Mus_musculus Locus Rpl4
snOPY snoRNA Orthological Gene Database
Mus_musculus Rpl4
Mus_musculus
Rpl4
9
SNORD18, SNORD16, SNORD18, SNORD16, SNORD18
2675..2742, 3050..3148, 3498..3568, 4288..4386, 4750..4820
7143
TGGCAACCCTGTGGGTGATTCTGATGTGAGTCGCTGACTTAGATTTTCACACAGGATGT
AGAAGTTGACAGAATTTCACTGAGGGAACACAGTGAATTTGTGGCACGGCTCACGCCTCT
CATCTCGGCATCAGGAGGCTGCCGAGGAGGGTCGATGCGGATTCTGTCCGTTTCTGAGCT
TGAGGCCCGATGACATCTAGCTCTCTGTGTCCCAGGAGCCTCTACTTAGAAGCGTGTACA
TCAGTCCAATCCGTACACTGCTTTGCCATCTTGCCTCCCTTGGGTAAGCTCGGGTGTTTT
CTCCGGAGGCCGGCAGTAGCCTAGGCCTCCGCAGAGCCCTGGCTGCCTCTCACATCCCAG
GTCCAGGAAAGCCGGCAGCCAGCTGTGGCAAACACCACCGGCAGGGGAGGGACAAGTACC
ATCCCATTCCCCAACCACAACTCACTGCCGGAGACGAGCATAAAACTCCTCCGCCGCGCG
GTTCATTCGCGACCACATACCGCCGTGGCCTCCGTCCATTGCTAAGAAGTTAAACTGAAC
TGCGCGCCCAGACAATGACGTCAGAGGCCATGACCCCGCCCCGCCGGAACTACTTCACGC
TTTAAGTTCGGTTTGTACTCAACGCTAACACATTGCTTTAATTTAGTAGAGCATCCCCTC
AATTTACTATTCCAAAAGTCTCCCATTTCTGTTAGGGGGGAAAAAATGGACTAAAAGAGA
TGTTATGATGAGGGTGGGCGGGATGAGGAGAAAGATAATTCTCGCGAGAGTTGTGACGAG
TTACGAATTATTCCGCGAAAAAGAGTCCCTCCTTTCTAATCACTCTTTTTAACTTTAAAA
AAAATGAATACATAATTTTAACACACGTCACGCAATAATATTACCTTTTGAAATTTTTAC
ATGTAGCAGAAAGATAGATCGTGTCTCTAATTTGATTTTGATAAGGGGCAGGATGCGGAA
GACGAGTGGAAGGATATATAGAGTACAAGTGACAAGTCTTTCCTTTTCCTGTGGGAGCAG
CCGGGTAGAGAGGAGCGTGGCCTTCTCCTCTCCCCGTCATGGTGAGTGGAGGTCTTCTAC
ACTGGGCTTCCCCCTGGTCTGGGGGGCGGCTATAGAGGAGGGCGAAGGTTCAGAACATGG
AATCTGCAGAGAGGAGACGAGGGAAAGGAAACCTAGCACCTTTTCTGGCCGGAGCTGAGT
TGTGGGCGCTGAGGCAGCCATCTTAGAGGCAACGTGGGCAACAGCGCCAGGTGGATGGTA
GAGGAACCTTTGGGATCTTAGCTTTTCTTAGTTCTAAGCTTTGCTTAGTTCTAAGCAGGG
TTGCTGGAAGCCGAGCGTTTTGATGCCAGAGACTTGTCAGGGGTTCGAGATCGTCCGATG
ACAACTCCGCACAGGCCGTGGCGGGTCATGTGCTTTCAGTCCGGAGAAATTGTCTTCAAA
GAAAAGGGCTGAAGGATATCTGAATTTATGCTTTCCAGGAAGATTGCCTTCACCTCTTTA
AGACAATTTCTGGAAATGCATGTCTTCGTTACTTTATATGATGTAATCTAGACCTTTGAA
TCTTAAGCGAGTTTTCAGTAGTAATTAGTATATTGTTTTACCACGAATGTTTATCTGTAG
ATGGATTAAGGTTGTTCTGACCACAGTAATTTGGAGACTGTTAGATTCATCGTTAAACCG
ACTAGATAGGTTGTCCTATTGTGAGACGACTTAAAGGGGGGTATAGTAGAAGAGATGGTA
TAGTATCTGGAAGGGCACATGGGAAATAGGTCAGACCTAAGTGCTGGTGGAATCCTCAGT
TAAGAGTCTTTCAGAGTATCAAAACGTTTCTGAATTTGAAGGGGTCTGGAACATTGGATA
AATGAGCAGGCCAGCTTTGCTGAAGTTGGTGAGGGTAGAATTAATTTAACATGTCCTCAT
TAAACAGTATCTATGAACAGTTTTTATAATGTTGCTTCCAAGTTTGTTTCTCATTAAAAT
TGATAGATTTTCAGGTTGTCCTTTTGCTGTAAAACTATTGAAATGATAAACCCAGTGGTG
GTTTACTGTGTTGCTTGAATTTGGGGTCTCCTGCAAAGCAATACTTGCCTCAAACTGATT
CCACAGATTGGCCTGTATATGGCCTCAAATATTGGGACTTTTACTTCTGTATTTACATAT
TTGTCTCCAGATATCAAGCTCTTGACATTTAATTATGGGATGAATGTGTCTCCAATGTTG
TCAATATAAGTACTCTTGATTATTTTTAAGTGAATCCATTATTATTATTATAACATTATA
TGGTTTTATTGGCATTGTATTTCCTGTCTCACACAGTTAACACCTGCCTTCCTAGTCCCC
AGGGAGTCATATCTGTTTGCAAGTACTAATAATGTGGGCTTTAAAATCTAGGTTTCAAAT
ACAGGAGATGGTACTTCCTCTGTTTTAGTTACTTTTTTTATTCCTTCCAAGGCTTGTGCC
CGTCCCCTCATATCGGTGTACTCCGAAAAGGGAGAGTCATCTGGCAAGAATGTCACTTTG
CCAGCTGTGTTCAAAGCTCCCATTCGACCAGATATTGTGAACTTCGTTCACACCAACTTG
AGGAAAAACAACAGACAGCCCTATGCCGTCAGTGAATTGGCAGGTATGGATTTGCATTCG
TCATCATGGTTATATACTTTCCAGGGCTCCTTTGCAGTAAATGATGAGATTCCATTGGTC
CGTGTTTCTGAACTACATGATTTTCCTTGGCTATTCTGATACTGCCTTTATCATGCATTA
GTTTTAAGTCATGGGTTTGTTATGAGTTAGTTCCTAAACCTTTTGTTCTTCCCAATTTTA
GGTCATCAGACCAGTGCTGAGTCTTGGGGTACTGGCAGAGCTGTGGCTCGAATTCCAAGA
GTTCGAGGTGGTGGGACCCACCGATCTGGCCAGGGTGCCTTTGGAAATGTATCCTTGATT
AGTGCTCTTGGCAACTGACCAACTGGACTTAGGCTAATTAATATTTGAATCATGTTTAAA
CATACTAGAGTCTCTCTAGACAAAAATCTGGAGATGTTTGGCTGGGAACTTGCAGTGATG
TCGTAATTTGCGTCTTACTCTGTTCACAGCGACAGTTGCCTGCTGTCAGTATGCTGGTTC
AGAAGGTTGACGAACATTGTTACTGAGCAAGTAGTAATCTTGTTAATTTTCTAAATTTGA
AAAAGATGTTAATTCTTGACAAAGAAAACAGATGTGTCGTGGGGGACGCATGTTTGCACC
AACCAAAACCTGGCGTCGTTGGCACCGCAGAGTGAATACAACCCAAAAACGATATGCCAT
CTGTTCTGCCCTGGCTGCCTCGGCCTTACCAGCTTTGGTGATGTCTAAAGGTCTGATGCT
TTGATATGTGACATTTAGTTTTAACTTGTACCTAAGTAAATTGCTTTCATGAATTCTGTT
TCTCTCTGCCTGCTAAAGTCACTTATGCTTACATCAACATAGTAGGCTCTTATCACATTC
TTATAATGTTCTTGACTGTCAAAATGATGAAATTCCACTTAATGGTCCGTGTTTCTGAAA
CGCATGATATTAGTGGAAATTCTGATTTGGCGCAAATTGCATGATGGTTTATTTTGAGGT
GTGGTGCAAAGTGAGACATCTGCCACTGAAAGCAGAGACAGTATCTTTTGAGTTCTGGAA
CAGTGTTTCTGGGGGGAAAGATGAGACTTTGCTGTTAAGTATTAAATTGGTTTTGTTAGG
TCATCGTATTGAGGAGGTTCCTGAGCTGCCGCTGGTGGTTGAAGATAAGGTTGAAGGTTA
CAAGAAGACCAAGGAGGCTGTTCAGCTGCTCAAGAAACTCAAAGCTTGGAATGACATCAA
AAAGGTAAGCTCACCATATACACTGATCTTCCATACTGGCAGATTTGGATTCAAAGGATA
AGTTGAGGTTTAATGGGTGGGTGGCTTCAGTTTTTATTGGATATAGAAACTTCCTTTCAA
AGAGCCAAAGTAGCAAAGATAGGGGTGGTTGCGTTAACCCAAGTTCCCTATAGGTAACCT
ATCCAGTGTAGATGGCGTTTTGTAGTATTTAAAGGAAGATGGACATGTAAATACTTTTTT
GGTGTTTCGAGACAGGGTTTCTCTGTGTAGCCTTGGCTGTCCTGGAACTCACTCTGTAGA
CCAGGCTGGCCTCAAACTCAAGAAATCTGCCTGCCTCTGCCTCCTGAGTTCTGGGATTAA
AGGTGTGTGCCACCACTGCCTGGCTGTAAATACATTGGAGAGAAGTCTTGCTGTCTTTTG
GGGGGGGTACAGAAAGGGCTTTTGGGCTTGCAATGATGTTGTAATTTGCGTCTTACTCTG
TTTTCAGTGACAGTTGCCTGCTGTCAGTAAGCTGAATCAGAAGGTTGACGAAAATTATTG
CTGAGCAGCTCAAAACTTTAACTGAGATTTGAGACTTGAAATGGTAACAGAAAGTTGTGA
ATTTCATGGATAAAAGTGTCAGGTGTGGCTGCTGAAAGTTGCTTTGCCTGCTGAGACAGT
TTTTCGTTTTGCTAAGATTGAGGATGTGGGAAGTCTTGATCAGAATACTAAAGCTACTTA
CTTTATAGGTCTATGCCTCTCAGAGAATGAGAGCTGGCAAGGGCAAAATGAGAAACCGAC
GGCGGATCCAGCGCAGGGGGCCCTGCATCATCTATAATGAAGATAATGGTATCATCAAGG
CCTTCCGCAACATCCCTGGTAAATCCTTGCACGTGGTTTAACTGCCTATTCTGTGCAGGC
TCACTTAGCTTGGTTATGATGAAATTCCACTTCATGGTCCGTGTTTCTGAAATAACATGA
TATTGTGGAAGTTCTGAGTCCTACGTGAGTGAGCTACGCCAGCCATGATGGCTTGAGCTT
CTAAGTGCCCTAGGTAGCTTGAGGAGCCATAGAAGTTGTATTTCTCCTGTTGGGCATGCA
GGCTTCCTGATTCTGCTTCCTCTTAAAGGTATTACTCTGCTTAATGTAAGCAAGCTGAAC
ATTTTGAAACTGGCTCCTGGTGGGCATGTGGGCCGTTTCTGCATCTGGACGGAGAGTGCT
TTCCGGAAGTTGGATGAGCTGTATGGCACTTGGCGGAAGGCTGCTTCCCTCAAGAGTAAC
TATAAGTGAGTTTTCCCTTATTTATTACACGTCAATGACTAATGTGTGCACTAACATCCT
CCATAAGTTCTGCATTCACATTTTGTTTGCGTTTTCCATTGTTTGGATGTGCCTCACCTG
TGATTATTAAATGAAGATGTAAAGGTTTATTCTGTATCTGGAGAGTTGAAACATTTAAAT
TAAAATTTGTACTGCTTTGTGTTCAGTTAGAGAATGAGACTTTGGACTTCTCTCTTCCTT
CCCCCCAGCCTGCCCATGCACAAGATGATGAACACCGACCTTAGCAGAATCTTGAAAAGC
CCAGAAATCCAAAGAGCCCTCCGAGCACCACGGTAGAGTTTTAAAACTTAAGGTCTAACA
CTTGATACGACCCCTTGACTATTAAAGGGATACATGTTGATTAATGAATGCTACCTCTTG
ATAGCAAGAAGATTCATCGCAGAGTCTTGAAGAAGAATCCACTGAAGAACCTGAGAATCA
TGTTGAAGCTGAACCCTTACGCCAAGACTATGCGCAGGAATACCATTCTTCGCCAGGCCA
GAAATGTAAGTCAGTTTGGCGTGTCAATTTTTTTTTTTTATTAGATTGCCCCCTTCCAAG
ACAGGAACTTACTATGAAGACGCTGGCGCCCCCCCCCCCCCCAACCACACACACTTGTTT
CTACCTCCCCAGGTACTGGGGTTAAAGATGTGAACCACGATGCGCTCATTGAAGATAAGA
TTCTTAATTTTCTATTTGTTTTTGTTGCAGCACAAACTTCGTGTGAAAAAGCTGGAAGCA
GCAGCTACTGCACTGGCAACCAAATCCGAGAAGGTTGTTCCAGAGAAGGGGACTGCAGAC
AAGAAGCCAGCGGTAGGCAAGAAAGGAAAGAAGGTGGATGCCAAGAAGCAGAAGCCTGCA
GGGAAAAAGGTGGTTGCCAAGAAACCAGCAGAGAAGAAGCCTACTACAGAAGAAAAGAAG
CCAGCTGCATAAACTATTAAAAATTGTTAAATTCCAGAGAGCAAGTAGAGACCGCATATT
TCAATAAATCAAACATGTGGTGACAAACCCTTGTGTGACTCTTAAATTGTGGATGTTTCC
AAGCCCCTTGAAATTAACCTTTTGAAGAACAAGTGGCAAGATGTGAGACTTCATGGTCAA
ACTTAGGTCATCAGAATTATAGAACAAAATTTTTTAAATAAAATTTCATTCTCTAGGCTG
CTTTGTTCCACATGGTAGTCTACTTTATAAACTGAACTTGGGATAAATAGCTAGGGGCCA
AGTCCTATGAATAGTGTGTAGTTATGGTAGCCACTAGAGGGCCTATGATGGTAAAAGGGA
ATGGCGGGACCACCACAGCTATGGCCACTGTGTCTGTAGAGGTGCAGTGTTCTTTGTATG
AATCAGTCTGATCATCCTAGAATTATCATCGTTTCCTCTTGCCTTGATGTTAAAACTGCT
AGCAGATAATGATGAGCGTGGGTAAAAACACTCCCTGAGACAAGGCAGTTCCTAAAGGTT
AGTAGCATTCCTGTCCTTACTAGGCTTAGGTATTTTGGGTATTTTGGTTCCTGCCTGCAT
AAGTAGCCTTTGCAGAGATTAAAGTCACTTGGAAAGTAGGTGACAGGGTGCTGAGATGAA
TGCTATCCTAAAGCCTGTGGGGCCAATTTACTGTGAGGGATTACCAAGGGACTGAAGAAT
CTCCATGCTCTTTGGGATTCCACTTTGTTTTCAGATCGTGGGAGCTAAGCCCCTACTGGC
CCTTCAGAAAACAGCTACGAGAAAGTAAGCCCTCAGCCCGGCGCTGGTCTCCGCAGTCGG
CGGTGACGTCATCACCGCGCGCCTAGTAGAAGGCAGCGCCCTAAGGAAGTGGAAGGGGAT
GTTGAGTCGACTGCAGGAGCTCCGCAAGGAGGAGGAAACCCTGCTGCGTCTAAAGGCGGC
TCTACACGACCAACTGAACCGCCTCAAGGTGAGCGTACAGCTTTCCAGCTCTAGCCCCTC
GGGACGTCGACGGAGCGCGGCGGTACAGCTCCAGGCCGCTAGGTGTTGAGCAGGTTTAGC
TCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1060, 2451..2622, 2821..2927, 3211..3349, 3719..3843, 4568..4697, 4948..5104, 5348..5431, 5524..5644, 5850..6143
1058..1060, 2451..2622, 2821..2927, 3211..3349, 3719..3843, 4568..4697, 4948..5104, 5348..5431, 5524..5644, 5850..6068
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved