
gttaatgctaaaaagttaatgccttggtgagactgatagtctgatggtgtgaattcacag
taagtggttgggattgccagatggaattccctgagctgccgtgacaggtggcattgcaga
agtgaaggattcaggaatttgagtgttgggtgggggcctgtgaatagcacttgggctggg
aggggagactgctgcccctgaatgtcctggaattcaaggacagtacctggttaaatgttt
ttctagcttttctaaaaagtttgttaggcctggcattggcggcgcacacctttaatccca
gcacttgggagtcaggcaggtggatttctggcctggtctacagagagttccaggatagcc
agggatacacagaaatcctgcctcaggaaaaaaccaaaaagaagtttgctaaaaataagc
atttttgcttgatggtattgaagattgtaagacattaaattgtgtcattacttctccagg
tactaagcccatactcaccaggggtctcaatgctgtctgctcttaacagttacatggcaa
gcactgctttttacaacaaagagtcaaatagcaaggtttttccttcaggaactgagtagg
ccctacctgcctcctgttgagttgtctcccccgccccccaagatagggtttctctgtgta
gccctggctgtccaggaacttaactct
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1044, 1671..1836, 2372..2490, 3332..3577, 3982..4110, 4214..4379, 4614..4786
1704..1836, 2372..2490, 3332..3577, 3982..4110, 4214..4379, 4614..4708
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved