Mus_musculus Locus Ppan
snOPY snoRNA Orthological Gene Database
Mus_musculus Ppan
Mus_musculus
Ppan
9
SNORD105
2216..2298
5908
CATCTCCAGGCCTCATATGGCAAAAGGAAAGAACCAACTCTTTTTTTAAAGAGTTATTT
ATTATATGTAAGTACACTGTAACTGTCTTCAGAAACACCGGAAGAGGGCGTCAGAACTCA
TTATGGTTGGGAGCCACCTTGGGGTTGCTGGGATTTGAGCTCAGGGCTTTCGGAAGAGCA
GTCAGTGCTCTTAACCGTTGAACCATCTCTTCAGCCTGAGAACCAACTCTTAAAAATGAC
CCTCTGATCTCCTCATATGCACCACCACAGATTGGCCTAGTCGGCCATCACTGGAAAGAG
AGGCCCATTGGACACGCAAACTGTATATGCCCCAGTACAGGGGAACGCCAGGGCCAAAAA
AAAAAAAAAAATGGGAATGGGTGGGTAGGGAAGTGGGGGGGAGGGTATGGGGGACTTTTG
GGATAGCATTGGAAATGTAACTGAGGAAAATATGTAATAAAAAATATTTAAAAATAAATA
AATAAATACAATCTATTTGGAGAGGGGGTGGACATGGTGGTACAAGTCTTTAGTTCCTGT
CCTTGGAAGATACGGGCCCACGGATCTGTGTGAGTTTAGTCAGCCAGGAAGGGTGGCACA
TGCCTCTAATCCCAGCGCTCAGTGTACGCACGCGGATCTCTGTTAGTTGCAGGCCAGCGT
GGGCTGCGTGAGATCCTGTTTCAGAATAAAAAACTGAAAGGCCAAACAAAGGGGGCAGTA
CGCTTGCCGAAACGTTCAGGATAGGGACTCGAACCCTCAAATAATTGTGAGGCCCCTCTC
TTTTGTGCAAAAAGGACCACGGCATCTTTATAAAGACCCCTGGAAAGGATTCTCGGTCCT
TTAAGCCGTCCGGAGCCAAGGACCGTTGGATGACGTCACTGGCCGGCACGCAGGAAGTGG
GAAGAGTTACGAGCCGCGTGGCACCGGAAGTTGGCCACGTAAAGTCCGTCCTCTTTGCGT
CTCCTGCACGGAAGTGAGCGGTGTGCGCCGGAAGCGAATACAGAGGCTGCCTCGTGGGGA
AGCAGGCAGCATGGGGCAGTCCGGGCGGGTGAGGCGCGGCGGCCTGGGCGGGCATGGGGC
ACTGGTGGGGTCGCGGCCGAAGCTTGGGCGCTCACCGCCTGCCTGTCGTCCCCGCAGTCC
CGACATCAGAAGCGCAATCGCGCCCAGGCGCAGCTCCGCAACCTCGAGTCCTACGCTGCA
CAGCCGCACTCGTTCGTGTTCACGCGAGGCCGAGCGGGTCGCAATGTCCGGCAGCTCAGC
CTGGATGTGCGGCGGGTCATGGAACCTCTCACCGCTACCCGCCTGCAGGTCTGTATCCCT
CAGCCCTTCAGCTCCAGGTTCGGGGCTCGGCATCTTGGCGAGGACTTGGGGCCAGAAGCT
GAGCGCCTGCCTTCCATGTGGGAGGGCTTGGCTGAATCCCCAGCACCTCTGACCCAGGCT
TAATGGTGTGCAGGCGAAATCGGGAATAGAATCGAGGGGGAAGATCACCATAGAGACCAT
CTGTGGTTACATAGTGAGGTCTTGTGTAAAAAACGGAAAGTCATACTTTGGGGGCAATCG
CTAGGTGACTCAGTGGGAAAGGGGGCTTGCTGTTAAACTGTAGTTCAATTCCTGTGCCCC
ACGTAGTGGAGGGGGTGAAACAGCTCCTGAAGTCCTCTGACCTCCATCTTTGCGTCCCTC
CCAACAGGCTTGTAAAAAATACTTTTTAAAGAGTATTTTTGAGTGCTGGGGCAATAGTTT
AGGGGTACAGGTAAAACCCCAATACCTCCAGAAAGGAGTGTGTGGTCAGAAATACCATCT
CAGAATAATCGTTTAAACGTCTTCTCTCAATGTTTGTGTCCGTTTCTTTTTTTTTTTTTT
AAAGATTTATTTATTTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAG
AGGGTCTCAGGTCTCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAAC
TCTGGACCTTCGGAAGAACAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCCT
TGTGTCCGTTTCTTTCTCCATTTATCAGGTTCGAAAGAAGAACTCCCTGAAGGACTGTGT
GGCAGTGGCTGGCCCCCTGGGGGTCACACACTTCCTTATTTTGACCAAAACAGATAACAG
TGTATACTTGGTGAGTGCGCGCCACACCGTCCCTTTCCCTCCCTGAGCCCCAGCTGCTCC
TGTCTGATGATGAGCCCATTGCCCTGAGCTCTTGTGATGCTGGCTTCAAAGTAAACGCTC
TGAAGTGAAGGAGCAGGGCTTTCCCTTCTCTCGCCCCACCCGCCAGCCAGACCCCTGCAC
CCTCACCCACCCTTTCTTTGGCAGAAGCTGATGCGGCTCCCAGGAGGCCCCACTTTGACG
TTCCAGATCAGCAAGGTGAGAAGGGTAGATATGAGAGCCCGGCTTGCCTGGGGAGGGCCC
TGGTCACACGGGTGCTTAGCCTCTCTTCTCCCTCCTTTCAGTATACACTGATACGGGACG
TGGTCTCTTCCCTGCGCCGACACCGGATGCACGAGCAGCAGTTTAACCACCCTCCCCTCC
TGGTGCTCAACAGCTTCGGCCCCCAGGGCATGCACATCAAGCTCATGGCCACCATGTTCC
AGAACCTGTTCCCGTCCATCAACGTGCACACGGTGGGCCAGATCTGTGACAGCTGCCGGG
GCCAGGGTTGGACAGTTGGAGGGGGAGCAGACCACATGTTACGCCTCCATTGAGTGGAGA
GACTCGCTTGGCATAAAGCAACTGATTTGATGTTAAATTCGGAGGCGGGGCTAGGAGTTG
ATAGGAGGGTCTCATATATCTCAAGCTGGCCTCCAACTTTGAGGCTGATGCTGGACTTGA
ACTTCTGATCTTCCATCTCTTCTGTGCTTAGTACACCTTGAAAGGTGTTGGGCTTTGTGC
ATTGTAGGCCGGCACTCTGCCAACTAAGCCATTTCTCTGCCCCTTATTCTGGATTCAAGG
TCGTATGTTAGACCAGGCTAGGATTAGACTTGTGGTCTTTTCTAATAAGCCACCTAGGAA
GACTAGAGTGTCAAGTACGCTCCTGGCTCCAGAGCTTCAGATGCTAAACCCTGGCATCAG
TGCTTCTCAGATTAGGTTCCTTACAATGTCTTAAGTCTGGTGGTTGGCTTTGGTGGCCCC
TTTAGCCAGTGCTTCAGACAGTCTGAGGACTCTGGTTGTAGTAGCCCCTAACACCTGCAC
TAGGCATCCTAGTGCCTTCTGCAGACACAGACTGCTGGAGAAAGCTACACTCCTTCCCAG
CTTGGTCCCTGGTTTCAGCACATAGTTCCCCAGGCAGGCGGCTCACGGTCCCCTTGCCTC
TACTCCCAGGTGAACCTGAACACCATTAAGCGCTGCCTCCTCATTAACTACAACCCTGAC
TCCCAAGAGCTGGACTTCCGACACTAGTGAGTGTTGGTGAGAGGGAGGGAGGGACTCAGT
GTGGGACACCCGTGCACCTGATGAGAATTCTGCTGCTGAGGTTGTGTGATTGCTCAGACT
CAAAGTAAACGCCCTGATGCATGTACAGGAGAGGGCAGAGAGCTGACCGTGGACTCCATG
ACCATTCACCTCTCCCCCTACTCCCGCCATTGCAGCAGCGTCAAAGTGGTTCCCGTGGGT
GCAAGCCGCGGCATGAAGAAGCTCTTACAGGAGAAGTTCCCTAACATGAGCCGACTGCAG
GACATCAGTGAGCTGCTGGCCACGTAAGTAAGAAAGCTGGTGGGTGGCAGCTGCACCTGT
GGAGCGCCCAAGGTAACCTGTTGTTTTACACAGGGGTGTGGGGCTATCAGACAGTGAGGT
GGAGCCAGATGGAGAACACAACACCACAGAACTGCCCCAGGCTGTGGCCGGCCGTGGCAA
CATGCAGGCCCAACAGAGCGCCGTCCGACTTACTGAGGTGAGGGTGGCTATGGTGGCCCT
CTCAGCTCCCAGTCACAAGGCTAGCCTGACTCTCTTCCCATTCCCCTGTGTTGGCAGATT
GGGCCCCGGATGACACTGCAGCTCATTAAGATCCAGGAGGGCGTCGGGAACGGCAATGTC
CTCTTCCACAGTTTTGGTGAGGGGACAGGGTGAGGCCAGCCCGTGAGAGCAGTGTCGAGT
CCCACTGTGACGTTGACAGATTGTCTGATCCTTCCTCACAGTACACAAGACAGAGGAGGA
GCTGCAGGCCATCCTGGCAGCCAAGGAGGAGAAGCTCCGGCTGAAGGCACAGCGTCAGAA
CCAACAGGCAGAGAACTTGCAGCGCAAGCAGGAGCTGCGCGAGGCCCACAAGAAGAAGAG
CCTGGCAGGCATAAAGCGAGCCCGTGCAAGGGCCGACGGTGACAGTGATGCTGAGGACCC
AGGGGCACCGCCAGAGGCAGTGGGGGCAGGTCAGCCTGAAGATGAAGAGGATGACGCTGA
GTATTTCCGCCAGGCTGTGGGGGAGGAGCCTGACGAAGGTATGTGGCAGGGTCCTCTGGT
GACACCTTGGCCCTTTTCATTTCTTCTCCATTAATCACATTTAACCACTTCTCTCCCTGC
AGACTTGTTCCCCACAGCGGCCAAGCGGAGACGGCAGGGGGGCCCTCTGGGCAAGAAGCA
GCGAGGGAAGGAGCAGAGGCCTGGTAATAAAGGCCGAGGTCAGGGTGGCAACTGGCAGGC
TCTGAAGCTACAAGGTAGATCCCAGAGAGGCAAGGCCAAGCCGAGACCCAGAGCCACACA
CCAGGACTCACGCCCAGCATCAAGGAGAAGAAACTGAACCTGCCGGCAGTGGGTGGACTA
TGGATGCCCCAGATTGGGGCCCGGAAGCTGCCTGGGATCCAGTGCAGTCCGGTTTCCTTT
TATAAAGGAACTGCCCAGTTCTTAACCTCCAATAAACCTGAACATGGTGCTTTTTGAGTC
TTCACTCTGGTTGGGGGAGGGCAGAGCTAGCAGTACTTGGATAGTATAAGGAGGAAGTGG
GCTAGGTGGGAGGTGTCACACTGACTAGCAGTAGAGATAGGCCAGTGACCAGACTGCTGG
GAACTCAGGCCAGGTGGGACCAGAAGCTGCTGTGAGGATTATGTCTGCCCCCTCAGGTAA
CCAGGTGCCAGCTCAGGGACATGAAGGGAAGGGTGGTGGGAGGGTGCTAAGGGAGCTTAA
GGTGGCCAGGCCAGAAGTAACCACACTGCATGTGGTTCTTACGGCTGCTGGGAGGGGAAC
CGTGCAAGACTGCAAATTGGGAGCAGAGTTTGGAATGTTATCTGTAATGGGACCTGATGC
ATTCCTCAGAATGAGTGATGTGATGTCTCCACCTGCACCATGCTGTGTCATCGTGTGTGT
CCGAAGACAGCTGCAGTGTAATTATTTAATCTTTTTTTAAAGAATTTTTATTTATGTGAG
TAAACTAGCTGTACAGATGGTTGTGAGCCTTCATGTAGTTGTTGAGAATTGAGTTTTAGG
ACCTCTGCTCACTCCAGCCCAAAGATTCATTATTATACATAAGTACACCGTAGCTGTCTT
CTGGCACCCCAGAAGAGGGAGTCAGATCTCAATACAGGTCATGTGGTTGCTGGGATTTGA
ACTCAGGACCTTTGGAAGATCAGTCAGTGCTCTTAACCACTGGCCACCTCTCCAGCCCTC
CCTCCACCTTCTTAAGGAATTTCATGTGTGTGTAGTGTGCTGTTTATATGTGGAGGTCAA
AGGTCAGTGCCAGGCATCTTCCTTAATTGCAGTCAGCGCTCTTACCCACTGAGCCATCAT
CTCACCAGCCCCCTACATAATAAATCTTAAAAACAATATTTGGGAGCTGCTGGCAAGTAC
TTAAGTTTCCAGGACTTCCTCTGGCTCATCCTGATGGCAGGGCTCCACAGTAGCAACAGT
CTCTTCCTGTGCCATTTCTTTCCCCCGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1047, 1137..1307, 2068..2169, 2364..2414, 2501..2671, 3369..3445, 3635..3742, 3813..3936, 4017..4095, 4181..4477, 4562..4908
1030..1047, 1137..1307, 2068..2169, 2364..2414, 2501..2671, 3369..3445, 3635..3742, 3813..3936, 4017..4095, 4181..4477, 4562..4773
NM_145610.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved