Mus_musculus Locus Hspa8
snOPY snoRNA Orthological Gene Database
Mus_musculus Hspa8
Mus_musculus
Hspa8
9
SNORD14, SNORD14, SNORD14
3308..3393, 3720..3805, 4473..4562
5924
TAGCTCACCCACAAAGGGACAAAAAACATTTATCTTTCGTACATTTATTCCATTAACTG
ATGAGTCTGGTGGAGCAGAGAGGGGACAGAGGTCACGCTGTCCCCTGTGGGACAGCGGAG
GTGGGGAGGGGCGTTCGGCTCAGGGGTAAGCAGAGAGGACTGGGCCATTTCTTTGATAGA
GGATCACAAACGATCCTGGGGACATGTGGCGAGCCAGGCAGATCGAGCCTCCGCACTGGG
GGGGGGGGGAATCGAGGTGTCCCATTTTGTGGGGGGTGAGGGGTGGGGAAAGCCAGCGAG
ATAGCGCGGCGGCTTAGCCTCCCACAAGCTGGCAGCACGAAACAAGAAGCCTAGCAGTGC
TCCTTAGTCTCAGGCTGGGGTGGACCAAGCCCGAGGCCGGGAAACCGCCGGGCTCAGGGA
GAAGGACCGAGGGTCGTGTGGGGGAGGGGCGCAACAACCTTCGCAGCCATTTTGTCCTCG
CCCCACTTCCGTCTTCTCTTCCCGGACTCCCCCTCCCTCAGGCTCTTCTCTCAGGCAGCC
CGGGGTCCCAAGAGGTAGGGATCCGGCCGAACGCTGCTCTCATTGGTCCGTCGCGGAGGT
ACCCGCCTTCCTCCCAGGGCATCCTTCCGCCCCCTCCCGCCTGCGCTGCCGGGTCGCGCA
CGCGCACTCGCCGGCGACCCTCTCCCCTCCCCCAGCAGCTCTGAGTGACAGAGGACTCCC
GCGCGCGGGCTCCCGGCGCCCCGCCTTCTCCGCTCCCCCCGGGCCGTTCCCAGAGCGGGG
GCGAGCGTGAAAGTTCCAGAACGCCGCGGTCGTGCGTCATCGCGAGGCGGGGCGGGGAGA
AGGCGGGACCTAGGCGAGCGTTCTGGCTCTTCATTAGTGCAGTCGGCAAGGGCTGGTCGT
CCATTGGCTAAGAAGCTATGATCGGCAGCGGGATGGGGCGGCACCCTTCTGGAAGGTTCT
AAGACAGGGTATAAGAGAGAGGGAAGCGGGCGGAAACCGGTCTCATTGAACGCGGAGGCA
GCTGCCTGGCATTTGTGTGGTCTCGTCGTCAGCGCAGCTGGGCCTACACACAAGGTGAGG
CATGGGACTCGGGGGTTTGCGGGGGTCCGGGGTGGTGCAGGAGTCCCGGGGAGTCTCTTA
GGCGGCGGCTGCAGCTCAGGCCGTCACCACCAGGGACAGAGACTGCAGCAGATCCGGAGG
ATGGGCTGAGTCAGGGCGGCGCCGCCATGGCCTTGTGGCTCCGCGTGGCGGGGGAGGGGA
GCCACAGGCGCCCTGGTCTTTTTATCCTGTCTGTGACTTCAAATATAAGGCTTCTGCCCG
GCGCCCACAGGGCAGGGCCCCCCGAGGTGGGAAAGGGGGATCCTGGCTCCCGCGGTGCGC
GGTCCGGGTGGGGGGGGTTCGGGGGGCGCTCGGAGGTGGCCACGTGCTCCACCATTGTCG
CAGACCTTTAGGACAGATGGTTCCTTGAGCCTTGGGCGGGCTGTGCCAGGCTTGGCACAG
ACCACCTATACTGCAGCACTGCTGCCACGAGCCTGCCGCGTGGCTTCAGGTGATAGGTCT
GGGTCACCAAGTCCAGACCCACTGCGGACTGGATAAAAGCCGGAAAGCGAGTGCTTAGCC
CCCCTCCTTTTTTTTTCTAATAGCAACCATGTCTAAGGGACCTGCAGTTGGCATTGATCT
CGGCACCACCTACTCCTGTGTGGGTGTCTTCCAGCATGGAAAGGTGGAAATTATTGCCAA
TGACCAGGGTAACCGCACCACGCCAAGCTATGTTGCTTTCACGGACACAGAGAGATTAAT
TGGGGATGCGGCCAAGAATCAGGTTGCAATGAACCCCACCAACACAGTTTTTGGTAAGTC
GCCAGCATCTTTGTGCCACTAGCATGAGTAAAAGGGCTGGGGGGCAGGGCATTTGGAATG
TAGAAACAGATCTGCCTTAATAACTGCAGCCTGAGATTGCAACTGTTTAAATATGACAAT
ATAAGGCCACAAGATTTTAAATATGGGCCTTGGCTTCCTGCACTAGAGATTACGTCCATC
TAGATGGGTGCTGCAGGTTTTTGTTTTCTGTTTTTTTGGTTTTTTTTTTTTTTGCAGTGA
TAGGCACTAAGGAGTGTGATGAGGTATGTTTAATATTTTACAGATGCCAAACGTCTGATC
GGGCGTAGGTTTGATGATGCTGTTGTTCAGTCTGATATGAAGCACTGGCCCTTCATGGTG
GTGAATGATGCAGGCAGGCCCAAGGTCCAAGTGGAATACAAAGGGGAGACAAAAAGTTTC
TACCCAGAGGAAGTGTCCTCCATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCGTAC
CTCGGAAAGGTGGGTTTTTTTTTTAACAGGTGCCATTTGAGATGGGTGTTACCTTTATGT
TTAATTCACACATTCTGATCGGGAATTTGCCAACCAAACAATTGTGCAATTCATTGTTTT
TTAGACCGTTACCAACGCTGTGGTCACAGTGCCCGCTTACTTCAATGACTCTCAGCGACA
GGCAACAAAAGATGCTGGAACTATTGCTGGCCTCAATGTACTTCGAATCATCAATGAACC
AACTGCTGCTGCTATTGCTTACGGCTTAGATAAGAAGGTAGGCATTTCAAATCAAGTACA
ACTTTGTTAGGGTTAACTTGCCAGAAACAGGCCTGAGCTAAGAATGTCTTATTTGACAGG
TCGGAGCTGAAAGGAATGTGCTCATTTTTGACTTGGGAGGTGGCACTTTTGATGTGTCAA
TCCTCACTATTGAGGATGGAATTTTTGAGGTCAAATCAACAGCTGGAGACACCCACTTAG
GTGGAGAAGATTTTGACAACCGAATGGTCAATCATTTCATTGCTGAGTTCAAGCGAAAGC
ACAAGAAAGACATCAGTGAGAACAAGAGAGCTGTCCGCCGTCTCCGCACGGCCTGCGAGC
GGGCCAAGCGCACCCTCTCCTCCAGCACCCAGGCCAGTATTGAGATTGATTCTCTCTATG
AGGGAATTGACTTCTATACCTCCATTACCCGGGCTCGATTTGAGGAGTTGAATGCTGACC
TGTTCCGTGGCACACTGGACCCTGTAGAGAAGGCCCTTCGAGATGCCAAGCTGGACAAGT
CACAGATCCATGATATTGTCTTGGTGGGTGGTTCTACCAGAATCCCCAAGATTCAGAAAC
TTCTGCAAGACTTCTTCAATGGAAAAGAGCTGAACAAGAGCATTAACCCCGATGAAGCTG
TTGCCTATGGTGCAGGTAAATACATACAGCCTTTATAGTCTTTATAATCTCAACAAGTCC
TGTAAGATTCGCTGTGATGATGGATTCCAAAACCATTCGTAGTTTCCACCAGAAGTACTG
TGTTGGCTAGTTCCTTCCTTGGATGTCTGAGCGAATGAAACATACATATGTTGAGTAGAC
TGCAGTTACAGTGCGTTGTTTCTAACATTTTTTTTCTTTTTATAGCTGTCCAGGCAGCCA
TTCTATCTGGAGACAAGTCTGAGAACGTTCAGGATTTGCTGCTCTTGGATGTCACTCCTC
TTTCCCTTGGTATTGAAACTGCTGGCGGAGTCATGACTGTCCTCATCAAGCGCAATACCA
CCATCCCCACCAAGCAGACACAGACTTTCACCACCTACTCTGACAACCAGCCTGGTGTAC
TCATTCAGGTATGTTGTCCCTAGAATTTTGTAGCTTGTATAGAAAGCCCAGGGAAGTTCC
TCGCTGTGATGATGGATTCCAAAACCATTCGTAGTTTCCACCAGAAATGCTGTGTTGGCT
AGTTCCTTCCTTGGATGTCTGAGCGAACTTATCTTCCCCAAATTTGAGCTTAAGCCACAC
GAGCAGTAGTTTCTAAAATTGGATGTCTTAATTTTTATTGTCTCTTCTAGGTGTATGAAG
GTGAAAGGGCCATGACCAAGGACAACAACCTGCTTGGAAAGTTCGAGCTCACAGGCATCC
CTCCAGCACCCCGTGGGGTCCCTCAGATTGAGGTTACTTTTGACATCGATGCCAATGGCA
TCCTCAATGTTTCTGCTGTAGATAAGAGCACAGGAAAGGAGAACAAGATCACCATCACCA
ATGACAAGGGTAAGTATGGACCTGCTGCTTTCTTTCTGAATAGAAAGAACAAGGTTTGCT
CTTACCATTAAAGAGACATGCTCATGATTTTGTAACTTTCATCATCAGGCCGCTTGAGTA
AGGAAGATATTGAGCGCATGGTCCAAGAAGCTGAGAAGTACAAGGCTGAGGATGAGAAGC
AGAGAGATAAGGTTTCCTCCAAGAACTCACTGGAGTCCTATGCCTTCAACATGAAAGCAA
CTGTGGAAGATGAGAAACTTCAAGGCAAGATCAATGATGAGGACAAACAGAAGATTCTTG
ACAAGTGCAATGAAATCATCAGCTGGCTGGATAAGAACCAGGTATGTGTTTTGCCAATAA
GTAGATGTTCATTCAGAAAAGGGCTGAGAGGGGTCACAATGATGATGAATGGTCCAAACA
TTCGCGGTTTCCACCAGAACGCAAGGCAGTGTTGGCAGTTACCTTCCTTGGATGTCTGAG
TGACTCAATAGCTAAGGGTTCTTTAGGCTTAGTTGTCAGTCTCCTCCCCCCAAAGTAATT
GGAGATCTTTTAATAAATTTGATTTCTTTTTTCTCAGACTGCAGAGAAGGAAGAATTTGA
GCATCAGCAGAAAGAACTGGAGAAAGTCTGCAACCCTATCATTACCAAGCTGTACCAGAG
TGCAGGTGGCATGCCTGGGGGAATGCCTGGTGGCTTCCCAGGTGGAGGAGCTCCCCCATC
TGGTGGTGCTTCTTCAGGCCCCACCATTGAAGAGGTGGATTAAGTCAGTCCAAGAAGGTG
TAGCTTTGTTCCACAGGGACCCAAAACAAGTAACATGGAATAATAAAACTATTTAAATTG
GCACCATACAGTTGTCCTGACTGAGTTAAATGTAAGAAACAGGGACAGGTTGAGACGGTC
TTGTCTCTAGCTGGCCTAGGATTTAGGTGCTTCTCAAGCTGGGAGAGCCAACACTGCCAG
TAAGCAGGTCTAGCCCCAGGCTACAGGTTTACCTTGAACCTGGATAACATTTGACAAGCT
AAATGAACACAGGGTGCTGGTTCTCAGCTATGAAATCTATGGGTGCAGATGGGGACTTGG
CCTTCTAAGTCCATTTGCTTGTATAATCTAGTGTTAAACTGCCACCTAGTGGCCAGCCTT
GTTTCAGAGGTCTGCATGCAGCAAAGCCTAGTAACTTGATGTAGTACTAATAATTAGGGG
AGAATAAAGGCTCGCCTTTAATGCCAGTACTTGGGAGGTAGATTCCTGAGGCCAGCCGGG
TCTACCAGAGTTCCAGGGCTAAACAAACCCTGCTTTTTTCATCTGCTGGGAGTACTGTCA
TGCTGAGTGAGGTCCATCTGCAGCCTCTGGCACTTGGTATTTCTAATACTACTGGATGTT
TTGCCTTGGCAGGAGACTGCTCTTCTAGTTCCCTAATGTTGGGATTAAACTGCCATTCTA
CTGTACTGAAAGTTGGGGAGATACATGTAATTTAATAGGATAGGGTACTTAGGTCCAGAC
AACCAACTGCAAGGAAATTTTTCTGTGCAGCGTTCATCTGAAACCCATGGTGGTTGCTGT
TATAAGAACATTTCAGTTTTCCTTTTTAAGTGATAGTGTGGGTGCACAACTGGGGTTAGA
ATAGATCAAATGTGTATTTTGGGGACTGAAGGCAGGCAGTAGGCTTGCTAGTACAACTGT
TCCCCTGCCCCCTACACTTGGAAGTCATGCCTGGGCTTGCACAAAATGGTTAAACTGATT
TTGCTGAGAATTGTGTAGTACTAAAAGTGAAAACTAAGTTTATGGAAAAGCCTTGGAATT
AAGTCAAGTTATAAGTAAAACTAGAGGATGTTAAGCGTGAGCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1073, 1643..1852, 2143..2348, 2464..2616, 2699..3254, 3465..3667, 3890..4088, 4188..4420, 4657..4924
1648..1852, 2143..2348, 2464..2616, 2699..3254, 3465..3667, 3890..4088, 4188..4420, 4657..4839
NM_031165.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved