Mus_musculus Locus 2810026P18Rik
snOPY snoRNA Orthological Gene Database
Mus_musculus 2810026P18Rik
Mus_musculus
2810026P18Rik
9
SNORD50, SNORD50
2006..2077, 2274..2345
3819
AACTGACAGCAAATGCACACATAATTAGTAAAAAATGCTACAAAATAAAGACCCGAGCT
TCCAAGTGCTAAAATATCCAAATGTGTGTATCCATACATTTAAATTACTTTGAATTATAT
ATTTGACCTTTGAAGTCTTAAGTTTTTTTCTGCAGATAATTTAGAAGGGAGAAACTTAAA
AAATAGCAAAGGATAGCTATGTGACCTTAGGCCAACTGGCGGCTTTTGACTTGCTTTCTC
CTCTGTGAAACGGAATGTTTAACTTCTCAGCATTCTGACAGTATAACTGTCACTAGTGTC
TGTTTCCCGGAGTGGGAGACTTGGGGGGGCGGGGGAATCTGGTGTTGGACCTGGTTGAGC
GCCCAAGCAGGCGTTGGATAAGCCTGCACTGGACAGCATGGCTGTCTGCAGACCAGCGGC
ACCCCCAGAATGCAGGAAGGATAAACGGAGAGCTTTTCGGTTTTCACCCGCGTAATTCTG
TCCTCCCAGGTCCCTTCGGCTGCCCCGCTGAATACACAAGCGCAGCGCTGGCCACCGTAG
CAACCAAGCTTCTCCACCAGCGGCGCTCAAAGCTGCCTGCGCGGCGAAGTCAAGGCCACT
CCCTGCCGCCGACCGTCCGTGTCGACTAGGCTCGAAGCAGGCGGTGACCTCGCCTCCAAC
TGCGGCAGTTCGTTTGAATTCTGGCGCCACTCCCACGCCACGTCGAGCTGAGCCACCCCG
CCAGACTCGGAAGAGACCGGTGGCGGCGAGCCAGCGGGAGCGCGCGCAGCAACGGAGATG
CACGCGGCGGCGGGCGGGCGGCGCGCACCACGCCCCGGAATGGCCTGTAAAAAAAAAAAG
AGGTCCAAGGCGCGCGCTCCCACGCGTTGCTTCATGAAAAGCCACGCCCCCACGTACTCT
CGCGTCCAATCAGTGACAGAGGGAGGGGCAGCCTCGATCTCGCACAAAGGAGACTATAAA
AGGAGCTGCGGTGAACCGGGCTCGTTCTTTTACGACGGAGCCTAAGATATTCTTTGTCTT
GTCGGTGAGTGAGTTACAGTCGGATGACCAAGTGAAATATAGGGGTGCAACGAGGATTTG
GAGGCTTCTGAGACTTGAACTTAGGGTACTGGTGTAAACTTCCTCGGAGAAGTGCGCAGC
AGCTAATGATATTTCGGGATTGGAGTCTGGGCCCCAGTGAGATTCGTACTAAGCGGCCTG
ACTGAAGGCCGCATGCGTTCTAGTTCCTGAGTCCCCGCGTGGGTAGGTTTTTACAGCAGG
GTTTGCAGCCTTTTGTGCTGTTCCGAAGGTACTAGAGTCACCGAAAGAGACATCCTATTA
TATGCACGTTCACAAGGACAATGGCGCCATTGTTCTTCGCGTCTTCAAAGCAGCTACAAG
AAGAAACCAAGGTAAAGGCGATGCAGCTTCTATATTTTAAGAATATTGTTATAGTGCAAT
AGGAAGTGATGTGTGATGCTTAAATTTTGTTTTTTGATTTTTCATTATATTAGATGGAGG
GGAGCCCAAAGCATCTGAGAGAATTGATAAATGAAAGAAACATGCTTAAAACATGACCGT
TTTAAAGGGTGTGTATTGAAGCCTAGATTTTTTCCCTTGTAAGCATGCAAACATACCGTT
GTGAAGTAAGAATCCGGGTTCCTGGAAATGTATTGTGAAGTAGTCCTGGCCAAACTACTC
TGGCCTTTGCAATTTGGAGTGACTGTTGTGAATGCATGGTGTACAAATTGATTGTACAAA
CAGTTGTGAGACATACCGGGTCAGAACAGTGATGAAATACATCCCGAAGATGATGACCTG
AAGATAAATGCAGCTTCTGAGAGAAGACCATTGTGTTTAAGTGGTAGTCTTGTTAATGCA
GTTCTTACTCATAGCATGTCATGGTACCTCTTTCTGTAGTGAATGCTGACCAGTGAGATG
CCAGCCTGCGTGTGAAGATCCTACAGCAGAAGTGCATGTGAGTGGTGCTCTGTTTTGTTT
TCTGCTGAGCTTACTGTCGTTGGTCTAGTCTATGATGATCCTATCCCGAACCTGAATTCC
TGTTGAAAAACCATAATTACGGATCTGGCTTCTGAGATGGACCATTGCAAAGGACTATTG
TGTTCTTCTTTAATGTTGGCAATGACGTAATGCCTGTGTTTTTGTTTTTATATTTTAGGG
CCAGTGACACAAGAACTTGCGAGAGATGCCAGTCCGCCTGTGAAGATCCTGCAGCAGGAG
TGCATGTGAGTGGTGCTCTGTTTTGTTTTCTGCTGAGCTTACTGTCGTTGGTCTAGTCTA
TGATGATCCTATCCCGAACCTGAATTCCTGTTGAAAAACCATACTTACGGATCTGGCTTC
TGAGATGGACCATTGCAAAGGACTATTGTGTTCTTCTTTAATGTTGGCAGTAACATAATG
CCTGTGTTCTTATTTTTATATTTTAGAGCCAGTGACACAAGACGTGCGAATGAAAACTAG
ATGTGACCATCCAGAAAAAGCATAGACAAAAAAATGCAGTCTTAGTACTGGGATGTTTGA
GATGGGGTCTATCTACATGTCTCTAGCTGTCCCTATCAGGACAGCATCTGGTGTGGCCTG
CAGAGTTGATTCCTGTACTTTTTTTTTTTTGTGGGCTGTATGTAAATGGATTGTTTTGAC
AATCCATTCGACAGTGTTCTCTTCTGTGAAGGTCATAGGTGAGCTGATTGACAGACACAG
CTGTACAGACTGAATGCAATCCTGACTATAAAGCTGCAGTTCATCATTATGAGCTATTTC
CTTATTCTGGCAGTGATTGAAATAAAATGGGGAGTATTGAAATAAAAAACATTCAATTGC
AAATATTTATTCAATTCTTTTTGTGTCAGAAGATTAACCAGAGTGCCCTGGTACATGGTT
CATTCCACTTCTGTGGGAATTGGGTTTGCAAAGTTACTGTGCAAAGCGCACTGTCAGCTC
CCAAACTAGCTAGCATGATCATACACATTATCAGGTTTCCCTGAGAACTTGTCAAAAAAT
TCCCTCCCTACCCATTTCTTAATTGGGGGGGGGGGTTCTAGACAGGGTTTCCTAGCCCTG
GCTGTCCTGGAACTCTAGACCATGCTGGCCTTGAACTCAGAAATCCACCTGCCTCCCCAG
TGCTGGGACATTTCTTAATTTTGAGACAGTTTCTATGTTCTATGCTTGGTTTGTCTTTAT
TCCACCTGCCTCTGCTTACCAAGTACTAATACTAAATGGGCTTCTACATTAACTGCTGCA
CCCTTCCATTCTCCTTTGCTTATGGGCTTCTGTTTTGATACAGTATCTCAAAATTGTCCT
AGCACTCAACTGCAGAGATGGCAGTCCCCAGTTTAGAGATAAAGGAGATCTAGTCTTCAC
ACTTAGCAGAGGGACTCTGGTTTCTTTCCCCCTGTACATGTTATGTCTTCCTGGTGCCAT
TGGTGAAAGAACCTTGCTACCTTTGAAAAGTGAGTTGGTTGTTATAGTCCAAATTATTGT
GTATGCTCTAGATATTACTGGTCTGCCAAGGAGCCCAGAGATGAACTGTCCATTCTCTTT
TGGAGGACAGGTATAGAGTGACAAAAATGGAAAGCAACCTAATAGAAATGGGGAAACGCA
AGTGAGTTTTCTTGGGCCCTGAAGTGGTAAACACATTTAACCACTGAGCCATCCCATCCC
CCATCATGACTGGGTGATTTGTACCTGAACAAGAAACAAGACCAAATGACATCGTTTTAG
TGGAAAATAAAATTCATTTCCATTAAATTTACTAACTCAAACCTTTTTAAACAGGCTGGG
TGGCATTTTTTTCACTAAGCATGAGGAACTAGCCTAGTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1390, 1493..1567, 1899..1956, 2158..2224, 2426..2819
1340..1390, 1493..1552
BC032970.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved